Application of rice OsIDD14, OsIDD12 and OsIDD13 proteins in leaf structure control

Abstract

The invention discloses an application of rice OsIDD14, OsIDD12 and OsIDD13 proteins in the control of a leaf structure. The invention belongs to the technical field of biology, and particularly relates to application of a group of IDD proteins and related biological materials thereof in controlling rice leaf structures. The invention provides application of proteins OsIDD14, OsIDD12 and OsIDD13 or substances for regulating and controlling expression of the proteins OsIDD14, OsIDD12 and OsIDD13 or substances for regulating and controlling activity or content of the proteins in regulation and control of plant leaf structures. Experiments prove that the protein OsIDD14, the protein OsIDD12 and the protein OsIDD13 jointly regulate and control the rice leaf structure, and through gene knockout of the OsIDD12, the protein OsIDD13 and the protein OsIDD14, it is found that the protein OsIDD12, the protein OsIDD13 and the protein OsIDD14 can control the leaf vein number and the leaf vein density of rice leaves and control the anatomical structure of the rice leaves to be closer to C4 gramineous plants, and important theoretical significance is achieved for creation of photosynthetic advantage C4 rice and rice breeding.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to the application of rice OsIDD14, OsIDD12 and OsIDD13 proteins in controlling leaf structure. Background Art

[0002] Photosynthesis is the source of material and energy for rice growth and development, and also the metabolic basis for the accumulation of starch and other nutrients in the grain. Improving photosynthesis efficiency is a key physiological and biochemical basis for increasing rice yield. Rice is a typical C3 plant, and the key enzyme that catalyzes CO2 fixation through photosynthesis is ribulose-1,5-bisphosphate carboxylase / oxygenase (RuBisCo). RuBisCo has low carboxylation efficiency and also possesses oxygenase activity. The low CO2 environment within the leaves caused by frequent stomatal closure increases RuBisCo oxygenase activity, resulting in reduced photosynthetic efficiency. Furthermore, stomatal closure promotes photorespiration in C3 rice, which significantly reduces photosynthetic efficiency and leads to yield losses. Photorespiration has been reported to cause a 30% yield loss in rice.

[0003] Nature has evolved highly photosynthetic C4 plants, where initial CO2 fixation is accomplished by phosphoenolpyruvate carboxylase (PEPC) in mesophyll cells. PEPC possesses a high carboxylation efficiency, generally believed to be thousands of times more efficient than RuBisCo carboxylase. PEPC's high carboxylation efficiency reduces the amount of carboxylase required for C4 photosynthesis, thereby significantly reducing the nitrogen (N) requirement of C4 plants. (To meet photosynthesis requirements, C3 plant leaves produce over 50% of their total protein content as RuBisCo, consuming significant amounts of amino acids.) CO2 fixation in C4 plants occurs in two cell types: PEPC-catalyzed carboxylation occurs in mesophyll cells (M). The resulting carbon 4 compound is actively transported to bundle sheath cells (BS), where it undergoes decarboxylation and releases CO2, which then completes the Kelvin cycle. This concentration of CO2 in the sheath cells inhibits RuBisCo oxygenase activity within the BS, thereby suppressing photorespiration and significantly improving photosynthetic efficiency. C4 plants achieve higher nitrogen utilization rates than C3 plants because they only require a small amount of PEPC to meet CO2 carboxylation requirements. Furthermore, the CO2 concentration mechanism in C4 plants allows them to maintain a certain level of photosynthesis even after stomata close in the face of high temperatures and water deficits, resulting in higher water (H2O) utilization efficiency.

[0004] Introducing the C4 pathway into C3 crops like rice is a technological approach with great potential to improve photosynthetic efficiency. It can also improve the water use efficiency and nitrogen use efficiency of rice, meeting the new requirements of high-yield, high-efficiency and environmentally friendly agricultural production. C4 photosynthesis must be carried out in two types of cells (see Figure 1) is completed, of which the mesophyll cells only have the function of fixing CO2 (completed by PEPC), while the vascular bundle sheath cells carry out the Kelvin cycle of CO2 assimilation. C4 plants have accordingly evolved a special anatomical structure with high vein density adapted to the C4 photosynthetic pathway. In the leaves of C4 grasses, the ratio of the number of vascular bundle sheath cells to mesophyll cells between adjacent veins (vascular bundles) is 1:1. This is a specific anatomical structure that all C4 crops such as corn, millet and sorghum have (see Figure 1 In C3 photosynthetic crops such as rice, the ratio of bundle sheath cells to mesophyll cells between adjacent veins (vascular bundles) is approximately 1:4 (see Figure 1 Increasing the number / density of leaf veins or reducing the number / density of mesophyll cells is the key to changing the structure of rice leaves to form a C4 leaf structure. The veins of rice leaves are typical parallel veins, consisting of a midrib (main vein) in the center of the leaf, multiple large veins on both sides of the midrib, and many small veins between the large veins, which are parallel along the longitudinal direction (longitudinal axis) of the leaf. These parallel veins are connected in the transverse direction of the leaf by connecting veins (reference: Sakaguchi J. & Fukuda H., Cell differentiation in the longitudinal veins and formation of commissural veins in rice (Oryza sativa) and maize (Zea mays), Journal of plant research, 2008, 121: 593-602). Large veins are also called large vascular bundles, and small veins are also called small vascular bundles (reference: Zou Liangping, Peng Ming, Research progress on rice leaf vein development, China Agricultural Science and Technology Herald, 2013, (1): 43-47). The veinlets of C4 plants in the grass family have obvious morphological differences from those of C3 plants. The cross-sectional area of ​​the veinlets of C3 plants is basically the same, and the thick-walled cells distributed above and below them enhance their mechanical support. However, the veinlets of C4 plants have two types. The veinlets that differentiate additionally in the early stages of leaf development have a smaller cross-sectional area than the veinlets differentiated in the first round, and the thick-walled cells above and below the additionally differentiated veins are missing (they are replaced by mesophyll cells / thin-walled cells). Currently, the mechanism that controls the formation of the two types of veinlets in C4 plants is poorly understood, and the genes that regulate them are still under investigation.

[0005] Scientists have successfully introduced multiple enzymes required for the C4 photosynthetic pathway into rice, but have yet to establish effective C4 assimilation in rice leaves. This is due to the lack of simultaneous development of C4-like anatomical structures in rice leaves. This suggests that the success of C4 rice requires not only the proper expression of C4 metabolic enzymes but also the development of a compatible C4 leaf anatomical structure. Currently, only a few genes controlling leaf vein density have been reported, and there are also no reports of genes controlling the formation of C4-like anatomical structures in rice leaves. Summary of the Invention

[0006] The technical problem solved by the present invention is how to synchronously construct an anatomical structure similar to that of C4 plants in rice leaves.

[0007] In order to solve the above technical problems, the first aspect of the present invention provides any of the following applications:

[0008] A1) Use of a protein or a substance regulating gene expression or a substance regulating the activity or content of the protein in regulating plant leaf structure and / or plant type;

[0009] A2) Use of a protein or a substance regulating gene expression or a substance regulating the activity or content of said protein in the preparation of a product for regulating plant leaf structure and / or plant type;

[0010] A3) Use of a protein or a substance regulating gene expression or a substance regulating the activity or content of said protein in cultivating plants with altered leaf structure and / or plant type;

[0011] A4) Use of a protein or a substance regulating gene expression or a substance regulating the activity or content of said protein in the preparation of a product for cultivating plants with altered leaf structure and / or plant type;

[0012] A5) Use of proteins or substances regulating gene expression or substances regulating the activity or content of said proteins in plant breeding;

[0013] The proteins are OsIDD12 protein, OsIDD13 protein and OsIDD14 protein:

[0014] The OsIDD12 protein is any one of the following:

[0015] B1) a protein having an amino acid sequence of SEQ ID No. 3;

[0016] B2) a protein obtained by substituting and / or deleting and / or adding amino acid residues of the protein of B1) and obtaining a protein having at least 80% identity with the protein of B1) and having a function related to regulating plant leaf structure;

[0017] B3) a fusion protein obtained by linking a protein tag to the N-terminus and / or C-terminus of B1);

[0018] The OsIDD13 protein is any one of the following:

[0019] C1) a protein having an amino acid sequence of SEQ ID No. 5;

[0020] C2) a protein obtained by substituting and / or deleting and / or adding amino acid residues of the protein of C1) and having at least 80% identity with the protein of C1) and having a function related to regulating plant leaf structure;

[0021] C3) a fusion protein obtained by linking a protein tag to the N-terminus and / or C-terminus of C1);

[0022] The OsIDD14 protein is any one of the following:

[0023] D1) a protein having an amino acid sequence of SEQ ID No. 1;

[0024] D2) a protein obtained by substituting and / or deleting and / or adding amino acid residues of the protein of D1) and having at least 80% identity with the protein of D1) and having a function related to regulating plant leaf structure;

[0025] D3) A fusion protein obtained by linking a protein tag to the N-terminus and / or C-terminus of D1).

[0026] The above proteins can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0027] In the above proteins, the tag refers to a polypeptide or protein that is fused and expressed with the target protein using in vitro DNA recombination technology to facilitate the expression, detection, tracing, and / or purification of the target protein. The tag can be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST, GFP tag, and / or SUMO tag, etc.

[0028] In the above application, the protein is derived from rice.

[0029] In the above applications, the substance that regulates gene expression or the substance that regulates the activity or content of the protein is a biological material related to the protein, and the biological material is any one of the following:

[0030] E1) a nucleic acid molecule encoding the protein of the first aspect;

[0031] E2) an expression cassette containing the nucleic acid molecule described in E1);

[0032] E3) a recombinant vector containing the nucleic acid molecule described in E1), or a recombinant vector containing the expression cassette described in E2);

[0033] E4) a recombinant microorganism containing the nucleic acid molecule described in E1), or a recombinant microorganism containing the expression cassette described in E2), or a recombinant microorganism containing the recombinant vector described in E3);

[0034] E5) a transgenic plant cell line containing the nucleic acid molecule of E1), or a transgenic plant cell line containing the expression cassette of E2);

[0035] E6) transgenic plant tissue containing the nucleic acid molecule described in E1), or transgenic plant tissue containing the expression cassette described in E2);

[0036] E7) a transgenic plant organ containing the nucleic acid molecule of E1), or a transgenic plant organ containing the expression cassette of E2);

[0037] F1) a nucleic acid molecule that inhibits, reduces or silences the expression of the gene encoding the protein according to the first aspect;

[0038] F2) an expression cassette containing the nucleic acid molecule described in F1);

[0039] F3) a recombinant vector containing the nucleic acid molecule described in F1), or a recombinant vector containing the expression cassette described in F2);

[0040] F4) a recombinant microorganism containing the nucleic acid molecule described in F1), or a recombinant microorganism containing the expression cassette described in F2), or a recombinant microorganism containing the recombinant vector described in F3);

[0041] F5) a transgenic plant cell line containing the nucleic acid molecule of F1), or a transgenic plant cell line containing the expression cassette of F2);

[0042] F6) transgenic plant tissue containing the nucleic acid molecule described in F1), or transgenic plant tissue containing the expression cassette described in F2);

[0043] F7) A transgenic plant organ containing the nucleic acid molecule of F1), or a transgenic plant organ containing the expression cassette of F2).

[0044] In the above, the substance that regulates gene expression or the substance that regulates the activity or content of the protein may be a substance that regulates gene expression.

[0045] In the above, the substance that regulates gene expression may be a substance that performs at least one of the following six types of regulation: 1) regulation at the transcription level of the gene; 2) regulation after transcription of the gene (that is, regulation of the splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (that is, regulation of the transport of the mRNA of the gene from the cell nucleus to the cytoplasm); 4) regulation of the translation of the gene; 5) regulation of the degradation of the mRNA of the gene; 6) post-translational regulation of the gene (that is, regulation of the activity of the protein translated from the gene).

[0046] Specifically, the substance that regulates gene expression can be a substance that increases gene expression or a substance that increases the activity or content of the protein, or a substance that reduces gene expression or a substance that reduces the activity or content of the protein.

[0047] More specifically, the substance that reduces gene expression or the substance that reduces the activity or content of the protein is a substance that inhibits, reduces or silences the expression of the gene, such as an agent that knocks out the gene by homologous recombination, or an agent that knocks out the gene by CRISPR / Cas9. The agent that inhibits, reduces or silences the expression of the gene may comprise a polynucleotide targeting the gene, such as siRNA, shRNA, sgRNA, miRNA or antisense RNA.

[0048] In the present invention, the reagent for inhibiting, reducing or silencing the gene expression includes sgRNA targeting the OsIDD12, OsIDD13 and OsIDD14 gene target 5'-CCTCGTCGGCATCAAGAAGCACT-3' or a nucleic acid molecule containing the gene encoding the sgRNA or a recombinant vector expressing the sgRNA.

[0049] More specifically, the substance that inhibits, reduces or silences gene expression or the substance that inhibits, reduces or silences the activity or content of the protein is any one of F1-F7.

[0050] In the application described above, the nucleotide sequence of the recombinant vector in F3) is obtained by connecting SEQ ID NO. 7 and SEQ ID NO. 8 in sequence end to end (the last base of SEQ ID NO. 7 is connected to the first base of SEQ ID NO. 8).

[0051] In the above biological materials, the nucleic acid molecules in E1) are nucleic acid molecules encoding OsIDD12 protein, nucleic acid molecules encoding OsIDD13 protein, and nucleic acid molecules encoding OsIDD14 protein;

[0052] Each of the above nucleic acid molecules is a DNA molecule shown as any of the following:

[0053] D1) the nucleotide sequence is a DNA molecule represented by SEQ ID No. 2 (OsIDD14 protein encoding gene), SEQ ID No. 4 (OsIDD12 protein encoding gene), or SEQ ID No. 6 (OsIDD13 protein encoding gene);

[0054] D2) the coding region sequence is positions 7 to 1323 of the DNA molecule shown in SEQ ID NO. 2 in the sequence listing (OsIDD14 protein encoding gene); or the coding region sequence is positions 8 to 1609 of the DNA molecule shown in SEQ ID NO. 4 in the sequence listing (OsIDD12 protein encoding gene); or the coding region sequence is positions 4 to 1518 of the DNA molecule shown in SEQ ID NO. 6 in the sequence listing (OsIDD13 protein encoding gene).

[0055] The nucleic acid molecule described herein can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA or antisense RNA.

[0056] In the above F3), the backbone of the recombinant vector may be a plant gene editing vector. The backbone of the plant gene editing vector may be a pYLCRISPR / Cas9Pubi-H vector.

[0057] As a specific embodiment, the recombinant vector is the recombinant vector pCRISPR-OsIDD12 / OsIDD13 / OsIDD14. The recombinant vector pCRISPR-OsIDD12 / OsIDD13 / OsIDD14 is formed by inserting a DNA fragment containing the target site sequence 5'-CCTCGTCGGCATCAAGAAGCACT-3' between the restriction endonuclease BsaI cleavage sites of the pYLCRISPR / Cas9Pubi-H vector. The nucleotide sequence of the recombinant vector pCRISPR-OsIDD12 / OsIDD13 / OsIDD14 is SEQ ID NO. 7.

[0058] The microorganism described in F4) above may be Agrobacterium tumefaciens, and the Agrobacterium tumefaciens may be EHA105.

[0059] Those skilled in the art can readily employ known methods, such as directed evolution or point mutagenesis, to simultaneously mutate the nucleotide sequences encoding the OsIDD14 protein of the present invention, as well as OsIDD12 (for which the present patent applicant has been granted a patent, Invention Patent Certificate No. 7592666), and OsIDD13 (for which the present patent applicant has been granted a patent, Invention Patent Certificate No. 7592666). Artificially modified nucleotide sequences that share 75% or greater identity with the nucleotide sequence of the isolated OsIDD14 protein of the present invention are derived from and are equivalent to the nucleotide sequences of the present invention, as long as they encode the OsIDD14 protein and possess the function of the OsIDD14 protein.

[0060] The aforementioned 75% or greater identity may be 80%, 85%, 90% or 95% or greater identity.

[0061] As used herein, identity refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of an amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively, and performing a search to calculate the identity of the amino acid sequence, the value (%) of identity can then be obtained.

[0062] Herein, the greater than 80% identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0063] The vectors described herein are well known to those skilled in the art, including but not limited to plasmids, phages (such as lambda phage or M13 filamentous phage), cosmids (ie, cosmids), Ti plasmids or viral vectors.

[0064] Recombinant expression vectors containing the OsIDD12, OsIDD13, and OsIDD14 genes can be constructed using existing plant expression vectors. These include, but are not limited to, binary Agrobacterium vectors and vectors suitable for plant microprojectile bombardment. These plant expression vectors may also contain the 3' untranslated region of the exogenous gene, i.e., a polyadenylation signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylation signal can direct the addition of polyadenylic acid to the 3' end of the mRNA precursor. Examples of these untranslated regions include, but are not limited to, Agrobacterium crown gall-inducing (Ti) plasmid genes (e.g., the rouge synthase Nos gene) and plant genes (e.g., the soybean storage protein gene), all of which have similar functions.

[0065] When constructing recombinant plant expression vectors using the OsIDD12, OsIDD13, and OsIDD14 genes, any enhancing or constitutive promoter can be added before the transcription initiation nucleotide, including but not limited to the cauliflower mosaic virus (CAMV) 35S promoter and the maize ubiquitin promoter. These can be used alone or in combination with other plant promoters. Furthermore, when constructing plant expression vectors using the genes of the present invention, enhancers, including translation enhancers or transcription enhancers, can also be used. These enhancer regions can be the ATG start codon or an adjacent region start codon, but must be in frame with the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are diverse and can be either natural or synthetic. The translation initiation region can be derived from the transcription initiation region or a structural gene.

[0066] To facilitate identification and screening of transgenic plant cells or plants, the plant expression vectors used may be modified to include, but are not limited to, genes encoding enzymes or luminescent compounds that can be expressed in plants (such as the GUS gene, GFP gene, and luciferase gene), antibiotic resistance markers (such as gentamicin markers, hygromycin markers, and kanamycin markers), or chemical resistance marker genes (such as herbicide resistance genes). For the safety of transgenic plants, it is possible to omit any selectable marker genes and directly screen for transformed plants using stress.

[0067] In a second aspect, the present invention provides a method for regulating plant leaf structure and / or plant type, comprising the following steps: regulating the activity and / or content of the protein described in the first aspect in the target plant, or / and regulating the expression level of the gene encoding the protein described in the first aspect, to regulate the plant leaf structure and / or plant type.

[0068] In a third aspect, the present invention provides a breeding method for cultivating plants with altered leaf structure and / or plant type, comprising the following steps: regulating the activity and / or content of the protein described in the first aspect in the target plant, or / and regulating the expression level of the gene encoding the protein described in the first aspect, to obtain plants with altered leaf structure and / or plant type.

[0069] In any of the methods described above, the regulation is achieved by simultaneously regulating the expression of genes encoding proteins OsIDD12, OsIDD13 and OsIDD14.

[0070] In any of the methods described above, the regulation is downregulation, inhibition, or reduction. Specifically, the reduction of the activity and / or content of the protein described in the first aspect in the target plant, or / and the reduction of the expression level of the gene encoding the protein described in the first aspect, comprises the following steps: introducing a recombinant expression vector comprising a nucleic acid molecule that inhibits, reduces, or silences the expression of the gene encoding the protein described in the first aspect into a recipient plant, thereby obtaining a target plant with altered plant leaf structure; the encoding gene encodes the protein described in the first aspect.

[0071] In the above, introduction refers to introduction by recombinant means, including but not limited to Agrobacterium-mediated transformation, biolistic methods, electroporation and in planta technology.

[0072] Using any vector capable of directing exogenous gene expression in plants, the genes or gene fragments encoding the knockout proteins OsIDD12, OsIDD13, and OsIDD14 provided herein can be introduced into plant cells or recipient plants to obtain transgenic cell lines and transgenic plants with altered plant leaf structure. Expression vectors carrying the genes encoding the knockout proteins OsIDD12, OsIDD13, and OsIDD14 can be transformed into plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, and Agrobacterium-mediated transfection, and the transformed plant tissues can be cultivated into plants.

[0073] The microorganisms described herein may be yeast, bacteria, algae, or fungi. The bacteria may be from the genera Escherichia, Erwinia, Agrobacterium, Flavobacterium, Alcaligenes, Pseudomonas, and Bacillus, among others. Specifically, the bacteria may be Agrobacterium tumefaciens EHA105.

[0074] In the present invention, the purpose of plant breeding may include cultivating plants with modified leaf structures.

[0075] In the present invention, the leaf structure change may be to produce a C4 plant-like anatomical structure.

[0076] In the present invention, the leaf structure change can specifically be the formation of two types of anatomically distinguishable veinlets in the leaves of C4 grass plants, an increase in the number of leaf veins, an increase in the density of leaf veins, a decrease in the number of mesophyll cells between leaf veins, and / or a decrease in the density of mesophyll cells between leaf veins.

[0077] In the above, the increase in the number of leaf veins / increase in leaf vein density is reflected in the increase in the number of large veins, the increase in the density of large veins, the increase in the number of small veins and / or the increase in the density of small veins. The decrease in the number of mesophyll cells between leaf veins / decrease in the density of mesophyll cells between leaf veins is reflected in the decrease in the density of mesophyll cells between small veins and / or the decrease in the density of mesophyll cells between small veins. The formation of two types of small veins that are clearly distinguishable in the anatomy of C4 grass-like leaves makes the leaf configuration of C3 grass crops closer to that of C4 grasses, specifically, the increase in small veins with a smaller cross-sectional area and the absence of thick-walled cells (no mechanical support capacity) above and below.

[0078] The plant type change is to reduce plant height, increase tiller number and / or reduce the length-to-width ratio of flag leaf (leaf length / leaf width).

[0079] The production of the C4-like plant anatomical structure may be specifically embodied in any one of the following:

[0080] 1) The target plant (transgenic plant) has an increased number of major veins on its leaves compared to the recipient plant;

[0081] 2) the number of leaf veins of the target plant (transgenic plant) is increased compared to the recipient plant;

[0082] 3) the number of small veins between the large veins of the target plant (transgenic plant) is increased compared to the recipient plant;

[0083] 4) The amount of mesophyll between the major and minor veins of the target plant (transgenic plant) is reduced compared to the recipient plant;

[0084] 5) The amount of mesophyll between the veins of the target plant (transgenic plant) is reduced compared to the recipient plant;

[0085] 6) Compared with the recipient plant, the target plant (transgenic plant) has a greater number of major veins on its leaves than the recipient plant;

[0086] 7) Compared with the recipient plant, the target plant (transgenic plant) has a higher number of leaf veins than the recipient plant;

[0087] 8) Compared with the recipient plant, the number of small veins between the large veins of the target plant (transgenic plant) is higher than that of the recipient plant.

[0088] 9) Compared with the recipient plant, the target plant (transgenic plant) has less mesophyll between the major veins and minor veins than the recipient plant.

[0089] 10) Compared with the recipient plant, the target plant (transgenic plant) has fewer mesophyll between the veins than the recipient plant.

[0090] 11) Compared with the recipient plant, the target plant (transgenic plant) has two types of veinlets, forming a morphology of two types of veinlets similar to that of C4 grass crops.

[0091] The major veins may be secondary veins inferior to the middle (main) vein in monocotyledons.

[0092] The small vein may be a thin vein inferior to a secondary vein.

[0093] The major and minor veins together with the mid (main) vein constitute the parallel vein system of monocotyledonous plants such as rice.

[0094] The plant type change can be specifically embodied in any of the following:

[0095] 1) The plant height of the target plant (transgenic plant) is lower than that of the recipient plant;

[0096] 2) The target plant (transgenic plant) has a higher tiller number than the recipient plant;

[0097] 3) The length-to-width ratio of the flag leaf of the target plant (transgenic plant) is lower than that of the recipient plant.

[0098] In the above method, the plant is any one of the following:

[0099] G1) dicots or monocots;

[0100] G2) Graminales;

[0101] G3) Grasses;

[0102] G4) Oryza plants;

[0103] G5) Rice.

[0104] This study investigates how the proteins OsIDD12, OsIDD13, and OsIDD14 work together to alter rice leaf anatomy and produce a C4-like leaf structure. Using CRISPR-Cas9 gene editing, the OsIDD12, OsIDD13, and OsIDD14 genes were simultaneously deleted, resulting in a lack of normal OsIDD12, OsIDD13, and OsIDD14 protein products in rice. Verification of gene function revealed that the loss of OsIDD12, OsIDD13, and OsIDD14 proteins in rice resulted in two types of small veins resembling those of C4 grasses, increasing the number of small veins between larger veins while also reducing the number and density of mesophyll cells between veins, thereby increasing leaf vein density. This study is of great significance in the development of C4 rice, providing key structural control genes for the introduction of the C4 photosynthetic pathway into C4 rice. The present invention provides an important candidate gene for C4 rice breeding and provides a foundation material for promoting the creation of high-light-efficiency rice. BRIEF DESCRIPTION OF THE DRAWINGS

[0105] Figure 1 Schematic diagram of the anatomical structure of typical C3 plant (rice) and C4 plant (corn) leaves.

[0106] Figure 2 This is a schematic diagram of the effect of hand-slicing, which is used to screen transgenic materials (triple mutants) and strains with changes in leaf structures such as veins, as well as to count the number of veins and mesophyll cells of each transgenic material.

[0107] Figure 3 The relative expression levels of OsIDD12, OsIDD13 and OsIDD14 genes in plants expressing OsIDD12, OsIDD13 and OsIDD14 (triple mutants) were obtained.

[0108] Figure 4 The morphology of plants knocked out for OsIDD12, OsIDD13, and OsIDD14. The plant on the far left is the control Nipponbare, the plant in the middle is triple mutant-1, and the plant on the right is triple mutant-2. The white scale in the figure represents 20 cm.

[0109] Figure 5 Leaf morphology of OsIDD12, OsIDD13, and OsIDD14 knockout plants. The leftmost leaf is the flag leaf of the control Nipponbare plant, the middle plant is triple mutant-1, and the right plant is triple mutant-2. The white scale represents 15 cm.

[0110] Figure 6These are paraffin sections of flag leaves from plants knocked out for OsIDD12, OsIDD13, and OsIDD14. The upper left image shows a cross-section of a flag leaf from a control Nipponbare plant; the upper right image shows a cross-section of a flag leaf from a plant knocked out for both OsIDD12 and OsIDD13 (double mutant); the lower left image shows a cross-section of a flag leaf from triple mutant-1; and the lower right image shows a cross-section of a flag leaf from triple mutant-2. Arrows in the lower left and right images indicate areas lacking sclerenchyma cells above and below the veinlets. Black bars represent 100 μm.

[0111] Figure 7 The number of large veins in the flag leaves of plants with OsIDD12, OsIDD13, and OsIDD14 knockout was counted. The triple mutants (transgenic lines-1 and -2) showed a significant increase in the number of large veins compared to the Nipponbare control (p<0.05).

[0112] Figure 8 The number of venules in the flag leaves of plants with OsIDD12, OsIDD13, and OsIDD14 knockout was counted. The number of venules in the triple mutants (transgenic lines-1 and -2) was significantly increased compared to the Nipponbare control (p<0.01).

[0113] Figure 9 The number of interveinal mesophyll cells in the flag leaves of plants with OsIDD12, OsIDD13, and OsIDD14 knockout was counted. The number of interveinal mesophyll cells in the triple mutants (transgenic lines-1 and -2) was significantly reduced compared to the Nipponbare control (p<0.01). DETAILED DESCRIPTION

[0114] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0115] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0116] Unless otherwise specified, the quantitative tests in the following examples were performed three times, and the results were averaged.

[0117] The quantitative experiments in the following examples were performed in triplicate unless otherwise specified.

[0118] The japonica rice variety "Nipponbare" used in the following examples has been described in: Goff, SA et al., (2002). A draft sequence of the rice genome (Oryza sativa L. ssp. japonica). Science (New York, NY), 296(5565), 92–100. The public can obtain it from the Institute of Biotechnology, Chinese Academy of Agricultural Sciences. This biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0119] The backbone vector pYLCRISPR / Cas9Pubi-H in the following examples was obtained from Liu Yaoguang, State Key Laboratory of Conservation and Utilization of Subtropical Agricultural Bioresources, South China Agricultural University. It is described in: Ma, X. et al. (2015). A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Molecular Plant 8:1274-1284. For specific examples, please refer to our laboratory's doctoral dissertation, "Creation of Materials Overexpressing Maize Transcription Factors in Rice and Functional Study of the OsbHLH91 / OsbHLH92 Genes," by Shouzhen Teng (awarded 2022). The sequence is publicly available in the gene bank (GenBank: KR029109.1). The biomaterial is publicly available from the Institute of Biotechnology, Chinese Academy of Agricultural Sciences. This biomaterial is for use only in repeating the experiments described in this invention and is not for use for other purposes.

[0120] The statistical method used in the following examples was the student's T-test method built into the statistical software SSPS. The sample size was the Nipponbare wild-type control, and at least 11 individual plants were counted for each transgenic line.

[0121] Example 1. Acquisition of OsIDD12, OsIDD13 and OsIDD14 genes

[0122] 1. Acquisition of the OsIDD12 gene

[0123] The OsIDD12 gene was amplified by PCR using Phanta Max Super-Fidelity DNA Polymerase purchased from Vazyme. Total RNA from Nipponbare leaves 7 days after germination was used as a template for reverse transcription of cDNA. The primers used were: OsIDD12-F: 5-'GGACATCATGCTGAGTTCTTGCG-3', OsIDD12-R: 5-'

[0124] PCR amplification was performed using the PCR reaction system shown in Table 1 and the reaction conditions shown in Table 2. The resulting amplified product was sequenced. The coding sequence of the OsIDD12 protein in the rice variety Nipponbare is the nucleotide sequence shown at positions 8 to 1609 of SEQ ID NO. 4, and the amino acid sequence of the encoded protein is shown in SEQ ID NO. 3.

[0125] Table 1 shows the PCR reaction system of OsIDD12 gene

[0126] sample Addition volume (μL) cDNA template 2 OsIDD12-F (10 mM) 2 OsIDD12-R (10mM) 2 DMSO 2.5 dNTPs (2.5 mM each) 2.5 Reaction Buffer (10X) 5 Phanta (5U / μL) 1 <![CDATA[ddH2O]]> 33 Total volume 50

[0127] Table 2 shows the PCR reaction conditions.

[0128]

[0129]

[0130] 2. Acquisition of the OsIDD13 gene

[0131] The OsIDD13 gene was amplified by PCR using Phanta Max Super-Fidelity DNA Polymerase purchased from Vazyme. Total RNA from Nipponbare leaves 7 days after germination was used as a template for reverse transcription of cDNA. The primers used were: OsIDD13-F: 5-'GCCATGTTGGGTTCTTGCG-3', OsIDD13-R:

[0132] PCR amplification was performed using the sequence of the 5-'CTACATGATGCCCATGCTGTTAGC-3' sequence. The PCR reaction system and reaction conditions are shown in Table 3 and Table 2, respectively. The amplified product was sequenced. The coding sequence of the OsIDD13 protein in the rice variety Nipponbare is the nucleotide sequence shown in positions 4 to 1518 of SEQ ID NO. 6, and the amino acid sequence of the encoded protein is shown in SEQ ID NO. 5.

[0133] Table 3 shows the PCR reaction system of OsIDD13 gene

[0134] sample Addition volume (μL) cDNA template 2 OsIDD13-F (10 mM) 2 OsIDD13-R (10 mM) 2 DMSO 2.5 dNTPs (2.5 mM each) 2.5 Reaction Buffer (10X) 5 Phanta (5U / μL) 1 <![CDATA[ddH2O]]> 33 Total volume 50

[0135] 3. Acquisition of the OsIDD14 gene

[0136] The OsIDD14 gene was amplified by PCR using Phanta Max Super-Fidelity DNA Polymerase purchased from Vazyme. Total RNA from Nipponbare leaves 7 days after germination was used as a template for reverse transcription of cDNA. The primers used were: OsIDD14-F: 5-'GCAGTTATGGCACTGGTCAAGAG-3', OsIDD14-R: 5-'

[0137] PCR amplification was performed using the residue CATGCATGTACATATCAGCTAGATGC-3' using the reaction system shown in Table 4 and the reaction conditions shown in Table 2. The resulting amplified product was sequenced. The cDNA encoding the OsIDD14 protein in the rice variety Nipponbare is the nucleotide sequence shown in positions 7 to 1320 of SEQ ID NO. 2, and the amino acid sequence of the encoded protein is shown in SEQ ID NO. 1.

[0138] Table 4 shows the PCR reaction system of OsIDD14 gene

[0139]

[0140]

[0141] Example 2. Obtaining triple mutant plants knocking out OsIDD12, OsIDD13, and OsIDD14 and identifying their phenotypes

[0142] 1. Obtaining plants with reduced expression (OsIDD12, OsIDD13, and OsIDD14 triple mutant material)

[0143] 1) Construction of pCRISPR-OsIDD12 / OsIDD13 / OsIDD14 gene knockout vector

[0144] The CRISPR-Cas9-based gene editing system specifically and simultaneously disrupts the OsIDD12, OsIDD13, and OsIDD14 genes, preventing them from expressing their normal products (OsIDD12, OsIDD13, and OsIDD14 proteins). Specific gene editing target sites were designed based on vector requirements and the characteristics of the OsIDD12, OsIDD13, and OsIDD14 genes. These sites share a common, specific site within the OsIDD12, OsIDD13, and OsIDD14 genes: 5'-CCTCGTCGGCATCAAGAAGCACT-3', a matching sequence found in no other gene in the entire rice genome.

[0145] Using the primers listed in Table 5, PCR was used to amplify DNA fragments containing each target site. The fragments were then ligated to the pYLCRISPR / Cas9Pubi-H vector backbone using an enzyme digestion-ligation system. The specific ligation steps were as follows: After digestion with BsaI at 37°C for 10 minutes, 1.5 μL of T4 DNA ligase buffer (10x the system concentration) and 0.2 μL of T4 DNA ligase were added. The ligation was cycled in a PCR instrument for 15 cycles: 37°C for 2 minutes, 10°C for 3 minutes, and 20°C for 5 minutes, followed by a final reaction at 37°C for 2 minutes. Sequencing of the ligation product confirmed successful ligation, resulting in the pCRISPR-OsIDD12 / OsIDD13 / 14 knockout vector. The nucleotide sequence of the vector was obtained by ligating SEQ ID NO. 7 and SEQ ID NO. 8 in end-to-end order (the last base of SEQ ID NO. 7 was linked to the first base of SEQ ID NO. 8).

[0146] The pCRISPR-OsIDD12 / OsIDD13 / OsIDD14 knockout vector is a vector containing the target site 5'- CCTCGTCGGCATCAAGAAGCACT The gRNA scaffold sequence (SEQ ID No. 7, positions 9430 to 9525), the promoter sequence (SEQ ID No. 7, positions 9047 to 9429), and two spacer sequences (SEQ ID No. 7, positions 9024 to 9046; positions 90526 to 9558) with a -3' sequence were inserted into the fragment between the restriction endonuclease BsaI sites of the vector pYLCRISPR / Cas9Pubi-H, while keeping the other nucleotide sequences of the vector pYLCRISPR / Cas9Pubi-H unchanged to obtain the pCRISPR-OsIDD12 / OsIDD13 / OsIDD14 recombinant vector.

[0147] Table 5 shows the primer sequences used for gene knockout

[0148]

[0149] 2) Obtaining recombinant Agrobacterium

[0150] The knockout vector pCRISPR-OsIDD12 / OsIDD13 / OsIDD14 obtained in step 1 was transferred into Agrobacterium tumefaciens EHA105 (Miaoling Biotechnology, catalog number: CCell32003) by electroporation to obtain recombinant Agrobacterium, which was named EHA105 / pCRISPR-OsIDD12 / OsIDD13 / OsIDD14 and used to transform rice callus tissue.

[0151] 3) Genetic transformation of rice

[0152] After culturing mature seeds of Nipponbare in an induction medium for 3 weeks (culture conditions: 32°C, light intensity 13230Lx), vigorously growing calli were selected as recipients for transformation. The recombinant bacteria EHA105 / pCRISPR-OsIDD12 / OsIDD13 / OsIDD14 obtained in step 2) were used to infect the callus, cultured in the dark at 25°C for 3 days, and then cultured on a screening medium containing 50 mg / L hygromycin and 400 mg / L carbenicillin for 2 weeks (culture conditions: 32°C, light intensity 13230Lx). Individuals without Agrobacterium contamination and with fresh callus growth were used for differentiation culture (culture conditions: 32°C, light intensity 13230Lx). After differentiation, seedlings were transferred to rooting and seedling growth medium and cultured for about 2 weeks (culture conditions: 32°C, light intensity 13230Lx) and then transferred to the field for planting to obtain T0 generation transgenic rice plants with OsIDD12, OsIDD13 and OsIDD14 knockout.

[0153] 4) PCR identification of transgenic positive plant lines

[0154] Genomic DNA was extracted from leaves of T0 generation transgenic rice plants with OsIDD12, OsIDD13, and OsIDD14 knockout, and PCR amplification was performed using primers Cas9-fw: 5'-GACGTGGACAAGCTCTTCATCC-3' and Cas9-rv: 5'-GGAGGATAGCATCGGAGAGGTTC-3'. Plants that amplified a 367 bp PCR fragment were considered positive.

[0155] Positive plants were harvested to obtain T1 generation seeds.

[0156] 2. Preliminary phenotypic identification of transgenic plants with OsIDD12, OsIDD13, and OsIDD14 knockout

[0157] The T1 generation seeds obtained in step 1 were planted in the field. After 60 days of growth, T1 generation OsIDD12, OsIDD13 and OsIDD14 knockout transgenic rice plants were obtained. Leaves of the T1 generation OsIDD12, OsIDD13 and OsIDD14 knockout transgenic rice plants were manually sliced ​​for preliminary screening, and plant types with obvious changes in leaf structure were marked. The plant growth conditions were observed to be short plants with short leaves. The fruit-bearing plants were harvested in the harvest season and T2 generation seeds were obtained.

[0158] Materials required for manual sectioning, such as chloral hydrate, lactic acid, toluidine blue, toothpicks, double-sided knives, and glass slides, were purchased from the market.

[0159] a. Sample

[0160] The harvested T1 seeds were planted in a greenhouse to produce T1 transgenic rice plants knocked out for OsIDD12, OsIDD13, and OsIDD14. Leaves from the T1 transgenic rice plants and wild-type rice (Nipponbare) grown in the greenhouse for 60 days were cut into 1-centimeter segments from the middle of the leaves. Ten plants per line were tested at a time, for a total of 200 plants from 20 lines.

[0161] b. Fixed

[0162] Place the excised leaf segment into a 2mL centrifuge tube and fix with 1.5mL of freshly prepared Carnoy's fixative (anhydrous ethanol:glacial acetic acid = 3:1). Vacuum the tube in a fume hood until the leaf completely sinks. Change the fixative every 24 hours. After standing at room temperature for 1 week, manually section the tube for observation.

[0163] c. Sectioning and staining

[0164] Use two tightly fitting double-edged razor blades to cross-cut the material. Transfer the material to a decolorizing solution (saturated chloral hydrate in lactic acid) at 50°C for 4 hours. Use a toothpick to transfer the decolorized material to clean water. Then, use tweezers to pick up the material from the clean water and stain it in 1% toluidine blue for 10-20 seconds. Rinse in clean water to remove any loose color. Then, use a toothpick to transfer the material to a glass slide.

[0165] d. Microscope observation and recording

[0166] Observe under a low-power microscope and record the strains with obvious changes in leaf structure.

[0167] Schematic diagram of freehand slicing effect Figure 2 shown.

[0168] The results showed that among 20 independent T1 generation knockout transgenic lines of OsIDD12, OsIDD13 and OsIDD14, 6 lines had at least one individual with obvious changes in leaf structure. Finally, the offspring of two T1 generation knockout transgenic lines of OsIDD12, OsIDD13 and OsIDD14 (named triple mutant-1 and triple mutant-2) with obvious changes in leaf structure (specifically, a significant increase in the number of veinlets and a significant decrease in the number of mesophyll cells between veinlets) were selected for detailed observation and statistics.

[0169] 3. Detailed observation and statistics of leaf anatomical phenotypes of transgenic T2 plants with OsIDD12, OsIDD13, and OsIDD14 knockout

[0170] 1) Quantitative PCR detection

[0171] The T2 generation seeds of the two OsIDD12, OsIDD13 and OsIDD14 knockout transgenic lines with obvious changes in leaf structure harvested in the previous step were further planted in the field. After 60 days of growth, T2 generation transgenic rice plants with OsIDD12, OsIDD13 and OsIDD14 knockout were obtained.

[0172] About four weeks after sowing (at the five-leaf stage) of T2 generation transgenic rice plants (triple mutant-1 and triple mutant-2) with knockout of OsIDD12, OsIDD13, and OsIDD14, RNA was extracted from the newly grown leaves and reverse transcribed to generate cDNA. Quantitative PCR was then used to detect the expression of OsIDD12, OsIDD13, and OsIDD14 genes using a universal forward primer (5'-CCTCGTCGGCATCAAGAAGCACT-3') (within the gene knockout target sequence) and specific reverse primers (5'-CTGCTGAGACGACGATGCTGC-3', 5'-CAGCTGCTTCTCCTGCTCTAAC-3', and 5'-CACGTCCAGAGTTACACGCATC-3') for OsIDD12, OsIDD13, and OsIDD14, respectively.

[0173] Quantitative PCR test results Figure 3 As shown, it can be seen that the expression levels of OsIDD12, OsIDD13 and OsIDD14 in the T2 generation transgenic rice plants triple mutant-1 and triple mutant-2 with knockout of OsIDD12, OsIDD13 and OsIDD14 were significantly lower than those in the wild-type Nipponbare, indicating that the correct expression of genes OsIDD12, OsIDD13 and OsIDD14 was shut down by gene editing.

[0174] 2) Morphological observation

[0175] The morphological observation results of T2 generation transgenic rice plants with OsIDD12, OsIDD13 and OsIDD14 knockout are shown in Figure 2. Figure 4 and Figure 5 As shown in the figure, compared with the Nipponbare WT plants of the same period, the T2 generation transgenic rice lines triple mutant-1 and triple mutant-2 with OsIDD12, OsIDD13 and OsIDD14 knockout had reduced plant height and increased tillering ( Figure 4 ); the length-width ratio of the flag leaf was significantly reduced compared with that of the WT plant ( Figure 5 ).

[0176] The leaves of the T2 generation transgenic rice plants triple mutant-1 and triple mutant-2 with OsIDD12, OsIDD13 and OsIDD14 knocked out were taken for paraffin section (20 plants per line, repeated once) to detect the clear phenotype.

[0177] 3) Leaf anatomical phenotypes of OsIDD12, OsIDD13, and OsIDD14 knockout plants

[0178] (1) Obtaining leaves

[0179] The T2 generation seeds of triple mutant-1 and triple mutant-2 were planted in the field. 20 days after the plants flowered and entered the grain filling stage, the flag leaves were taken. Two plants were taken from each line, and two flag leaves were taken from each individual plant.

[0180] (2) Preparation and testing of leaf paraffin sections

[0181] Glacial acetic acid, ethanol, xylene, adhesive tablets, safranin, fast green, neutral gum, glass slides and cover slips were purchased from the market.

[0182] a. Sample

[0183] The flag leaf of (1) above.

[0184] b. Material fixation

[0185] Take a 1-2 cm section from the middle of the flag leaf and fix it in freshly prepared Carnoy's fixative (anhydrous ethanol:glacial acetic acid = 3:1). Vacuum the sample at room temperature until it completely submerges in the fixative. After 24 hours at room temperature, replace the fixative with fresh solution. This allows for long-term preservation of the material in the fixative.

[0186] c. Material dehydration

[0187] After one week of fixation, the material was rinsed three times with 70% ethanol. Dehydration was repeated three times in 70% ethanol for 2 hours. Dehydration was then performed in 75%, 80%, 85%, 90%, 100%, and 100% ethanol, with each concentration remaining in ethanol for 1 hour.

[0188] d. Material transparency

[0189] The materials stored in 100% ethanol were cleared using different gradients of ethanol / xylene clearing solution, namely 100% ethanol, ethanol / xylene = 3:1, ethanol / xylene = 1:1, ethanol / xylene = 1:3, 100% xylene and 100% xylene for 1 hour each.

[0190] e. Material wax dipping

[0191] At approximately 38°C, gradually add crushed paraffin wax to xylene until the volume ratio reaches 1:1. Allow to stand until the paraffin wax is completely dissolved. Transfer the paraffin wax to a 58°C incubator to allow the xylene to evaporate completely. Then, divide the paraffin wax into small beakers containing the other materials and incubate at 58°C. Replace the paraffin wax after at least 4 hours. Repeat this process at least three times.

[0192] f. Material embedding

[0193] Place the wax-soaked material in a small paper box, then pour in the melted paraffin wax, and then place the small paper box in cold water to solidify the paraffin wax as quickly as possible.

[0194] g. Material slicing and spreading

[0195] As needed, trim the wax block embedded with the material into a trapezoidal shape with a blade. Keep the wax block intact and as little paraffin as possible around the material. Stick the trimmed wax block to a hardwood block (a small homemade block of about 1 cm x 2 cm x 2 cm), and then fix the wax block to the wax carrier of the microtome. Adjust the angle of the slice and adjust the machine so that the slice thickness is 8 microns. Add a drop of water and a sample adhesive tablet to each clean glass slide and spread it evenly, float the wax strip on the glass slide, and then spread the glass slide on a 42°C slide spreader.

[0196] h. Dissolve wax and rehydrate

[0197] The sections were placed in xylene to dissolve the paraffin until it was completely dissolved, and xylene:anhydrous ethanol (1:1) was added and allowed to stand for 5 minutes. Then, the sections were rehydrated in 100%, 95%, 90%, 85%, 80%, 70%, 50%, 35% ethanol and distilled water for 5 minutes each.

[0198] i. Dyeing and dehydration

[0199] Stain with a 1% safranin aqueous solution for approximately 12 hours, then rinse with running water to remove excess dye. Dehydrate in 35%, 50%, and 70% ethanol for 5 minutes each. Continue staining in 0.1% Fast Green for approximately 10 seconds, immediately immerse in 100% ethanol for 30 seconds, and then immerse in 100% ethanol, anhydrous ethanol:xylene (1:1), and 100% xylene solutions for 5 minutes each.

[0200] j. Seal

[0201] The above slides were blown dry at room temperature. After confirming that the staining was successful under a microscope, about one drop of mounting medium was dropped onto the material, and then carefully covered with a coverslip and allowed to air dry naturally.

[0202] k. Microscope observation and photography

[0203] Use a microscope with a built-in camera system to perform microscopic observation and photography of materials.

[0204] The transgenic rice with OsIDD12 and OsIDD13 knockout prepared in authorized patent CN 116178516 B (hereinafter referred to as double mutant) was used as a control.

[0205] The photo results are as follows Figure 6 As shown in the figure, compared with the wild-type Nipponbare, the T2 generation of transgenic plants from triple mutant-1 and triple mutant-2 effectively altered rice leaf structure. Specifically, the number of leaf veins increased, and the number of mesophyll cells between veins (between adjacent major and minor veins, and between minor veins) decreased significantly. For example, while there is typically at least an eight-cell interval between two minor veins in Nipponbare, the number of mesophyll cells in triple mutant-1 and triple mutant-2 was reduced to approximately five after knockout of OsIDD12, OsIDD13, and OsIDD14. Furthermore, the triple mutants developed two types of minor veins, one of which was not significantly different from the Nipponbare control, while the other had a reduced cross-sectional area and lacked the usual thick-walled cells above and below the veins, similar to the minor vein pattern of C4 grasses, forming two types of minor veins similar to those of C4 grasses.

[0206] Although the control double mutant had more leaf veins and fewer mesophyll cells, the number of mesophyll cells between the leaf veins was only reduced by about 6, and the morphology of all the small veins was consistent, which was significantly different from the two types of small veins in C4 grass crops.

[0207] 3) Statistics of leaf veins and mesophyll cells in plants with OsIDD12, OsIDD13, and OsIDD14 knockout

[0208] Twenty T2 transgenic plants of each of the triple mutant-1 (denoted as transgenic line-1 in the figure) and triple mutant-2 (denoted as transgenic line-2 in the figure) were subjected to paraffin sectioning of leaves, and the number of mesophyll cells at each level of veins and between the veinlets was detected and counted.

[0209] See the results Figure 7 、 Figure 8 and Figure 9It can be seen that compared with wild-type rice, the T2 generation transgenic plants of triple mutant-1 and triple mutant-2 have increased numbers of large veins and small veins, but decreased numbers of mesophyll cells between small veins. The increased number of veins and decreased number of mesophyll cells are both statistically significantly different. Using Student's t-test, P<0.01 indicates extremely significant differences, and P<0.1 indicates significant differences.

[0210] In summary, OsIDD14 protein has the function of synergistically controlling rice leaf structure with OsIDD12 and OsIDD13 proteins. By simultaneously reducing the expression of OsIDD12, OsIDD13 and OsIDD14 genes through gene knockout, two types of small veins similar to C4 grass crops can be formed, the number of small veins between large veins in rice leaves can be increased, and the number of mesophyll cells between veins and the density of mesophyll cells can be reduced, thereby increasing the vein density of the leaves.

[0211] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

Claims

1. Any of the following applications: A1) Use of a protein or a substance that regulates gene expression or regulates the activity or content of the protein in regulating the leaf structure and / or plant architecture of plants; A2) Use of a protein or a substance that regulates gene expression or regulates the activity or content of the protein in the preparation of a product for regulating the leaf structure and / or plant architecture of plants; A3) Use of a protein or a substance that regulates gene expression or regulates the activity or content of the protein in cultivating plants with altered leaf structure and / or plant architecture; A4) Use of a protein or a substance that regulates gene expression or regulates the activity or content of the protein in the preparation of a product for cultivating plants with altered leaf structure and / or plant architecture; A5) Use of a protein or a substance that regulates gene expression or regulates the activity or content of the protein in plant breeding; The protein is OsIDD12 protein, OsIDD13 protein, and OsIDD14 protein: The OsIDD12 protein is any of the following: B1) A protein with an amino acid sequence of SEQ ID No. 3; B2) A protein obtained by substituting and / or deleting and / or adding amino acid residues to the protein of B1), having more than 80% identity with the protein shown in B1) and having a function related to regulating the leaf structure of plants; B3) A fusion protein obtained by linking a protein tag to the N-terminus and / or C-terminus of B1); The OsIDD13 protein is any of the following: C1) A protein with an amino acid sequence of SEQ ID No. 5; C2) A protein obtained by substituting and / or deleting and / or adding amino acid residues to the protein of C1), having more than 80% identity with the protein shown in C1) and having a function related to regulating the leaf structure of plants; C3) A fusion protein obtained by linking a protein tag to the N-terminus and / or C-terminus of C1); The OsIDD14 protein is any of the following: D1) A protein with an amino acid sequence of SEQ ID No. 1; D2) A protein obtained by substituting and / or deleting and / or adding amino acid residues to the protein of D1), having more than 80% identity with the protein shown in D1) and having a function related to regulating the leaf structure of plants; D3) A fusion protein obtained by linking a protein tag to the N-terminus and / or C-terminus of D1).

2. The application according to claim 1, wherein: The protein is derived from rice.

3. The application according to claim 1 or 2, characterized in that: The substance that regulates gene expression or regulates the activity or content of the protein is a biological material related to the protein, and the biological material is any of the following: E1) A nucleic acid molecule encoding the protein described in claim 1; E2) An expression cassette containing the nucleic acid molecule described in E1); E3) A recombinant vector containing the nucleic acid molecule described in E1), or a recombinant vector containing the expression cassette described in E2); E4) A recombinant microorganism containing the nucleic acid molecule described in E1), or a recombinant microorganism containing the expression cassette described in E2), or a recombinant microorganism containing the recombinant vector described in E3); E5) A transgenic plant cell line containing the nucleic acid molecule described in E1), or a transgenic plant cell line containing the expression cassette described in E2); E6) A transgenic plant tissue containing the nucleic acid molecule described in E1), or a transgenic plant tissue containing the expression cassette described in E2); E7) A transgenic plant organ containing the nucleic acid molecule described in E1), or a transgenic plant organ containing the expression cassette described in E2); F1) A nucleic acid molecule that inhibits or reduces or silences the expression of the coding gene of the protein described in claim 1 or 2; F2) An expression cassette containing the nucleic acid molecule described in F1); F3) A recombinant vector containing the nucleic acid molecule described in F1), or a recombinant vector containing the expression cassette described in F2); F4) A recombinant microorganism containing the nucleic acid molecule described in F1), or a recombinant microorganism containing the expression cassette described in F2), or a recombinant microorganism containing the recombinant vector described in F3); F5) A transgenic plant cell line containing the nucleic acid molecule described in F1), or a transgenic plant cell line containing the expression cassette described in F2); F6) A transgenic plant tissue containing the nucleic acid molecule described in F1), or a transgenic plant tissue containing the expression cassette described in F2); F7) A transgenic plant organ containing the nucleic acid molecule described in F1), or a transgenic plant organ containing the expression cassette described in F2).

4. The application according to claim 3, characterized in that: The nucleotide sequence of the recombinant vector described in F3) is obtained by sequentially connecting SEQ ID NO.7 and SEQ ID NO.8 head to tail.

5. A method for regulating plant leaf structure and / or plant type, comprising the following steps: regulating the activity and / or content of the protein described in claim 1 or 2 in a target plant, or / and regulating the expression level of the coding gene of the protein described in claim 1 or 2, to regulate plant leaf structure and / or plant type.

6. A breeding method for cultivating a plant with altered leaf structure and / or plant type, comprising the following steps: regulating the activity and / or content of the protein described in claim 1 or 2 in a target plant, or / and regulating the expression level of the coding gene of the protein described in claim 1 or 2, to obtain a plant with altered leaf structure and / or plant type.

7. The method according to claim 5 or 6, characterized in that: The regulation is to reduce.

8. The method according to claim 7, characterized in that: The reduction of the activity and / or content of the protein described in claim 1 or 2 in the target plant, or / and the reduction of the expression level of the coding gene of the protein described in claim 1 or 2, comprises the following steps: introducing a recombinant expression vector containing a nucleic acid molecule that inhibits or reduces or silences the expression of the coding gene of the protein described in claim 1 or 2 into a recipient plant, to obtain a target plant with altered plant leaf structure; the coding gene encodes the protein described in claim 1 or 2.

9. The method according to any one of claims 6-8, characterized in that: The plant is any one of the following: G1) A dicotyledonous plant or a monocotyledonous plant; G2) A plant of the order Poales; G3) A plant of the family Poaceae; G4) A plant of the genus Oryza; G5) Rice.

10. According to any one of the applications described in claims 1-5 or any one of the methods described in claims 7-9, characterized in that: The alteration of the leaf structure is to produce a C4-like plant anatomical structure; and / or the production of the C4-like plant anatomical structure is to form two types of leaf veins of a C4-like plant of the family Poaceae, an increase in the number of leaf veins, an increase in the vein density, a decrease in the number of mesophyll cells between veins, and / or a decrease in the mesophyll cell density between veins; The plant type change is to reduce plant height, increase tiller number and / or reduce leaf length-width ratio.

Images