Application of HaMYB1 in plant flower color regulation and control
By applying the sunflower MYB1 gene (HaMYB1) in tobacco, recombinant vectors were constructed and transfected tobacco to regulate anthocyanin content, the problem of insufficient research on the regulation mechanism of the color gene was solved, the deepening of flower color and the improvement of anthocyanin content was achieved, and the ornamental and economic value of flowers was enhanced.
Patent Information
- Application Number
- CN202510469279.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-15
- Publication Date
- 2025-07-08
AI Technical Summary
The existing technology is still in its infancy in the study of the color gene regulation mechanism of carotenoid metabolic genes, especially the research on the transcriptional regulation mechanism of carotenoid metabolic genes, and lacks effective means to enrich the diversity of flower and color and enhance the ornamental and economic value.
Through the application of the sunflower MYB1 gene (HaMYB1) in tobacco, recombinant vectors are constructed and transfected or transformed tobacco, the content of anthocyanins or their derivatives is regulated, and the accumulation of anthocyanins is improved.
The deepening of tobacco color and a significant increase in anthocyanin content have been achieved, and the ornamental and economic value of flowers has been enhanced.
Smart Images

Figure FT_1 
Figure FT_2
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and particularly to the application of HaMYB1 in the regulation of plant flower color. Background Art
[0002] Flower color is an important trait of ornamental plants. Its diversity not only has extremely high ornamental value, but also can attract insects for pollination, resist natural enemies, and adapt to environmental changes, which is of great significance in biological evolution. In addition, the study of flower color regulation helps to enrich the diversity of plant flower color phenotypes and improve the ornamental and economic value of flowers.
[0003] Common means of flower color regulation mainly include gene regulation and environmental regulation. Environmental regulation involves the influence of factors such as light, temperature, and pH value on flower color. In terms of gene regulation, flower color is affected by regulating structural genes and transcription factors in the pigment synthesis pathway; certain achievements have been made in the study of the gene regulation mechanism of flower color. For example, the expression of carotenoid metabolism genes is closely related to flower color, but the research on its transcriptional regulation mechanism is still in its infancy.
[0004] Therefore, it is crucial to discover more flower color regulation genes, construct a more complete flower color regulation network, and improve breeding efficiency for promoting the development of the flower industry. Summary of the Invention
[0005] In view of this, the technical problem to be solved by the present invention is to provide the application of HaMYB1 in the regulation of plant flower color.
[0006] The present invention provides the application of sunflower MYB1 in the regulation of tobacco flower color.
[0007] Furthermore, the amino acid sequence of the sunflower MYB1 is as shown in SEQ ID NO:6.
[0008] The nucleotide sequence of the nucleic acid encoding the sunflower MYB1 is as shown in SEQ ID NO:5.
[0009] The flower color regulation is achieved by regulating the content of anthocyanin or its derivatives.
[0010] The derivatives of anthocyanin include anthocyanins.
[0011] The present invention provides a method for regulating tobacco flower color, which includes: constructing a recombinant vector containing the nucleic acid encoding the sunflower MYB1 and then transfecting or transforming tobacco.
[0012] Furthermore, the amplification primers of the nucleic acid encoding the sunflower MYB1 include an upstream primer with a nucleotide sequence as shown in SEQ ID NO:1 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO:2.
[0013] The backbone of the recombinant vector is derived from pRI101-AN.
[0014] The transfection or transformation of tobacco is followed by tissue culture of the transfected or transformed tobacco leaves.
[0015] After the transfection or transformation of tobacco, it also includes an identification step. The primers for identification include an upstream primer with a nucleotide sequence as shown in SEQ ID NO:3 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO:4.
[0016] The present invention discovers through experiments that sunflower MYB1 can regulate the flower color of tobacco; the experimental results show that the flower color of the transformed tobacco containing sunflower MYB1 is deeper, and the anthocyanin content is significantly increased compared with that of the wild type. Brief Description of the Drawings
[0017] Figure 1 Showing the sequence analysis of the HaMYB1 gene, where A is the sequence similarity analysis, B is the chromosome, and C is the relative expression level of the HaMYB1 gene after overexpression in tobacco;
[0018] Figure 2 Showing the flower color and anthocyanin content of wild-type and HaMYB1 overexpressing tobacco, where A is the display of flower color and B is the anthocyanin content. Detailed Embodiments
[0019] The present invention provides the application of HaMYB1 in regulating plant flower color. Those skilled in the art can draw on the content of this article and appropriately improve the process parameters to achieve it. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all regarded as included in the present invention. The methods and applications of the present invention have been described through preferred embodiments. Relevant personnel can obviously make changes or appropriate alterations and combinations to the methods and applications in this article without departing from the content, spirit, and scope of the present invention to implement and apply the technology of the present invention.
[0020] HaMYB1-F: 5’-ggggtaccatgcttgatgtgctcaattc-3’ (SEQ ID NO:1);
[0021] HaMYB1-R: 5’-cgggatccagcaatatcttcaagcatag-3’ (SEQ ID NO:2);
[0022] F: ggctccgccgcatgt (SEQ ID NO:3);
[0023] R: ctccattttgcggcattttt (SEQ ID NO:4);
[0024] CDS sequence of HaMYB1: atgcttgatgtgctcaattcaggttctaattacaaatccgataatgggtttaaaccgggcttctttagtgcagttgaacgaaaactagcaatatcacttcccggagctggcataaaaggaaagccacatatagagtcgcgtgtaaagacaatgaagagtgattggtctgctgtgcatgatatgctagcatggaacaatacaagtggttttggttgggattacaataatggcatgcttgaggctccgccgcatgtttggcaagcttatatacaggtgcacaaaaatgccgcaaaatggagatcgaagaaatttcctcattactgggacttatgtattgtgtttggcaaggatcgggcaagtgggagagatgcccaaacagccgctgatattatatccgatatgaccagagaagaaccagaggcagaggctactgggtatggactagatgatgtggatcttaatcaaccactaaataggtcttcatatgaagcttctagagaagactcaagtatacaacgaaagaggaagaagcgcaacaactgggatcctctaatgagtagcttgaaagagtcggctgaaataattggtgcggagattagggaggctacaaatactttcaatagagtttttggaactgagagcaatagagaggaactacgtaacaatctttttgcggagatgaacaaagttgtgggtttgactactcgtgaatgtgacaaggctgtatgtaagctcgcacaaaatgaagagttgatggtaatcttttttaaggttgatgaagaacgcaaatttggatgggtaaagactatgcttgaagatattgcttga (SEQ ID NO:5);
[0025] The protein sequence of HaMYB1: MLDVLNSGSNYKSDNGFKPGFFSAVERKLAISLPGAGIKGKPHIESRVKTMKSDWSAVHDMLAWNNTSGFGWDYNNGMLEAPPHVWQAYIQVHKNAAKWRSKKFPHYWDLCIVFGKDRASGRDAQTAADIISDMTREEPEAEATGYGLDDVDLNQPLNRSSYEASREDSSIQRKRKKRNNWDPLMSSLKESAEIIGAEIREATNTFNRVFGTESNREELRNNLFAEMNKVVGLTTRECDKAVCKLAQNEELMVIFFKVDEERKFGWVKTMLEDIA (SEQ ID NO:6).
[0026] The test materials used in the present invention are all ordinary commercially available products and can be purchased on the market. The present invention will be further described below in conjunction with the embodiments:
[0027] Example 1
[0028] I. Sequence analysis and vector construction of the HaMYB1 gene
[0029] 1. Sequence analysis of the HaMYB1 gene
[0030] Previous research results found that the HannXRQ_Chr01g0013481 gene in sunflower is closely related to the content of anthocyanins. According to sequence similarity, the HannXRQ_Chr01g0013481 gene contains a Myb / SANT-like domain and can be identified as an MYB transcription factor ( Figure 1 A in Figure 1 ). According to its position on the chromosome, it was named HaMYB1 (
[0031] B in
[0032] ). Subsequently, the creation and identification of transgenic tobacco materials were carried out:
[0033] II. Transformation of Tobacco
[0034] Genetic transformation: Remove the leaf margins and veins of sterile tobacco seedlings, cut them into appropriate sizes, place them in MS medium, and pre-culture for 2 days; Culture the Agrobacterium liquid containing the target gene until OD 600 = 0.6 - 0.8, centrifuge to discard the supernatant, resuspend the cells with pre-cooled MS0 to make its OD 600 = about 0.8; Place the pre-cultured leaves in the bacterial liquid, take them out after 8 minutes of infection, blot the excess bacterial liquid with sterilized filter paper, place the infected leaves with the veins facing up, spread them flat on medium G and culture them in the dark for 2 - 3 days; Wash the co-cultured explants 3 times with sterilized water containing Cef, then blot them dry with sterilized filter paper, inoculate the leaves with the veins facing down onto the S1 differentiation medium, and culture them in the dark for 2 - 3 weeks; When adventitious buds grow from the leaf margins and the bud length is 0.1 - 0.5 cm, cut the S1 adventitious buds and transfer them to the S2 differentiation medium, and culture them under light for 1 - 2 weeks, and the adventitious buds grow into young seedlings; Break the S2 seedlings and transfer them to the S3 medium, and culture them under light for 1 - 2 weeks, and the seedlings gradually become strong; Remove the swollen part at the bottom and the yellowed leaves at the lower part of the S3 strong seedlings, inoculate them onto the rooting medium, and culture them under light at 28°C for 1 - 2 weeks; Identify positive seedlings using specific primers and conduct relevant experiments.
[0035] III. Positive Identification of Positive Transformed Seedlings (including DNA level and expression level)
[0036] Transfer the transgenic seedlings into the soil and manage them in the normal way. After about 3 weeks, extract RNA from each individual plant and perform reverse transcription to obtain cDNA. Use primer pairs F and R to detect the expression level of positive seedlings, and further select plants with high expression levels.
[0037] IV. Detection of Anthocyanins
[0038] The anthocyanin content was determined using the Mibio Micro Plant Anthocyanin Detection Kit. The brief steps are as follows: Take 0.1 g of the sample and add 1 mL of extraction buffer, and sonicate for 2 hours. Collect the supernatant after centrifugation at 8000 g for 10 minutes. Take 20 μL of the supernatant and mix it with 180 μL of buffer I, react at 40°C for 20 minutes, and measure the absorbance values at OD530 (A1) and OD700 (A2). Repeat the above steps using buffer II to obtain A3 and A4. The final anthocyanin content is calculated according to the formula in the kit manual: ΔA = (A1 - A2) - (A3 - A4); Anthocyanin content (μg / g fresh weight) = 33.4 × ΔA × F / W, where F refers to the dilution factor of 106 and W is the sample weight in g.
[0039] The flower color of HaMYB1 overexpressing tobacco is deeper ( Figure 2A). The anthocyanin contents of these overexpressing plants were tested and it was found that the flowers of the overexpressing lines accumulated more anthocyanins than those of the negative control transgenic lines ( Figure 2 B). This indicates that HaMYB1 plays an important function in flower color formation.
[0040] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.
Claims
1. Application of sunflower MYB1 in regulating tobacco flower color.
2. The application according to claim 1, wherein The amino acid sequence of the sunflower MYB1 is shown in SEQ ID NO:
6.
3. The application according to claim 1, characterized in that, The nucleotide sequence of the encoding nucleic acid of the sunflower MYB1 is shown in SEQ ID NO:
5.
4. The application according to claim 1, characterized in that, The regulation of flower color is achieved by regulating the content of anthocyanin or its derivatives.
5. The application according to claim 4, wherein The derivatives of the anthocyanin include anthocyanin glycosides.
6. Method for regulating tobacco flower color, characterized in that, Including: Construct a recombinant vector containing the encoding nucleic acid of the sunflower MYB1 and then transfect or transform tobacco.
7. The regulation method according to claim 6, wherein The amplification primers of the encoding nucleic acid of the sunflower MYB1 include an upstream primer with a nucleotide sequence shown in SEQ ID NO: 1 and a downstream primer with a nucleotide sequence shown in SEQ ID NO:
2.
8. The regulation method according to claim 6, characterized in that The backbone of the recombinant vector is derived from pRI101-AN.
9. The regulation method according to claim 6, wherein The transfection or transformation of tobacco is tissue culture after transfection or transformation of tobacco leaves.
10. The regulation method according to claim 6, wherein After the transfection or transformation of tobacco, it also includes the step of identification. The identification primers include an upstream primer with a nucleotide sequence shown in SEQ ID NO: 3 and a downstream primer with a nucleotide sequence shown in SEQ ID NO: 4.