Application of tomato cytokinin receptor gene SlHK2 and knockout vector thereof in regulation and control of tomato fruit size

Abstract

The invention provides a tomato cytokinin receptor gene SlHK2 and an application of a knockout vector of the tomato cytokinin receptor gene SlHK2 in regulating and controlling the size of tomato fruits. The cytokinin receptor gene SlHK2 is identified from tomatoes. The knockout vector disclosed by the invention is targeted to an sgRNA sequence as shown in SEQ ID NO.1, namely a fragment with the length of 20bp in a 6370-6389bp region of an SlHK2 gene sequence. The invention also provides a transgenic engineering bacterium transfected with the knockout vector of the tomato cytokinin receptor gene SlHK2 and application of the transgenic engineering bacterium in regulation and control of tomato fruit size. According to the invention, a target sgRNA fragment of a CRISPR / Cas9 gene edited tomato cytokinin receptor gene SlHK2 is obtained through screening, a CRISPR / Cas9 gene edited vector pYLCRISPRCas9Pubi-N-SlHK2 of the SlHK2 is obtained through construction, then transgenic engineering bacteria are transfected and transferred into tomatoes, and the size of tomato fruits of an obtained homozygous mutant strain of the SlHK2 gene is obviously increased.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and particularly relates to the application of the tomato cytokinin receptor gene SlHK2 and its knockout vector in regulating tomato fruit size. Background Art

[0002] As an important plant reproductive organ, the fruit can protect the normal development of seeds and promote their dissemination, contributing to species reproduction; at the same time, the fruit is also an important part of people's diet, providing various nutrients to maintain good health. As one of the vegetables with the largest planting area and consumption in China, tomatoes have sweet and sour fruits, low calories, and contain various nutritional elements such as lycopene, potassium, and vitamin C, which are widely loved by people. Large fruits are one of the directions in tomato breeding, and cultivating large-fruited tomatoes is of reference significance for improving the production value and economic value of tomatoes.

[0003] The size of tomato fruits is affected by various factors at different stages during the growth and development process, including the number of fruit locules, cell division and expansion of the pericarp, etc. Research shows that up-regulated expression of the SlWUS gene in flower buds can increase the number of fruit locules, thus increasing the fruit size. Changes in the cell division rate or duration in the ovary affect the final fruit size. It has been reported in the literature that mutations at the fs8.1 locus are likely to increase the number of pericarp cells and the number of layers, resulting in longer and heavier fruits. Cell expansion during fruit development is also one of the reasons for the change in fruit volume. Research shows that in overexpression lines of SlFSM1, due to the reduced degree of pericarp cell expansion, the pericarp thickness decreases and the fruit size becomes smaller.

[0004] Cytokinins are a class of growth regulators that regulate plant growth and development, and play functions in multiple biological processes such as cell division, lateral root formation, leaf senescence, and fruit development. Cytokinins play an important role in regulating tomato fruit size. Research shows that the content of cytokinins increases significantly during the pollination and fertilization stages and the initial stage of fruit development; in transgenic tomato lines with reduced endogenous cytokinin content, the pericarp thickness of the fruits decreases, and the size and weight are significantly reduced; exogenous application of CPPU-type cytokinins will increase the pericarp thickness, thereby increasing the fruit size and weight. However, the existing reports mainly focus on the regulation of tomato fruit size by cytokinin content, and there are few reports on the application of cytokinin signaling pathway genes in regulating tomato fruit size.

[0005] Cytokinins regulate the expression of downstream genes through their signaling pathway genes and play functions; finding cytokinin signaling pathway genes closely related to tomato fruit size, using gene editing technologies such as CRISPR / Cas to obtain tomato lines with mutations in cytokinin signaling pathway genes, and creating new tomato germplasms with increased fruit size are of great significance for enriching tomato germplasm resources and cultivating new varieties of large-fruited tomatoes. Summary of the Invention

[0006] In view of the needs of large-fruited tomato breeding, the object of the present invention is to provide an application of a tomato cytokinin receptor gene SlHK2 and its knockout vector in regulating tomato fruit size. In one aspect of the present invention, the knockout vector is a CRISPR / Cas9 gene editing vector.

[0007] The specific technical solution of the present invention is as follows:

[0008] The first object of the present invention is to provide an application of knocking out the tomato cytokinin receptor gene SlHK2 in increasing tomato fruit size.

[0009] Furthermore, the gene number of the tomato cytokinin receptor gene SlHK2 is LOC101255900, and the gene sequence of SlHK2 with the gene number LOC101255900 is located at 59087453-59098895 bp on tomato chromosome 7 (Genbank accession number NC_015444.3).

[0010] Furthermore, the application is to introduce a frameshift mutation in the region of 6370-6389 bp of the SlHK2 gene sequence, thereby knocking out the SlHK2 gene. The sequence of the region of 6370-6389 bp of the SlHK2 gene sequence is shown as SEQ ID NO.1.

[0011] The present invention identified a cytokinin receptor gene SlHK2 from tomato. The targeted sgRNA sequence of SlHK2 of the present invention is a 20-bp fragment in the region of 6370-6389 bp of the SlHK2 gene sequence (i.e., the fragment shown as SEQ ID NO.1), and it is also a sequence specific to other cytokinin receptor genes and other tomato genes.

[0012] The second object of the present invention is to provide an application of the knockout vector of the tomato cytokinin receptor gene SlHK2 in increasing tomato fruit size.

[0013] Furthermore, the knockout vector is a CRISPR / Cas9 gene editing vector.

[0014] Furthermore, the knockout vector targets the sgRNA sequence shown as SEQ ID NO.1:

[0015] CCTTCCTTATGCTACCCCGG.

[0016] Furthermore, the knockout vector is pYLCRISPRCas9Pubi-N-SlHK2, and the gene editing vector is obtained by replacing the sequence between two BsaI restriction enzyme sites at 8807 bp to 9492 bp (the LB boundary is the 1st bp) of the pYLCRISPRCas9Pubi-N general vector (NCBI accession number: MG719602.1) with the sgRNA-SlHK2 gene sequence. The sgRNA-SlHK2 gene sequence is composed of the AtU3d-C9 promoter, the sgRNA sequence shown in SEQ ID NO.1, and the sgRNA backbone sequence connected in sequence.

[0017] Furthermore, the nucleotide sequence of the sgRNA-SlHK2 gene sequence is as shown in SEQ ID NO.2: ATAAGCTTATGATTTCTTTTTTCTTACGAATTTTGCGTCCCACATCGGTAAGCGAGTGAAGAAATAACTGCTTTATATATGGCTACAAAGCACCATTGGTCACCTTCCTTATGCTACCCCGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAA AGTGGCACCGAGTCGGTGCTTTTTTT.

[0018] The present invention also provides a method for constructing the CRISPR / Cas9 gene editing vector pYLCRISPRCas9Pubi-N-SlHK2 of the tomato cytokinin receptor gene SlHK2. The construction method is as follows:

[0019] S1: Search for the gene number LOC101255900 in the NCBI database (https: / / www.ncbi.nlm.nih.gov / ), and obtain the gene sequence of the SlHK2 gene in the region of 59087453 - 59098895 bp on chromosome 7 of tomato (Genbank accession number: NC_015444.3), that is, the tomato cytokinin receptor gene SlHK2.

[0020] S2: Use the online tool CRISPR-P 2.0 (http: / / cbi.hzau.edu.cn / crispr / ) to design the targeting sgRNA sequence for CRISPR / Cas9 gene editing of the tomato cytokinin receptor gene SlHK2, and select the sequence shown in SEQ ID NO.1 in the region of 6370 - 6389 bp of the SlHK2 gene sequence as the targeting sgRNA sequence.

[0021] S3: Sequentially ligate the AtU3d - C9 promoter, the target sgRNA sequence shown in SEQ ID NO.1, and the sgRNA backbone sequence to form the sgRNA - SlHK2 gene sequence shown in SEQ ID NO.2.

[0022] S4: Submit the composed sgRNA - SlHK2 gene sequence to a biological company for synthesis, and insert it between two BsaI restriction sites of the pYLCRISPRCas9Pubi - N (NCBI accession number MG719602.1) universal vector at 8807bp - 9492bp (the LB boundary is the 1st bp), and replace the sequence between them with the sgRNA - SlHK2 gene sequence to obtain the CRISPR / Cas9 gene editing vector pYLCRISPRCas9Pubi - N - SlHK2 of SlHK2.

[0023] The CRISPR / Cas9 gene editing vector constructed in the present invention can be directly used for Agrobacterium - mediated plant genetic transformation, and has important significance in aspects such as increasing tomato fruit size, promoting high - yield and high - quality tomato production, and reducing breeding costs.

[0024] The third object of the present invention is to provide the application of a transgenic engineering bacterium transfected with the knockout vector of the aforementioned tomato cytokinin receptor gene SlHK2 in increasing tomato fruit size.

[0025] Furthermore, the transgenic engineering bacterium is Agrobacterium EHA105 as the host cell.

[0026] The beneficial effects achieved by the technical solution of the present invention are as follows:

[0027] (1) The present invention screened a target sgRNA fragment for CRISPR / Cas9 gene editing of the tomato cytokinin receptor gene SlHK2, constructed the CRISPR / Cas9 gene editing vector pYLCRISPRCas9Pubi - N - SlHK2 of SlHK2, and then transfected the transgenic engineering bacterium and transferred it into tomatoes to obtain a homozygous mutant line of SlHK2 with significantly increased fruit size.

[0028] (2) The fruit size of the homozygous mutant line of SlHK2 is larger than that of the wild type (WT), and the single - fruit weight is heavier than that of the WT.

[0029] (3) The present invention can obtain tomato plants with increased fruit size by CRISPR / Cas9 gene editing of the SlHK2 gene, which has important significance for promoting high - yield and high - quality tomato production and reducing breeding costs. Description of the Drawings

[0030] Figure 1 : Vector map constructed in Example 2.

[0031] Figure 2 : The WT and SlHK2 homozygous mutant line plants at the reproductive growth stage in Example 5.

[0032] Wherein: WT is the wild-type tomato variety Micro-Tom, and slhk2-11 and slhk2-22 are two SlHK2 homozygous mutant lines obtained by CRISPR / Cas9 gene editing.

[0033] Figure 3 : The fruit size of tomatoes at the red-ripe stage in Example 5;

[0034] Wherein: WT is the wild-type tomato variety Micro-Tom, and slhk2-11 and slhk2-22 are two SlHK2 homozygous mutant lines obtained by CRISPR / Cas9 gene editing.

[0035] Figure 4 : The longitudinal and transverse diameters of tomato fruits at the red-ripe stage in Example 5.

[0036] Wherein: WT is the wild-type tomato variety Micro-Tom, and slhk2-11 and slhk2-22 are two SlHK2 homozygous mutant lines obtained by CRISPR / Cas9 gene editing.

[0037] Figure 5 : The single fruit weight of tomatoes at the red-ripe stage in Example 5.

[0038] Wherein: WT is the wild-type tomato variety Micro-Tom, and slhk2-11 and slhk2-22 are two SlHK2 homozygous mutant lines obtained by CRISPR / Cas9 gene editing. Detailed implementation manners

[0039] The following examples are used to further explain the present invention, but the examples do not limit the present invention in any form.

[0040] Example 1: Obtaining the sgRNA of the tomato cytokinin receptor gene SlHK2

[0041] 1. Search for the gene number LOC101255900 in the NCBI database (https: / / www.ncbi.nlm.nih.gov / ), and obtain the gene sequence of the SlHK2 gene in the region of 59087453-59098895 bp on chromosome 7 of tomato (Genbank accession number is NC_015444.3).

[0042] 2. Design the targeting sgRNA sequence of the CRISPR / Cas9 gene-edited tomato cytokinin receptor gene SlHK2 using the online tool CRISPR-P 2.0 (http: / / cbi.hzau.edu.cn / crispr / ). Select the sequence shown in SEQ ID NO.1 in the 6370-6389 bp region of the SlHK2 gene sequence as the targeting sgRNA.

[0043] Example 2: Construction of the gene-editing vector pYLCRISPRCas9Pubi-N-SlHK2 for the tomato cytokinin receptor gene SlHK2

[0044] Sequentially ligate the AtU3d-C9 promoter, the sgRNA sequence shown in SEQ ID NO.1, and the sgRNA backbone sequence to form the sgRNA-SlHK2 gene sequence shown in SEQ ID NO.2. Submit the formed sgRNA-SlHK2 gene sequence to a biological company for synthesis and insert it between the two BsaI restriction enzyme cleavage sites of the pYLCRISPRCas9Pubi-N (NCBI accession number MG719602.1) general vector at 8807 bp - 9492 bp (the LB border is the 1st bp) to obtain the CRISPR / Cas9 gene-editing vector pYLCRISPRCas9Pubi-N-SlHK2 for SlHK2. The vector map is as Figure 1 shown.

[0045] Example 3: Genetic transformation of tomatoes

[0046] Genetically transform the tomato variety Micro-Tom with the vector pYLCRISPRCas9Pubi-N-SlHK2 obtained in Example 2 using the Agrobacterium-mediated method. The specific steps are as follows:

[0047] (1) Preparation of bacterial suspension:

[0048] Using the pYLCRISPRCas9Pubi-N-SlHK2 gene editing vector as the template sequence, specific primers were designed: sgRNA-F: 5'-TTACTAGATCGGGAGCACCGG-3' (SEQ ID No.3) and sgRNA-R: 5'-CGATGTAGGAGATCGATGCATG-3' (SEQ ID No.4), and a sequence with a length of 304bp could be amplified: TTACTAGATCGGGAGCACCGGTAAGGCGCGCCGTAGTGCTCGATAAGCTTATGATTTCTTTTTTCTTACGAATTTTGCGTCCCACATCGGTAAGCGAGTGAAGAAATAACTGCTTTATATATGGCTACAAAGCACCATTGGTCACCTTCCTTATGCTACCCCGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCGGTATCATTGGCGCGCCTCTCGAGCTAGCGGCCGCATGCATCGATCTCCTACATCG (SEQ ID No.5).

[0049] The plasmid of the gene editing vector pYLCRISPRCas9Pubi-N-SlHK2 was transformed into Agrobacterium tumefaciens EHA105 competent cells by the freeze-thaw method, and Agrobacterium colony PCR was performed using the sequences shown in SEQ ID No.3 and SEQ ID No.4 as primers (Table 1). The PCR product bands were examined by 1% agarose gel electrophoresis. If the size was 304bp as shown in SEQ ID No.5, it was considered that the plasmid was successfully transferred. A very small amount of Agrobacterium with the successfully transferred plasmid was picked, added to 800 μl of LB liquid medium containing 50 mg / L Kan and 50 mg / L Rif, cultured with shaking at 28°C at 200 rpm for 16 h, and stored in a -80°C refrigerator after adding 50% glycerol.

[0050] Table 1 Colony PCR reaction system

[0051] <![CDATA[ddH2O]]> Up to 25μl sgRNA-F 1μl(0.2 - 0.3μM) sgRNA-R 1μl(0.2 - 0.3μM) Colony - Taq polymerase 12.5μl(1.25U)

[0052] (2) Explant preparation

[0053] ① Seed disinfection: Select 100 seeds with complete appearance and full grains and place them in a 10ml sterile centrifuge tube. First add 3ml of 75% anhydrous ethanol solution and mix for 1min. Pour out the liquid and add 3ml of 10% sodium hypochlorite solution to disinfect for 7min. Then quickly wash with sterile water 6-8 times. Add 5ml of sterile water to a 10×10cm sterile square culture dish, use sterile tweezers to clamp a sterilized filter paper, spread it in the culture dish, and then use tweezers to spread the sterilized seeds on the water-soaked filter paper, seal it with a sealing film, and place it in a dark incubator at 28℃ for 2-3d. When the radicle elongates to about 1cm, move it into a tissue culture bottle containing MS solid culture medium, and then place it in a dark incubator at 28℃. When the hypocotyl elongates to about 3cm, move it to the tissue culture room for normal light cycle culture.

[0054] ② Material collection: When the tomato seedlings grow under light for 7-10 days and the first true leaf is about to emerge, cut the seedlings from the stem with sterile scissors, and use tweezers to pick up the part above the tomato stem and place it on sterile filter paper. Then use a scalpel to remove the tip of the tomato cotyledon and cut it off from the part close to the petiole. Cut the remaining cotyledon into two small squares perpendicular to the veins, and spread the leaves with the front side facing up on the pre-culture medium for 2 days.

[0055] (3) Activation of bacteria:

[0056] Streak EHA105 Agrobacterium containing the gene editing vector pYLCRISPRCas9Pubi-N-SlHK2 on LB solid medium containing 50 mg / L Kan and 50 mg / L Rif, and place it upside down in a 28°C constant temperature incubator and culture it in the dark for 2 days. After a single colony grows, pick a single colony of moderate size, full and round, and inoculate it into 800μl LB liquid medium containing the same concentration of antibiotics, and culture it in a 2ml centrifuge tube at 200rpm and 28℃ for 16h. Take 100μl of the bacterial solution and add it to a new 100ml LB medium, and culture it at 200rpm and 28℃ for about 15h to make the OD 600 The value was 0.6-0.8. Centrifuge at 5000 rpm for 5 min at 4°C, and resuspend the precipitated bacteria with resuspension solution (MS + 100 μM AS) to adjust the OD 600 The value was 0.47-0.5. The suspension was continued to be shaken at 100 rpm and 28°C for 1 hour and then set aside.

[0057] (4) Agrobacterium infection:

[0058] Place the tomato cotyledons pre-cultured for 2 days into the revived bacterial solution and shake at 28°C and 100 rpm for 20 minutes. Use sterile tweezers to remove the tomato cotyledons and place them on filter paper, and use the filter paper to absorb the bacterial solution on the surface.

[0059] (5) Co-cultivation:

[0060] Use forceps to lay the infected tomato cotyledons flat on the co-culture medium, and place the petri dish in the dark incubator of the tissue culture room for 3 days of culture.

[0061] (6) Screening culture:

[0062] Use sterile forceps to transfer the tomato cotyledons in the co-culture medium to the screening medium, and transfer them to the light for culture. Replace the medium every 15 days. During the screening period, callus is produced on the tomato cotyledons, and then the callus differentiates to form buds.

[0063] (7) Bud growth culture:

[0064] Transfer the cotyledons with newly differentiated bud points to the bud growth medium. When the regenerated buds grow larger, transfer them to a tissue culture bottle containing the bud growth medium.

[0065] (8) Rooting culture:

[0066] When the regenerated buds on the callus grow to 3 - 4 true leaves, use a scalpel to cut them from the callus and insert them into the rooting medium for rooting culture.

[0067] (9) Acclimatization:

[0068] When the tomato has grown strong roots in the rooting medium, acclimatization can be carried out. Wash the medium from the roots of the plant, remove the old leaves, add water to the seedling root-stem transition zone in the tissue culture bottle, and place it in the light for 4 - 5 days, changing the water every day.

[0069] (10) Transplanting:

[0070] After acclimatization, transplant the tomato into the cultivation substrate and place it in the plant growth room for growth.

[0071] The medium formulations used in genetic transformation are as follows:

[0072] ① Pre-culture medium: MS medium + ZT (2 mg / L) + AS (20 mg / L)

[0073] ② Co-culture medium: MS medium + ZT (2 mg / L) + AS (20 mg / L)

[0074] ③ Screening medium: MS medium + ZT (3 mg / L) + Kan (80 mg / L) + Ti (300 mg / L)

[0075] ④ Bud growth medium: MS medium + ZT (1 mg / L) + Kan (80 mg / L) + Ti (300 mg / L)

[0076] ⑤ Rooting medium: MS medium + IBA (0.2 mg / L) + Kan (20 mg / L) + Ti (300 mg / L)

[0077] ⑥ LB liquid medium: Tryptone 10 g / L + Yeast extract 5 g / L + NaCl powder 10 g / L

[0078] Make up the volume to the required specification with distilled water, dispense into Erlenmeyer flasks of the required size, seal, and sterilize by the conventional method (for example, sterilize at 121 °C for 25 min. The sterilization method of the following media is the same as that of this medium).

[0079] ⑦ MS solid medium: Sucrose 20 g / L + MS medium powder 1.8 g / L + Agar 7 g / L

[0080] ⑧ MS liquid medium: Sucrose 20 g / L + MS medium powder 1.8 g / L

[0081] ⑥ - ⑧ The pH of the media is adjusted to 5.80 with 1 M sodium hydroxide, make up the volume to the required specification with distilled water, dispense into Erlenmeyer flasks of the required size, seal, and sterilize by the above method.

[0082] The main solution formulations are as follows:

[0083] ① Preparation of ZT (10 mg / mL) hormone: Weigh 90 mg of ZT, dissolve it with 600 μL of 1 M sodium hydroxide, make up the volume to 9 mL with distilled water, and store it at -20 °C for later use.

[0084] ② Preparation of IBA (1 mg / mL) hormone: Weigh 6 mg of IBA, make up the volume to 6 mL with distilled water, and store it at -20 °C for later use.

[0085] ③ Preparation of Ti Timentin solution (300 mg / mL): Weigh 1.8 g of Ti, make up the volume to 6 mL with distilled water, and store it at -20 °C for later use.

[0086] ④ Preparation of Kan kanamycin solution (100 mg / mL): Weigh 600 mg of Kan, make up the volume to 6 mL with distilled water, and store it at -20 °C for later use.

[0087] ⑤ Preparation of AS acetosyringone solution (20 mg / mL): Weigh 0.1 g of AS, make up the volume to 5 ml with DMSO, and store it at -20 °C for later use.

[0088] ⑥ 1 M sodium hydroxide stock solution: Weigh 4 g of sodium hydroxide, dissolve it with distilled water and make up the volume to 100 mL, and store it at room temperature for later use.

[0089] Example 4: Identification of gene - edited lines of tomato cytokinin receptor gene SlHK2

[0090] (1) Select the young leaves of T0 generation transgenic plants and extract DNA using the CTAB method.

[0091] The steps for DNA extraction using the CTAB method are as follows:

[0092] ① Preheat the CTAB extraction solution in a water bath at 65°C and add 1% volume of β-mercaptoethanol;

[0093] ② Pick 0.5 g of young leaves of tomato, quickly freeze them in liquid nitrogen, transfer them to a small mortar pre-cooled with liquid nitrogen in advance, and grind them thoroughly in liquid nitrogen;

[0094] ③ Transfer the ground powder to a PE tube containing 2 ml of preheated CTAB extraction solution, mix well, and incubate in a water bath at 65°C for 1 h, during which invert and mix 3 - 5 times;

[0095] ④ Take out the PE tube, cool it to room temperature, add an equal volume of chloroform / isoamyl alcohol (24:1), gently mix, centrifuge (8000 rpm, 16°C, 15 min), and transfer the supernatant to a new PE tube;

[0096] ⑤ Extract again, add an equal volume of chloroform / isoamyl alcohol (24:1), gently mix, centrifuge (8000 rpm, 16°C, 15 min), and transfer the supernatant to a new PE tube;

[0097] ⑥ Add an equal volume of absolute ethanol, gently mix until filamentous or flocculent precipitate appears, which is the crude extract;

[0098] ⑦ Pick out the clumped DNA and transfer it to a 1.5 ml PE tube, add 75% ethanol and incubate in an ice bath for 2 - 3 h, change 75% ethanol 2 - 3 times in the middle, air dry and then dissolve completely with 600 μl of ddH2O;

[0099] ⑧ Add 6 μl of RNase, incubate in a water bath at 37°C for 30 min, detect the extracted DNA by electrophoresis on a 1% agarose gel, and store it at -80°C in the refrigerator for later use.

[0100] (2) Using the sequences shown in SEQ ID No.3 and SEQ ID No.4 as primers, perform PCR amplification with the DNA obtained in (1) as the template. The reaction system is shown in Table 2. Detect the PCR products by electrophoresis on a 1% agarose gel. If there are PCR product bands and the size conforms to 304 bp shown in SEQ ID No.5, it indicates that the plant to which the template DNA belongs is likely to contain the transgene.

[0101] Table 2 Conventional PCR reaction system

[0102] <![CDATA[ddH2O]]> Up to 25μl Forward primer 1μl(0.2 - 0.3μM) Reverse primer 1μl(0.2 - 0.3μM) DNA template 2μl(0 - 500ng) Taq polymerase 12.5μl(1.25U)

[0103] (3) Collect the seeds obtained from the self - pollination of T0 transgenic plants and plant them in the intelligent greenhouse of Nanjing Agricultural University to obtain T1 plant lines. Growth conditions: 22°C during the day, light intensity 10000 Lux, 16 h; 18°C at night, dark for 8 h; humidity 60%, with other routine management.

[0104] (4) Select the young leaves of T1 plant lines and extract DNA using the CTAB method, with the method the same as (1).

[0105] (5) Transgenic identification: Using the sequences of SEQ ID No.3 and SEQ ID No.4 as primers, and the DNA extracted in (3) as a template for PCR amplification. The reaction system is shown in Table 2. The PCR products are detected by 1% agarose gel electrophoresis. If the reaction is successful but there is no PCR product band, it indicates that the transgenic fragment has been cleared from the plant through self - segregation.

[0106] (6) Using the upstream and downstream sequences of the sgRNA shown in SEQ ID No.1 of the WT tomato SlHK2 gene as templates, design specific primers: SlHK2 - F: 5'-TTGCGAGCGAGGGCTTCTG - 3' (SEQ ID No.6) and SlHK2 - R: 5'-GCATCTCGTGGCTCCTTGCA - 3' (SEQ ID No.7), which can amplify a fragment with a length of 479 bp in WT tomatoes. The specific sequence is:

[0107] GCATCTCGTGGCTCCTTGCAGGATCCCCAAAATCAAGGTTGCTAACGTGAAGTAATCCTGTGTCGTTCTCATCCATGCCATACATTTTAATTGGAGCAAACTTGTTAGTTGTATCATAAACATTTACCACAATAGTTTGTTTGCTCGCAAGCTGCTGCAGAAGCTTTTCAACTAATGATGGAACATCGTAAGAAGCACCAATGTACCTTTTCAACATTAATGCAAAAATGAACTCAATAAGAAATTAGGGATAAAAGACTTGATCACCACAAGGACAACATCTAGAGCTATAATAGAAAAATCCCAGGTTTATAGGAGGGAACTTACCCAACAGTAGCATTGATGCGGTCCACCGGGGTAGCATAAGGAAGGAGATGAGTATTATAGACCGCAAATGTAAGAACAACACCCAGGTGATTGGATTTCAATAGCTTAAACGGTGACGTCAAAACCCCCTTGCCAGAAGCCCTCGCTCGCAA(SEQ ID No.8).

[0108] Using the sequences of SEQ ID No.6 and SEQ ID No.7 as primers and the DNA extracted in (3) as a template for PCR amplification. The reaction system is shown in Table 2. The PCR products are detected by 1% agarose gel electrophoresis. If the band size is about 479 bp, they are submitted to a biological company for Sanger sequencing. The sequences obtained by sequencing are compared with the sequence shown in SEQ ID No.8 to analyze whether there are mutations at the SlHK2 targeting site in the T1 generation plants and the specific mutation types.

[0109] (7) Through transgenic identification and sequencing alignment analysis, 2 lines without transgenes and with homozygous mutations at the SlHK2 targeting site were obtained, named slhk2-11 and slhk2-22 respectively. One nucleotide T was inserted after the 6386th nucleotide in the SlHK2 gene sequence of the slhk2-11 line, and the 6386th nucleotide C was deleted in the SlHK2 gene sequence of the slhk2-22 line. Frameshift mutations occurred in the SlHK2 genes of both lines, and it is speculated that their normal functions are likely to be lost, and the SlHK2 gene was knocked out.

[0110] Example 5: Measurement of the longitudinal and transverse diameters and weight of tomato fruits

[0111] Select a number of plump seeds of WT, slhk2-22 and slhk2-11, place them in a petri dish, add an appropriate amount of water, and germinate them in a dark incubator at 28°C for 3-5 days. When the roots grow to about 3 cm, transplant them into flower pots (10 cm in length and width, 8.8 cm in height) filled with nutrient soil and place them in a plant growth chamber for growth. The environmental conditions in the growth chamber are as follows: day / night temperature 23°C / 19°C, day / night time 16 h / 8 h, relative humidity 50-55%, and light intensity 200 μmol m -2 ·s -1 . Select a number of WT and slhk2 seedlings with consistent growth 10 days after transplantation, plant them in flower pots filled with nutrient soil, and place them in a plant growth chamber for growth.

[0112] Observed the WT and slhk2 mutant lines in the reproductive growth stage and found that the plant height of the slhk2 mutant lines was significantly higher than that of the WT, the number of lateral buds and compound leaves was significantly reduced, and the flowering time was slightly delayed ( Figure 2 ). Observed the fruits of the WT and slhk2 mutant lines at the red-ripe stage and measured the longitudinal and transverse diameters and weights of the fruits. The longitudinal and transverse diameters of the fruits were measured using a vernier caliper, and the fruit weights were measured using a balance. As Figure 3 shown, the fruits of the two mutant types of slhk2 lines at the red-ripe stage were significantly larger than those of the WT. Among them, the longitudinal diameters of the fruits of slhk2-22 and slhk2-11 were 1.04 times and 1.12 times that of the WT, respectively, and the transverse diameters of the fruits were 1.15 times and 1.07 times that of the WT, respectively ( Figure 4 ). The weights of the fruits of the slhk2-22 and slhk2-11 lines at the red-ripe stage increased significantly, being 1.4 times and 1.26 times that of the WT, respectively ( Figure 5 ). This indicates that the knockout of the cytokinin receptor gene SlHK2 by the sgRNA-guided CRISPR / Cas9 gene editing shown in SEQ ID NO.1 can increase the size of tomato fruits and the fruit weight.

[0113] The present invention uses the designed sgRNA fragment of the tomato cytokinin receptor gene SlHK2 to construct the gene editing vector pYLCRISPRCas9Pubi-N-SlHK2 of the tomato cytokinin receptor gene SlHK2. Through genetic transformation and gene editing, tomato lines with the SlHK2 gene knocked out can be obtained, effectively increasing the size of tomato fruits.

[0114] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. Application of knocking out tomato cytokinin receptor gene SlHK2 in increasing tomato fruit size.

2. The application according to claim 1, characterized in that, The gene number of the tomato cytokinin receptor gene SlHK2 is LOC101255900, and the SlHK2 gene sequence is located at 59087453 - 59098895 bp on tomato chromosome 7 (Genbank accession number: NC_015444.3).

3. The application according to claim 2, wherein The application is to introduce a frameshift mutation in the region of 6370 - 6389 bp of the SlHK2 gene sequence, thereby knocking out the SlHK2 gene. The sequence of the region of 6370 - 6389 bp of the SlHK2 gene sequence is as shown in SEQ ID NO.

1.

4. Application of the knockout vector of tomato cytokinin receptor gene SlHK2 in increasing tomato fruit size.

5. The application according to claim 4, characterized in that The knockout vector is a CRISPR / Cas9 gene editing vector.

6. The application according to claim 4, characterized in that The knockout vector targets the sgRNA sequence shown in SEQ ID NO.

1.

7. The application according to claim 4, wherein The knockout vector is pYLCRISPRCas9Pubi - N - SlHK2, and the gene editing vector is obtained by replacing the sequence between the two BsaI restriction enzyme sites at 8807 bp - 9492 bp of the pYLCRISPRCas9Pubi - N general vector with the sgRNA - SlHK2 gene sequence. The sgRNA - SlHK2 gene sequence is composed of the AtU3d - C9 promoter, the sgRNA sequence shown in SEQ ID NO.1, and the sgRNA backbone sequence connected in sequence.

8. The application according to claim 7, characterized in that, The nucleotide sequence of the sgRNA - SlHK2 gene sequence is as shown in SEQID NO.

2.

9. Application of the transgenic engineering bacteria transfected with the knockout vector of tomato cytokinin receptor gene SlHK2 described in any one of claims 4 to 8 in increasing tomato fruit size.

10. The application according to claim 9, characterized in that, The transgenic engineering bacteria use Agrobacterium EHA105 as the host cell.

Images