Application of kinase inhibitor in improving nucleic acid editing efficiency

By combining the kinase inhibitor Cenisertib with the CRISPR-Cas system, the problem of low single-base mutation efficiency of CRISPR Cas technology at RNA level was solved, and the nucleic acid editing efficiency was significantly improved.

CN120272529APending Publication Date: 2025-07-08CHINESE PEOPLES LIBERATION ARMY ARMY SPECIAL MEDICAL CENTER
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510450005.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-11
Publication Date
2025-07-08

AI Technical Summary

Technical Problem

The existing CRISPR Cas technology is inefficient when introducing single-base mutations at the RNA level.

Method used

The kinase inhibitor Cenisertib is used to improve the nucleic acid editing efficiency, and by combining it with the CRISPR-Cas13b, CRISPR-Cas13x, and CRISPR-Cas13j nucleic acid editing systems, the efficiency of nucleic acid editing tools is enhanced.

Benefits of technology

The nucleic acid editing efficiency of CRISPR-Cas13b, CRISPR-Cas13x and CRISPR-Cas13j was significantly improved, and 8.3%, 11.7% and 11% respectively.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120272529A_ABST
    Figure CN120272529A_ABST
Patent Text Reader

Abstract

The invention relates to application of a kinase inhibitor in improvement of nucleic acid editing efficiency, belongs to a new strategy of old drugs, and verifies the kinase inhibitor screened from a drug compound library in an endogenous gene and exogenous gene nucleic acid editing experiment to prove that the screened compound can effectively improve the editing efficiency of a nucleic acid editing tool. According to the method disclosed by the invention, by taking Censertib as an example, the nucleic acid editing efficiency of the CRISPR-Cas13b can be improved by 8.3%, the nucleic acid editing efficiency of the CRISPR-Cas13x can be improved by 11.7%, the nucleic acid editing efficiency of the CRISPR-Cas13j can be improved by 11%, and the application prospect is wide.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to the application of kinase inhibitors in improving nucleic acid editing efficiency. Background Art

[0002] The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) system is an immune defense mechanism in bacteria and archaea, mainly including the CRISPR locus and Cas proteins (CRISPR-associated proteins), which has been developed as a powerful gene editing tool in recent years. The CRISPR single-base mutation system is a gene editing tool based on CRISPR-Cas technology, which can achieve precise replacement of a single base in the genome without generating DNA double-strand breaks (DSBs). As an efficient and precise gene editing tool, the CRISPR single-base mutation system is continuously promoting the development of gene editing technology in basic research and clinical applications. Improving the mutation efficiency of this system can not only enhance the precision and reliability of gene editing, but also expand its application scope in the fields of medicine, agriculture and basic research, which has important scientific and clinical significance. Summary of the Invention

[0003] The present invention aims to solve at least one of the technical problems in the related art to some extent. For this reason, the main object of the present invention is to provide an application of kinase inhibitors in improving nucleic acid editing efficiency, aiming to solve the problem of low mutation efficiency when using CRISPR Cas technology to modify base sequences and introduce single-base mutations at the RNA level.

[0004] The object of the present invention is achieved by the following technical solutions:

[0005] The application of kinase inhibitors in improving nucleic acid editing efficiency, wherein the kinase inhibitors include but are not limited to: one or a mixture of more than one of Cenisertib, Imatinib, Dasatinib, Nilotinib, Gefitinib, Erlotinib, Ibrutinib, Afatinib, Ibrutinib, Afatinib, Vemurafenib, Dabrafenib, Vemurafenib, Palbociclib, Idelalisi, Idelalisib.

[0006] Further, the kinase inhibitor is Cenisertib.

[0007] Furthermore, the application of the kinase inhibitor in a drug for improving the nucleic acid editing efficiency of a human cell line / human primary cell / target cell in vivo, wherein the nucleic acid includes endogenous or exogenous nucleic acid.

[0008] Furthermore, the human cell line is 293T cells or A549 cells.

[0009] Furthermore, the human primary cell is one of human induced pluripotent stem cells, human primary T cells, and human hematopoietic stem cells.

[0010] Furthermore, the target cell in vivo is a rodent or human target cell.

[0011] Furthermore, the drug includes a pharmaceutically acceptable carrier.

[0012] Furthermore, the dosage form of the drug is any pharmaceutically acceptable dosage form.

[0013] Furthermore, the dosage of the drug is any pharmaceutically acceptable dosage.

[0014] The method for the kinase inhibitor to improve the nucleic acid editing efficiency in cells, when nucleic acid editing is performed in cells, the cells are contacted with the kinase inhibitor; the tools for nucleic acid editing include the CRISPER CAS9, or CRISPER CAS12, or CRISPER CAS13b, or CRISPER CAS13x, or CRISPER CAS13j nucleic acid editing system.

[0015] Compared with the prior art, the present invention has at least the following advantages:

[0016] The present invention relates to the application of a kinase inhibitor in improving the nucleic acid editing efficiency, belonging to the strategy of repurposing old drugs. Through verification in the nucleic acid editing experiments of endogenous genes and exogenous genes with the kinase inhibitor screened from the drug compound library, it is confirmed that the screened compound can effectively improve the editing efficiency of the nucleic acid editing tool. Taking Cenisertib as an example in the present invention, Cenisertib can significantly improve the exogenous gene mutation efficiency, increase the CRISPR-Cas13b nucleic acid editing efficiency by 8.3%, increase the CRISPR-Cas13x nucleic acid editing efficiency by 11.7%, and increase the CRISPR-Cas13j nucleic acid editing efficiency by 11%, with broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the specific embodiments of the present invention, the drawings required for use in the specific embodiments or the description of the prior art will be briefly introduced below.

[0018] Figure 1Picture for the homology structure modeling, three-dimensional structure analysis, active site selection and virtual screening in Example 1 of the present invention;

[0019] Figure 2 Schematic diagram and screening results of further screening the drugs obtained by virtual screening using a reporter plasmid provided in Example 2 of the present invention.

[0020] Figure 3 Flow cytometry analysis chart for detecting that Cenisertib can improve the exogenous gene editing efficiency of different CRISPR / Cas13 provided in Example 3 of the present invention;

[0021] Figure 4 Result chart for detecting that Cenisertib can improve the exogenous gene editing efficiency of different CRISPR / Cas13 provided in Example 3 of the present invention;

[0022] Figure 5 Waveform chart for detecting that Cenisertib can improve the endogenous gene editing efficiency of different CRISPR / Cas13 provided in Example 4 of the present invention;

[0023] Figure 6 Result chart for detecting that Cenisertib can improve the endogenous gene editing efficiency of different CRISPR / Cas13 provided in Example 4 of the present invention. Detailed implementation manners

[0024] The present invention will be further described in detail below with reference to the drawings and embodiments. The following embodiments are only descriptive and not restrictive, and the protection scope of the present invention cannot be limited thereby.

[0025] Unless otherwise specified, the professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods or materials similar or equivalent to the described content can also be applied to the present invention. Unless otherwise specified, the technical means and operation methods used in the following embodiments are conventional means and methods well known to those skilled in the art, and the raw materials used are all commercially available products.

[0026] The technical solution of the present invention will be further described below with reference to the drawings and embodiments. For the experimental methods without specific conditions noted in the following embodiments, they are usually carried out under the conditions described in the conventional conditions or according to the conditions recommended by the manufacturer.

[0027] Example 1 Virtual screening

[0028] In this example, homology structure modeling was performed on Cas13X and ADAR, the three-dimensional structure was analyzed, the active site was selected, and virtual screening was carried out. 1,664 small molecule compounds that can interact with them were preliminarily screened out. The screening schematic diagram is as Figure 1as shown

[0029] Example 2: Plasmid-assisted screening of the reporter

[0030] In this example, a reporter plasmid and a gene editing plasmid were used. First, a nonsense mutation [W98X (UGG to UAG)] was introduced into the base sequence expressing mCherry in the reporter plasmid. After transfection, mCherry fluorescence could not be expressed. If the A base at the 293rd position of this reporter plasmid was edited to G, it indicated that the nonsense mutation was repaired to the wild-type codon, and mCherry fluorescence could be expressed. The intensity of the fluorescence reflected the efficiency of the A-to-G mutation. The gene editing plasmid was a CRISPR-Cas13 plasmid, which contained gRNA and GFP and had the function of mutating the A at the 293rd position of mutant mCherry to G.

[0031] 293T cells were evenly seeded in a 96-well plate, with 10,000 cells seeded in each well. After 24 hours, the cells grew to 70 - 80%. Transfect the plasmids: Prepare solution A: Mix 5 μL of OPTI-MEM and 0.6 μL of Lipo3000 and incubate for 10 minutes; Prepare solution B: Mix 5 μL of OPTI-MEM, 0.6 μL of P3000, 150 ng of the reporter plasmid, and 150 ng of the gene editing plasmid, and incubate for 10 minutes; Mix solutions A and B and incubate at room temperature for 15 minutes; Add the mixed solution to the 293T cells. After 24 hours of transfection, add 1 μM of the virtual screening drug library respectively. After 24 hours, use a microplate reader to detect the fluorescence intensities of mCherry and GFP in each well of the cells. The higher the ratio, the higher the editing efficiency from A to G. The results are as Figure 2 shown. A is a schematic diagram of the screening method; B is the screening result. The indicated position by the label has the highest ratio of mCherry and GFP fluorescence intensities after adding the compound Cenisertib.

[0032] Example 3: Detection of exogenous gene mutation efficiency

[0033] In this application, the editing efficiency of different CRISPR / Cas13 systems by Cenisertib in vitro was tested. Taking the detection of the mutation efficiency of a human cell line as an example, the specific steps are as follows: Seed 293T cells in a 12-well plate, and the number of cells seeded in each well is 5×10 5, after 24 h, co - transfection of the mCherry reporter plasmid and gene - editing plasmids (CRISPR - Cas13b, CRISPR - Cas13x, and CRISPR - Cas13j plasmids) was carried out; Prepare Solution A: Mix 60 μL of OPTI - MEM and 6 μL of Lipo3000 and incubate for 10 minutes; Prepare Solution B: Mix 60 μL of OPTI - MEM, 6 μL of P3000, and 3000 ng of plasmid (1500 ng of reporter plasmid + 1500 ng of gene - editing plasmid) and incubate for 10 minutes; Mix Solution A and Solution B and incubate at room temperature for 15 minutes; Add the mixed solution to 293T cells, mix well and culture for 24 hours, then add 10 nM Cenisertib and continue to culture for 24 hours. The proportion of mCherry - positive cells was detected by flow cytometry.

[0034] The detection results are as Figure 3 and Figure 4 shown. Figure 3 Taking DMSO as a control, after adding 10 nM Cenisertib, the proportion of mCherry - positive cells after the CRISPR - Cas13b, CRISPR - Cas13x, and CRISPR - Cas13j induced gene mutations in the exogenous reporter plasmid expression. Figure 4 is a bar chart; The results show that for human 293T cells, Cenisertib significantly improves the efficiency of exogenous gene point mutations induced by CRISPR - Cas13b, CRISPR - Cas13x, and CRISPR - Cas13j: Compared with the blank group (DMSO), adding Cenisertib increased the mutation efficiency of CRISPR - Cas13b by 4.9%, CRISPR - Cas13x by 19.0%, and CRISPR - Cas13j by 39.3%.

[0035] Example 4 Detection of endogenous gene mutation efficiency

[0036] In this application, the editing efficiency of Cenisertib on different CRISPR / Cas13 systems was tested in vitro. Taking the detection of the mutation efficiency of human cell lines as an example, the specific steps are as follows: Seed 293T cells in a 12 - well plate, and the number of cells seeded in each well is 5×10 5, transfection with gene editing plasmids (CRISPR-Cas13b, CRISPR-Cas13x, and CRISPR-Cas13j plasmids) was performed after 24 h; Solution A was prepared: 60 μL of OPTI-MEM and 6 μL of Lipo3000 were mixed and incubated for 10 minutes; Solution B was prepared: 60 μL of OPTI-MEM, 6 μL of P3000, and 3000 ng of the target plasmid were mixed and incubated for 10 minutes; Solutions A and B were mixed and incubated at room temperature for 15 minutes; the mixed solution was added to 293T cells, and after mixing, the cells were cultured for 24 hours, then 10 nM Cenisertib was added, and the cells were cultured for another 24 hours. RNA was extracted and reverse transcribed, and PCR amplification was carried out (forward primer: TACTCCCGGCCCCCGC CATTT (SEQ ID NO.1); reverse primer: AGAAAGCCCTCCCCAGTCCT (SEQ ID NO.2)). The PCR products were subjected to first-generation sequencing, and the editing efficiency of the 24th base A to base G of the KRAS gene was calculated using the online tool EditR (http: / / baseeditr.com / ).

[0037] The detection results are as Figure 5 and Figure 6 shown. Figure 5 Figure [X] is a waveform diagram of the point mutation efficiency results of human 293T cells transfected with CRISPR-Cas13b, CRISPR-Cas13x, and CRISPR-Cas13j gene editing plasmids with DMSO as a control and 10 nM Cenisertib added. Figure 6 Figure [X] is a bar chart. The results show that for human 293T cells, Cenisertib significantly improves the point mutation efficiency of CRISPR-Cas13b, CRISPR-Cas13x, and CRISPR-Cas13j: compared with the blank group (DMSO), adding Cenisertib increases the nucleic acid editing efficiency of CRISPR-Cas13b by 8.3%, increases the nucleic acid editing efficiency of CRISPR-Cas13x by 11.7%, and increases the nucleic acid editing efficiency of CRISPR-Cas13j by 11%.

[0038] Based on the strategy of repurposing old drugs, the present invention screened a drug compound library and verified it through cell experiments. Compared with developing new drugs from scratch, repurposing old drugs based on the redevelopment of existing drugs can save a large amount of upfront R & D investment and new drug R & D time; combined with later verification experiments, it greatly increases the reliability of the compound screening results; through verification, it is known that Cenisertib can be used as a drug to improve nucleic acid editing.

[0039] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that: they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements on some or all of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention, and they should all be covered within the scope of the claims and the description of the present invention.

Claims

1. Use of a kinase inhibitor in enhancing nucleic acid editing efficiency, characterized in that, The kinase inhibitors include, but are not limited to: one or a mixture of more than one of Cenisertib, Imatinib, Dasatinib, Nilotinib, Gefitinib, Erlotinib, Ibrutinib, Afatinib, Ibrutinib, Afatinib, Vemurafenib, Dabrafenib, Vemurafenib, Palbociclib, Idelalisi, Idelalisib.

2. The application according to claim 1, characterized in that, The kinase inhibitor is Cenisertib.

3. The application according to claim 1 or 2, characterized in that, Use of the kinase inhibitor in a drug for increasing the nucleic acid editing efficiency of a human cell line / human primary cell / target cell in vivo, wherein the nucleic acid includes endogenous or exogenous nucleic acid.

4. The application according to claim 3, characterized in that The human cell line is 293T cells or A549 cells.

5. The application according to claim 3, characterized in that, The human primary cell is one of human induced pluripotent stem cells, human primary T cells, and human hematopoietic stem cells.

6. The application according to claim 3, wherein The target cell in vivo is a rodent or human target cell.

7. The application according to claim 3, characterized in that, The drug includes a pharmaceutically acceptable carrier.

8. The application according to claim 7, wherein The dosage form of the drug is any pharmaceutically acceptable dosage form.

9. The application according to claim 8, characterized in that, The dosage of the drug is any pharmaceutically acceptable dosage.

10. A method for increasing nucleic acid editing efficiency in cells by the kinase inhibitor according to claim 1 or 2, characterized in that, When nucleic acid editing is performed on cells, the cells are contacted with the kinase inhibitor; the tools for nucleic acid editing include the CRISPERCAS9, or CRISPER CAS12, or CRISPER CAS13b, or CRISPER CAS13x, or CRISPER CAS13j nucleic acid editing system.