A molecular marker related to the level of natural immunoglobulin g antibody in chicken plasma and application thereof
By providing SNP molecular markers and primer pairs related to chicken plasma innate immunoglobulin G antibody levels, the problem of the cumbersome process of measuring chicken plasma innate immunoglobulin G antibody was solved, enabling early and precise breeding selection and improving breeding efficiency and accuracy.
Patent Information
- Application Number
- CN202510354470.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-25
- Publication Date
- 2025-12-09
- Estimated Expiration
- 2045-03-25
AI Technical Summary
The current technology for measuring chicken plasma natural immunoglobulin G antibody levels is cumbersome, costly, and slow, making it difficult to perform early and precise trait selection at the genetic level.
This invention provides a SNP molecular marker associated with the level of chicken plasma innate immunoglobulin G antibody. By detecting the genotype of the SNP molecular marker, individuals with high or low levels of chicken plasma innate immunoglobulin G antibody can be screened. Specific primer pairs can be designed for detection, enabling early and precise breeding selection.
It significantly improves the efficiency and accuracy of chicken breeding, can be applied on a large scale to chicken breeding, promotes industrial development, and provides strong technical support.
Smart Images

Figure CN120272603B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of livestock breeding, in particular to a molecular marker related to the level of natural immunoglobulin G antibody in chicken plasma and application thereof. BACKGROUND
[0002] Natural antibodies are antibodies produced by the animal body without any antigen stimulation, and belong to the components of the innate immune system, which is the first line of defense against pathogens. The level of natural antibodies can reflect the potential immune capacity and disease resistance of animals. Efficient production of laying hens and broilers highly depends on continuous high-intensity selection of key economic traits such as growth rate, feed conversion efficiency and egg production, as well as the cultivation of specialized breeds. However, while improving production performance, the animal's immunity is usually reduced, and the general disease resistance is weakened. This phenomenon poses a new challenge to poultry farming, that is, while pursuing high-efficiency production, the animal health is threatened. Studies have shown that the level of natural immunoglobulin G antibody in chicken plasma is closely related to the general disease resistance, viability and production performance of chickens, and the higher the IgG antibody level, the stronger the resistance to common diseases. This trait has a moderate heritability, so it is a suitable trait for selection. However, the determination process of this trait is quite cumbersome, and the determination age usually needs to be performed after the chicken matures, which makes the selection cycle longer. Traditional selection methods based on trait determination and pedigree combination have the problems of high cost and slow selection process. Genome-wide association analysis (GWAS) deeply mines SNPs and other genetic variations related to complex traits at the genomic level, and selects genetic variations by means of SNP and other molecular marker technologies, so as to realize early and accurate selection of traits, thereby significantly improving the selection efficiency of target traits at the genetic level and accelerating the genetic progress. Therefore, it is expected to provide a molecular marker related to the level of natural immunoglobulin G antibody in chicken plasma and apply it to chicken selection, so as to breed chickens with high level of natural immunoglobulin G antibody in plasma. SUMMARY
[0003] The purpose of the present application is to provide a molecular marker related to the level of natural immunoglobulin G antibody in chicken plasma and application thereof.
[0004] To achieve the above-mentioned purpose, the present application provides the following technical scheme:
[0005] One of the technical schemes of the present application is:
[0006] A SNP molecular marker related to the level of natural immunoglobulin G antibody in chicken plasma, the SNP molecular marker is the 251st nucleotide in SEQ ID NO: 1, and the polymorphic form is G or A.
[0007] Further, when the SNP molecular marker is AA genotype, the level of natural immunoglobulin G antibody in chicken plasma is high; when the SNP molecular marker is GG genotype, the level of natural immunoglobulin G antibody in chicken plasma is low.
[0008] The second technical scheme of the present application is:
[0009] A primer pair for detecting the SNP molecular marker related to the level of natural immunoglobulin G antibody in chicken plasma, wherein the nucleotide sequence of the upstream primer is ACCGTCACAGCACTCACCTCT, and the nucleotide sequence of the downstream primer is CACACCACAACAAGCAGAACCT.
[0010] The third technical scheme of the present application is the application of the SNP molecular marker related to the level of natural immunoglobulin G antibody in chicken plasma in identifying or assisting in identifying the level of natural immunoglobulin G antibody in chicken plasma, which specifically comprises detecting the genotype of the SNP in the chicken to be tested, and the chicken to be tested with AA genotype is an individual with high level of natural immunoglobulin G antibody in plasma, and the chicken to be tested with GG genotype is an individual with low level of natural immunoglobulin G antibody in plasma.
[0011] The fourth technical scheme of the present application is:
[0012] The application of the SNP molecular marker related to the level of natural immunoglobulin G antibody in chicken plasma in chicken breeding, which specifically comprises detecting the genotype of the SNP in the chicken to be tested, and selecting the parent with AA genotype for breeding of the high level natural immunoglobulin G antibody strain.
[0013] Compared with the prior art, the present application has the following beneficial effects:
[0014] The SNP molecular marker related to the level of natural immunoglobulin G antibody in chicken plasma provided by the present application can be used for breeding of the level of natural immunoglobulin G antibody in chicken plasma at the genetic level, directly screening the level of natural immunoglobulin G antibody in chicken plasma from the root source, accurately grasping the genetic information, effectively avoiding the drawbacks of traditional methods, significantly improving the efficiency and accuracy of breeding, and can be large-scale applied to chicken breeding practice, promoting the development of industry.
[0015] The primer pair for detecting the SNP molecular marker related to the level of natural immunoglobulin G antibody in chicken plasma provided by the present application further facilitates the detection of the SNP molecular marker and the identification of the genotype, and provides strong technical support for chicken breeding. BRIEF DESCRIPTION OF DRAWINGS
[0016] Various other advantages and benefits will become apparent to those of ordinary skill in the art, upon reading the following detailed description of the preferred embodiments. The accompanying drawings are intended to further aid the understanding of the various embodiments of the preferred embodiments, and are not intended to limit the present application. Moreover, like reference numerals designate similar parts throughout the several views in the drawings. In the drawings:
[0017] Figure 1 Manhattan plot for genome-wide association analysis of plasma natural immunoglobulin G antibody levels trait in chickens 50 weeks of age. DETAILED DESCRIPTION
[0018] Various example embodiments of the present application will now be described in detail with reference to the drawings. The detailed description is merely intended to teach a few examples of the present application and is not intended to limit the scope of the application. Rather, the detailed description merely describes a few example embodiments of the present application and is not intended to limit the scope of the application. The application has general applicability.
[0019] Further, for the recitation of numeric ranges herein, it is contemplated that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limits of that range is also contended. Each smaller range between any stated value or intervening value in a stated range and any other stated value or intervening value in that stated range is contemplated. The upper and lower limits of these smaller ranges can independently be included or excluded in the range, and are also contended herein.
[0020] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All patents, patent applications, publications, and descriptions mentioned herein are incorporated by reference to the extent allowed by law. Nothing herein is to be construed as an admission that the application is not entitled to antedate such disclosure by virtue of prior application.
[0021] Various modifications and changes can be made to the specific embodiments of the application described herein without departing from the scope or spirit of the application. Other embodiments of the application will be apparent to those of ordinary skill in the art from the description and examples presented herein. The description and examples presented herein are meant as illustrative only and are not meant to limit the scope of the application.
[0022] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean including, but not limited to.
[0023] Example 1
[0024] Identification of SNP molecular markers associated with plasma natural immunoglobulin G antibody levels trait in chickens
[0025] 1. Experimental animals
[0026] A total of 872 mixed populations (including white leghorn chickens, Beijing oil chickens, and white leghorn and Beijing oil chicken reciprocal cross hybrid populations) were used in this example. Free feeding and drinking water were provided during the feeding period, and the feeding standards followed the relevant provisions of the industry standard (NY / T 33-2004).
[0027] 2. Phenotype determination
[0028] When the chicken population was fed to 50 weeks of age, 1 mL of blood was collected from the wing vein of all test chickens using an anticoagulant vacuum blood collection tube. The upper plasma was separated by centrifugation at 200 g for 2 minutes using a 4°C low-temperature centrifuge and stored at -80°C for later use. The natural immunoglobulin G antibody level in the plasma was determined according to the ELISA method reported in the literature (Poultry Science, 2011, 90:2263-2274).
[0029] 3. Extraction of genomic DNA
[0030] 0.5 mL of blood was collected from the wing vein of all test chickens using an anticoagulant vacuum blood collection tube, and whole genomic DNA was extracted using the phenol-chloroform extraction method. The DNA samples with qualified concentration and purity were further detected by agarose gel electrophoresis to further detect the purity and integrity of the DNA samples. The sample concentration was required to be greater than 50 ng / μL, the purity OD260 / 280 was 1.8-2.0, and the integrity was good. The DNA samples were stored at -20°C for later use.
[0031] 4. Genomic resequencing
[0032] All DNA samples of the test chickens were subjected to individual whole-genome resequencing using the DNBSEQ sequencing platform according to the standard operating procedure, with a sequencing depth of about 15x. Sequence alignment and genotype extraction were performed using BWA and GATK software. After further quality control using SNPcaII rate and MAF, 11892646 SNPs and 872 individuals were obtained for subsequent analysis.
[0033] 5. Whole-genome association analysis
[0034] After the pedigree data, phenotype data, and genomic SNP site data were sorted out, whole-genome association analysis was performed using GCTA software. The single-variable mixed linear model was:
[0035] y = Xb + jα + u + e
[0036] y - phenotype value;
[0037] b - fixed effect (including population effect and cage position effect);
[0038] X - corresponding relationship matrix;
[0039] j - additive genotype of the SNP site to be detected;
[0040] a - additive SNP effect;
[0041] u - random animal effect, subject to where G is the genomic additive relationship matrix, is the additive genetic variance;
[0042] e - residual effect subject to where I is the identity matrix, is the residual variance. Define P <1E-6 as the significance threshold;
[0043] The results of the GWAS analysis are shown in Figure 1 The chicken 50-week-old plasma natural immunoglobulin G antibody level trait was significantly associated with the interval of 1.48 Mb on chromosome 31 (chr31: 137183-1613893). Further verification of all sites in the genomic association region locked the chr31: 386365 site as a candidate site;
[0044] The genetic markers affecting the chicken 50-week-old plasma natural immunoglobulin G antibody level trait are shown in Table 1;
[0045] Table 1 Genetic markers affecting the chicken 50-week-old plasma natural immunoglobulin G antibody level trait
[0046]
[0047] Example 2
[0048] Correlation of different genotypes of the chr31: 386365 site with the chicken plasma natural immunoglobulin G antibody level
[0049] 1. Experimental animals
[0050] A total of 872 mixed populations (including Bailaihang chickens, Beijing oil chickens, and Bailaihang and Beijing oil chicken reciprocal cross hybrid populations) were used in this example. Free feeding and drinking water were provided during the feeding period, and the feeding standards followed the relevant provisions of the industry standard (NY / T 33-2004).
[0051] 2. Phenotype determination
[0052] All test chickens were fed to 50 weeks of age, and 1 mL of blood was collected from the wing vein using an anticoagulant vacuum blood collection tube. The blood was centrifuged at 200 g for 2 minutes using a low-temperature centrifuge at 4°C, and the upper plasma was separated and stored at -80°C for use. The natural immunoglobulin G antibody level in the plasma was determined according to the ELISA method reported in the literature (Pou ltry Science, 2011, 90:2263-2274);
[0053] 3. Extraction of genomic DNA
[0054] All test chickens were fed to 50 weeks of age, and 1 mL of blood was collected from the wing vein using an anticoagulant vacuum blood collection tube. The blood was centrifuged at 200 g for 2 minutes using a low-temperature centrifuge at 4°C, and the upper plasma was separated and stored at -80°C for use. The natural immunoglobulin G antibody level in the plasma was determined according to the ELISA method reported in the literature (Pou ltry Science, 2011, 90:2263-2274);
[0055] 4. Genotyping of the chr31:386365 locus
[0056] All test chicken DNA samples were subjected to individual whole-genome resequencing using the DNBSEQ sequencing platform according to the standard operating procedure, with a sequencing depth of about 15x. Sequence alignment and genotype extraction were performed using BWA and GATK software. After further quality control using SNPca l l rate and MAF, 11892646 SNPs and 872 individuals were obtained for subsequent analysis.
[0057] The pedigree data, phenotype data, and genomic SNP site data were sorted out, and the chr31:386365 locus was locked. The chr31:386365 locus genotype was typed into three types: GG genotype, GA genotype, and AA genotype.
[0058] 5. Determination of the phenotype advantage genotype
[0059] The 50-week-old plasma natural immunoglobulin G antibody levels of chicken chr31:386365 SNP locus individuals with different genotypes are shown in Table 2. At the chr31:386365 locus, the 50-week-old plasma natural immunoglobulin G antibody titer of the GG genotype individual was 7.99, that of the GA genotype individual was 8.58, and that of the AA genotype individual reached 9.00.
[0060] The data show that the AA genotype is significantly associated with high levels of plasma natural immunoglobulin G antibodies, and the GG genotype is associated with low levels of plasma natural immunoglobulin G antibodies.
[0061] Table 2 Plasma natural immunoglobulin G antibody levels of individuals with different genotypes of the chicken chr31:386365 SNP site at 50 weeks of age
[0062]
[0063] Note: Different letters among groups indicate significant differences (P < 0.05).
[0064] Example 3
[0065] Establishment of a molecular marker detection method for the chr31:386365 SNP site and its application in breeding
[0066] 1. Construction of a molecular marker detection method
[0067] Based on the DNA sequence information adjacent to the chr31:386365 SNP site published in the Ensembl database, specific primers were designed and synthesized for PCR amplification;
[0068] The nucleotide sequence of SEQ ID NO: 1 corresponds to the region of 250 bases adjacent to the 386365th nucleotide from the 5' end and its adjacent upstream and downstream on chromosome 31;
[0069] SEQ ID NO: 1:
[0070] TACAGTCTTCCTAACTTTTCATGGGCTTTTAATTTTGTTTCTTTGCAGAAAATGAGGATGCAGAGAA
[0071] AAGAATTGGTAAGGATAATTTTAACTTAGAAAAGTCCTTAAAAAACATTTAAGTTTTGTTTGATCAG
[0072] AAATACTATTTTAGAATGGACTAGTGAAACATTTTGAGATCTTTAAAGGACTGGAGGACCGTCACAGCACTCACCTCTCTTTCACACTTTGAGGCTTAGTTGTCCCTGAAAAAAAGG / ATTGTATCTGCCACAA TCTTTGTCTCTGGAATGTCTATTTCCATAGTAAGGGAGTATCATTTAAGTAGTCCGGCAGAGGTTCTTTTTTTTTTTTTTTTTTCTGTAAGTGAGAAAAAATGTCTCTTTCTACTAACTAACTTACATATCTAAAGAGGGGAATAATACCTATAGAGAGAGGGAGACACATTCATATGCACTTTGACTCTTGGCAACGTAAAGGTTCTGCTTGTTGTGGTGTGAAGCATATCCAC
[0073] PCR amplification primer sequences are shown in Table 3;
[0074] Table 3 PCR amplification primer sequences
[0075]
[0076] PCR amplification system is shown in Table 4;
[0077] Table 4 PCR amplification system
[0078]
[0079] PCR amplification conditions are shown in Table 5;
[0080] Table 5 PCR amplification conditions
[0081]
[0082] The amplified product is analyzed by one generation sequencing technology to determine the genotype of the chr31:386365 site; the genotype result covers three types of GG, GA and AA;
[0083] 2. Using the chr31:386365 site molecular marker to select and breed chicken plasma natural immunoglobulin G antibody level
[0084] In order to select individuals with a higher level of chicken plasma natural immunoglobulin G antibody, 220 Beijing You chickens were selected as research objects; at 5 weeks of age, blood samples were collected from the research objects one by one, and then genomic DNA was extracted according to the procedure of step 3 in Example 1; the target site sequence was amplified using specific primers, and genotyping was performed using first-generation sequencing technology;
[0085] The genotyping results showed that the number of individuals with GG genotype was 15, the number of individuals with GA genotype was 80, and the number of individuals with AA genotype was 125;
[0086] In view of the genotype with a higher level of chicken plasma natural immunoglobulin G antibody, AA genotype individuals were preferentially selected; then, the chickens were raised to 50 weeks of age to determine the level of plasma natural immunoglobulin G antibody; the correlation of chicken chr31:386365 site in Beijing You chickens with different genotypes and the level of plasma natural immunoglobulin G antibody at 50 weeks of age is shown in Table 6; the average plasma natural immunoglobulin G antibody titer of individuals with GG genotype at 50 weeks of age was 7.89; that of individuals with GA genotype was 8.25; and that of individuals with AA genotype reached 8.96.
[0087] Table 6 Correlation of chicken chr31:386365 site in Beijing You chickens with different genotypes and the level of plasma natural immunoglobulin G antibody at 50 weeks of age
[0088]
[0089] Note: Different letters between groups indicate significant differences (P < 0.05).
[0090] Finally, it should be noted that: the above examples are only used to illustrate the technical solutions of the present application and not to limit it, although the present application has been described in detail with reference to the above examples, those skilled in the art should understand that: the specific embodiments of the present application can still be modified or replaced equivalently without departing from the spirit and scope of the present application, any modification or equivalent replacement without departing from the spirit and scope of the present application should be covered within the protection scope of the claims of the present application.
Claims
1. A primer pair for detecting a SNP molecular marker associated with the level of natural immunoglobulin G antibody in chicken plasma, characterized in that, The nucleotide sequence of the upstream primer in the primer pair is ACCGTCACAGCACTCACCTCT, and the nucleotide sequence of the downstream primer is CACACCACAACAAGCAGAACCT. The SNP molecular marker is the 251th nucleotide in SEQ ID NO:1, and the polymorphic form is G or A; when the SNP molecular marker is AA genotype, the level of natural immunoglobulin G antibody in chicken plasma is high; and when the SNP molecular marker is GG genotype, the level of natural immunoglobulin G antibody in chicken plasma is low.
2. Use of a primer pair according to claim 1 for identifying or aiding in the identification of the level of natural immunoglobulin G antibodies in chicken plasma, characterized in that, The application is specifically: using the primer pair to detect the genotype of the SNP in the test chicken, when the genotype is AA type, the test chicken individual is an individual with high level of natural immunoglobulin G antibody in plasma; and when the genotype is GG type, the test chicken individual is an individual with low level of natural immunoglobulin G antibody in plasma. The chicken individual is either a white leghorn chicken or a Beijing fatty chicken.
3. Use of a primer pair according to claim 1 in chicken breeding, characterized in that, The application is specifically: using the primer pair to detect the genotype of the SNP in the test chicken, selecting the parent with AA genotype to breed the high level of natural immunoglobulin G antibody in plasma strain, and the test chicken is either a white leghorn chicken or a Beijing fatty chicken. The application is specifically: using the primer pair to detect the genotype of the SNP in the test chicken, selecting the parent with AA genotype to breed the high level of natural immunoglobulin G antibody in plasma strain, and the test chicken is either a white leghorn chicken or a Beijing fatty chicken.
Citation Information
Patent Citations
Molecular marker related to broiler chicken antibody titer, detection method and application
CN116516026A
SNP (Single Nucleotide Polymorphism) molecular marker of gene PLA2G7 related to chicken immune traits and application of SNP molecular marker
CN117305473A
Cited By
SNP (Single Nucleotide Polymorphism) molecular marker related to chicken immune traits and application
CN122235316A