Wheat stem WSC content related allelic variation, molecular marker and application

By developing the 156bp allelic variation and related molecular markers of the wheat 6-FEH gene, the problem of improving the WSC content of stems was solved, efficient molecular marker-assisted selection breeding was achieved, and wheat yield and drought resistance and heat resistance were improved.

CN120272634APending Publication Date: 2025-07-08YANGZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510441864.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-09
Publication Date
2025-07-08

AI Technical Summary

Technical Problem

The prior art lacks allelic variation research and related molecular markers of wheat 6-FEH gene, which makes it difficult to efficiently improve the water-soluble carbohydrate content of stems, affecting wheat yield and drought resistance and heat resistance.

Method used

An insertion/deletion allelic variant of 156bp downstream of the 6-FEH gene transcription termination base on the wheat 2D chromosome was developed, and a 6-FEH_D4F and 6-FEH_D4R primer sequence was designed to detect this allelic variant, assist in identifying the WSC content of stems, and selecting wheat varieties with high WSC content of stems.

Benefits of technology

By detecting wheat genotype, the selection efficiency of excellent genotypes for 6-FEH genes is significantly improved, the molecular marker-assisted selection and breeding efficiency of stem WSC content is improved, and the genetic improvement of wheat stem WSC content is promoted.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120272634A_ABST
    Figure CN120272634A_ABST
Patent Text Reader

Abstract

The invention discloses allelic variation related to the WSC content of wheat stalks, a molecular marker and application. The allelic variation is an insertion / deletion type DNA fragment which is located at the 591bp position of the downstream of a 6-FEH gene transcription termination base on a wheat 2D chromosome and has the length of 156bp, and the fragment shows the difference of'existence 'and'none' in different wheat varieties, wherein the insertion / deletion type DNA fragment is located at the 591bp position of the downstream of the 6-FEH gene transcription termination base on the wheat 2D chromosome. By cloning a 6-FEH gene on a wheat 2D chromosome and a downstream sequence thereof, insertion / deletion type allelic variation with the length of 156bp in different varieties is explored, and an InDel molecular marker is developed based on the allelic variation; further, phenotypic data of a set of natural population materials in a plurality of different environments are utilized to confirm that the WSC contents of the stalks among different genotype materials distinguished by the InDel marker have significant difference, the WSC contents of the stalks of the wheat materials can be judged in an auxiliary manner by utilizing the InDel marker, and the selection efficiency of the excellent genotype of the 6-FEH gene is improved; the molecular marker-assisted selection breeding efficiency of the WSC content of the wheat stalks is accelerated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to wheat breeding, and specifically, to an allelic variation, a molecular marker related to the water-soluble carbohydrate (WSC) content in wheat stems, and their applications, and particularly to an allelic variation related to the fructan hydrolase gene 6-FEH in wheat and the development and application of a molecular marker for detecting the allelic variation. Background Art

[0002] Wheat is one of the three major staple food crops in China. Continuously increasing wheat yield is of great significance for ensuring China's food security. The filling stage is a crucial period for determining wheat yield, and the water-soluble carbohydrates (WSCs) stored in stems and leaf sheaths are important carbon sources for grain filling (Ehdaie et al., 2006), and their contribution to wheat yield can reach 10% - 50% (Foulkes et al., 2002; Rebetzke et al., 2008). In addition, stem WSC plays an important role in wheat drought resistance and heat tolerance. Increasing the stem WSC content can effectively improve drought resistance and heat tolerance, thereby improving wheat stability (Sadras et al., 2011; Xiao et al., 2012). During the evolution of wheat varieties, the stem WSC content has been significantly increased (Sadras and Lawson, 2011; Xiao et al., 2012), which has made important contributions to increasing grain weight per spike and yield, improving variety stress resistance, and increasing stability. Therefore, increasing the stem WSC content has become an important goal in wheat breeding and genetic improvement (Xue et al., 2008; Dreccer et al., 2009). Since it is difficult to measure the stem WSC content, breeders cannot efficiently select and improve it through phenotypic identification, and molecular marker-assisted selection breeding has become the key means for improving the stem WSC content.

[0003] Research shows that the accumulation of stem WSC content is the highest from heading to 10 days after flowering, remains in a stable accumulation state around 20 days after flowering, then shows metabolic attenuation, and is at a relatively low level around 30 days after flowering (Xue et al., 2008; Khoshro et al., 2014). Fructan is the main component of WSC, accounting for about 85% of the total stem WSC during the filling stage (BLACKLOW et al., 1984; XUE et al., 2008). During the filling stage, fructan metabolism is mainly catabolic metabolism, and its hydrolysis and transport are of great significance for increasing the intensity of grain filling (VEENSTRA et al., 2017). The exohydrolase genes 1-FEH and 6-FEH of fructan are key genes regulating the hydrolysis metabolism of stem fructan in the late growth stage of wheat (Zhang et al., 2020). Currently, there are reports on allelic variations of the wheat 1-FEH gene and the development of molecular markers (Fu Luping, 2020).

[0004] The WSC content in wheat straw is a complex quantitative genetic trait controlled by multiple genes. In the breeding process, it is necessary to aggregate multiple excellent genes regulating the WSC content to better achieve the breeding goal of increasing the WSC content in straw. Therefore, exploring allelic variations of different genes regulating the WSC content in straw and developing efficient and reliable molecular markers are the keys to realizing the efficient genetic improvement of the WSC content in wheat straw.

[0005] Van Riet et al. (2006) first cloned the cDNA sequence of the wheat 6-FEH gene and submitted this cDNA sequence to the EMBL nucleic acid database with the accession number AM075205. After that, there have also been research reports on the expression patterns of the wheat 6-FEH gene in different varieties or different environments (Joudi et al., 2011; Meguro-Maoka et al., 2016; Zhang et al., 2020). However, there is currently no research on the allelic variations of the wheat 6-FEH gene among different wheat varieties, lacking an understanding of the effects of different allelic variations of the 6-FEH gene on the WSC content in wheat straw, and lacking molecular markers related to the 6-FEH gene. Summary of the Invention

[0006] Aiming at the above problem of lacking molecular markers related to the 6-FEH gene and the WSC content in wheat straw, the present invention provides allelic variations, molecular markers and applications related to the WSC content in wheat straw, which are of great significance for improving the WSC content in wheat straw and further enhancing the high-yield potential and stable-yield characteristics of wheat.

[0007] To achieve the above object, on the one hand, the present invention provides an allelic variation related to the WSC content in wheat straw, which is an "insertion / deletion" type allelic variation with a sequence length of 156 bp at the position 591 bp downstream of the transcriptional termination base of the 6-FEH gene on wheat chromosome 2D. The position of this 156-bp sequence in the Chinese Spring wheat genome version V1.0 is the base sequence from the 635167196th to the 635167351st on chromosome 2D. In different wheat varieties, this 156-bp base sequence shows the difference between "present" and "absent".

[0008] On the second hand, the present invention provides a molecular marker for detecting the above allelic variation, which includes:

[0009] Two primer sequences, 6-FEH_D4F and 6-FEH_D4R; or

[0010] Two primer sequences, 6-FEH_DM1F and 6-FEH_DM1R.

[0011] The third aspect of the present invention provides a reagent or kit for detecting the above-mentioned allelic variations in wheat, which comprises the above-mentioned molecular marker.

[0012] The fourth aspect of the present invention provides the application of the above-mentioned molecular marker in any one of the following:

[0013] (1) Detecting the genotype of allelic variations in the downstream sequence of the 6-FEH gene on chromosome 2D of wheat;

[0014] (2) Assisting in identifying the high or low content of WSC in wheat stems;

[0015] (3) Assisting in breeding wheat varieties with high WSC content in stems.

[0016] The fifth aspect of the present invention provides a method for detecting the genotype of wheat varieties using the above-mentioned molecular marker. The method uses PCR amplification to obtain a PCR product. The product with an allelic genotype of Insertion contains the sequence with a length of 156 bp, the product with an allelic genotype of Deletion does not contain the sequence with a length of 156 bp, and the product composed of both the sequence with a length of 156 bp and the sequence without the length of 156 bp has a heterozygous genotype.

[0017] The sixth aspect of the present invention provides a method for assisting in identifying the high or low content of WSC in wheat stems. The method uses the above-mentioned method to detect the genotype of the wheat stem genome. The WSC content in the stems of varieties with a genotype of Deletion is significantly higher than that of varieties with a genotype of Insertion.

[0018] The seventh aspect of the present invention provides a method for assisting in breeding wheat varieties with high WSC content in stems. The method uses the above-mentioned method to detect the genotypes of wheat in each generation during the breeding process, and selects materials with a genotype of Deletion or heterozygous genotype until a wheat variety with a genotype of Deletion is bred.

[0019] Through the above technical solutions, the present invention achieves the following beneficial effects:

[0020] The present invention cloned the 6-FEH gene and its downstream sequence on wheat chromosome 2D, discovered the "insertion / deletion" type allelic variation with a length of 156 bp existing in different varieties, developed an InDel molecular marker based on this allelic variation, and further confirmed through the phenotypic data of a set of natural population materials in multiple different environments that there are significant differences in the stem WSC content among different genotype materials distinguished by this InDel marker. Using this InDel marker can assist in judging the high or low stem WSC content of wheat materials, improve the selection efficiency of excellent genotypes of the 6-FEH gene, and accelerate the molecular marker-assisted selection breeding efficiency of wheat stem WSC content, which has important significance for the genetic improvement and molecular breeding of wheat stem WSC content. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 It is the electrophoresis gel image of the gradient PCR product of primer group 6-FEH_D4 in Example 1 of the present invention;

[0022] Figure 2 It is the electrophoresis gel image of the chromosome specificity verification of primer group 6-FEH_D4 in Example 1 of the present invention;

[0023] Figure 3 It is the electrophoresis gel image of the amplification product of the target fragment of different wheat varieties using primer group 6-FEH_D4 and high-fidelity DNA polymerase in Example 1 of the present invention;

[0024] Figure 4 It is the electrophoresis gel image of the bacterial liquid PCR product of the target fragment vector cloning in different wheat varieties in Example 1 of the present invention;

[0025] Figure 5 It is the comparison diagram of the amplified sequences in different wheat varieties using primer group 6-FEH_D4;

[0026] Figure 6 It is the electrophoresis gel image of the gradient PCR product of primer group 6-FEH_DM1 in Example 2 of the present invention;

[0027] Figure 7 It is the electrophoresis gel image of the chromosome specificity verification of primer group 6-FEH_DM1 in Example 2 of the present invention;

[0028] Figure 8 It is the electrophoresis gel image of detecting some materials of the natural population with InDel marker 6-FEH_DM1 in Example 3 of the present invention;

[0029] Figure 9 It is the t-test result of 160 different genotype materials of wheat varieties in Example 3 of the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0030] The following is a detailed description of the specific implementation manners of the present invention in combination with embodiments. It should be understood that the specific implementation manners described herein are only for explaining and illustrating the present invention, and are not used to limit the present invention.

[0031] Example 1 Discovery of "insertion / deletion" allelic variations in the downstream sequence of the 6-FEH gene on wheat chromosome 2D

[0032] (1) Obtaining homologous gene sequences of the wheat 6-FEH gene

[0033] Van Riet et al. (2006) submitted the cDNA sequence of the cloned wheat 6-FEH gene to the EMBL nucleic acid database, with the sequence accession number: AM075205, and the sequence length was 1,797 base pairs (nt). This sequence was the sequence from the translation start codon to the translation stop codon corresponding to the 6-FEH gene mRNA sequence, that is, this sequence did not contain the intron region, 5' untranslated region, 3' untranslated region, and the upstream and downstream regulatory region sequences corresponding to the 6-FEH gene. Taking AM075205 as the template sequence, a BLAST nucleic acid sequence alignment search was performed on the website of the International Wheat Genome Sequencing Consortium (IWGSC) (https: / / urgi.versailles.inra.fr / blast_iwgsc / blast.php) (using the blastn program provided by the website), and the genomic data for alignment was selected as the Chinese Spring wheat genome version V1.0. According to the BLAST results, there were three sequences with a sequence identity greater than 96%, which were the base sequences at positions 777,623,928 to 777,624,829 on chromosome 2A, positions 779,253,932 to 779,254,833 on chromosome 2B, and positions 635,164,357 to 635,165,258 on chromosome 2D in the Chinese Spring genome version V1.0. The lengths of these three sequences were all 902 base pairs.

[0034] The WheatOmics website (http: / / 202.194.139.32 / ) for wheat crops provides gene annotation information of the Chinese Spring wheat reference genome. Researchers can view the gene distribution within the target chromosome segment on the Chinese Spring wheat genome and the gene structure information predicted by bioinformatics and other means through this website. Based on this, the applicant found through comparative analysis that the three similar sequences retrieved by BLAST respectively correspond to the 3rd exon sequences of the gene sequences with gene numbers TraesCS2A01G588300, TraesCS2B01G594900, and TraesCS2D01G564900 on the Chinese Spring reference genome. It can be seen therefrom that there are 3 6-FEH genes on the wheat genome, and the gene numbers are respectively: TraesCS2A01G588300, TraesCS2B01G594900, and TraesCS2D01G564900. Their physical positions are respectively: the base sequence from position 777622662 to 777627335 on chromosome 2A (the gene direction is the antisense strand direction), the base sequence from position 779251292 to 779256095 on chromosome 2B, and the base sequence from position 635161247 to 635166604 on chromosome 2D. The present invention uses the genomic sequences of these three genes and the 2000bp sequences upstream and downstream as templates to design primers to attempt to clone the 6-FEH genes in different wheat varieties, explore allelic variations of the genes, and develop molecular markers.

[0035] (II) Design of the 6-FEH_D4 primer set

[0036] Due to the long gene sequence, the present invention adopts a strategy of segmental cloning to clone the TraesCS2D01G564900 gene in different wheat varieties. Based on this strategy, a chromosome-specific primer set was designed and named 6-FEH_D4, which contains two primers, 6-FEH_D4F and 6-FEH_D4R. Among them, the base sequence of 6-FEH_D4F is: CAATATGCAGGAGCACACGGCTG (SEQ ID No.1), and the base sequence of 6-FEH_D4R is: CATGAAATCGTGTGCGATGGAGGAC (SEQ ID No.2). Using this primer set can amplify the base sequence from position 635165650 to position 635167773 on chromosome 2D in the V1.0 version of the Chinese Spring wheat genome. The total length of the sequence is 2124 bases, and this sequence contains a 955bp sequence of the latter half of the TraesCS2D01G564900 gene and a 1169bp genomic DNA sequence downstream of the gene (i.e., downstream of the transcription termination base site).

[0037] (III) Screening of the Optimal Annealing Temperature for the 6-FEH_D4 Primer Set

[0038] The PCR experiment was carried out using the primer set 6-FEH_D4 and the 2×Taq PCR Mix kit produced by Beijing Huitian Dongfang Technology Co., Ltd. to screen the optimal annealing temperature of the primers. The PCR reaction system was as follows: 5 μl of 2×Taq PCR Mix, 0.3 μl each of the forward and reverse primers (concentration: 10 μM), 1 μl of genomic DNA template (wheat variety: Lunxuan 1690), and 3.4 μl of ddH2O. The total volume of the system was 10 μl. The PCR reaction procedure was as follows: First, pre-denaturation at 94°C for 5 min; then denaturation at 94°C for 30 s, annealing at 54 - 64°C (annealing temperature gradient: 54, 56, 58, 60, 62, 64°C) for 30 s, extension at 72°C for 150 s, for a total of 40 cycles; finally, extension at 72°C for 10 min and incubation at 10°C. After the PCR amplification was completed, the PCR products were electrophoretically detected using 1.5% agarose gel. The loading amount for each well was 5 μl. The electrophoretic gel pattern is as shown in Figure 1 Figure. In the figure, well 1 is the DNA molecular weight standard DL2000, wells 2 - 7 are the PCR products of other experiments carried out by the applicant, and wells 8 - 13 are the PCR products of the above primer set at different annealing temperatures. The annealing temperatures corresponding to wells 8 - 13 are 54, 56, 58, 60, 62, and 64°C respectively. It can be seen from the figure that the optimal annealing temperature of the above primer set is 64°C.

[0039] (III) Chromosome Specificity Verification of the 6-FEH_D4 Primer Set

[0040] For the primer set 6-FEH_D4, the Chinese Spring nullisomic-tetrasomic lines were used to verify the chromosome specificity of the primers. The PCR reaction system referred to the system of the above 2×Taq PCR Mix kit, only the DNA template was replaced accordingly. The PCR program referred to the program for screening the optimal annealing temperature above, where the annealing temperature was 64°C and the extension time was 130 s, and other program parameters remained unchanged. After the PCR amplification was completed, the PCR products were electrophoretically detected using 1.5% agarose gel. The loading amount for each well was 5 μl. The electrophoretic gel pattern is as shown in Figure 2As shown, the spotting well 1 is a negative control (using ddH2O as the DNA template), the spotting wells 2-4 are the PCR products of the nullisomic-tetrasomic lines M2AT2D, N2BT2A, and N2DT2B of Chinese Spring in sequence, the spotting well 5 is the PCR product of the wheat variety Chinese Spring, and the spotting well 6 is the DNA molecular weight standard DL2000. It can be seen from the figure that the above primer set can amplify the target bands in the nullisomic-tetrasomic lines M2AT2D (lacking chromosome 2A and adding chromosome 2D) and N2BT2A (lacking chromosome 2B and adding chromosome 2A), but cannot amplify the corresponding bands in the nullisomic-tetrasomic line N2DT2B (lacking chromosome 2D and adding chromosome 2B), indicating that this primer set is specific to wheat chromosome 2D.

[0041] (4) Amplifying the target fragments of different wheat varieties using the primer set 6-FEH_D4

[0042] Since it is easy to generate mismatched bases during PCR amplification using ordinary Taq enzyme, in order to clone the accurate base sequence of the target DNA fragment, high-fidelity DNA polymerase is usually used for PCR experiments. Based on this, the applicant used the primer set 6-FEH_D4 and the TransStart FastPfu DNA polymerase kit produced by TransGen Biotech Co., Ltd. (https: / / www.transgen.com.cn / ) to perform PCR amplification on the 6-FEH gene fragments of three wheat varieties, Yangmai 16, Doumai, and Shi 4185. The PCR reaction system is as follows: 2 μl of genomic DNA template, 2.5 μl each of forward and reverse primers (concentration: 10 μM), 10 μl of 5x TransStarts FastPfu Buffer, 5 μl of dNTPs (2.5 mM), 1 μl of TransStarts FastPf DNA polymerase, 2 μl of PCR Stimulant, 25 μl of ddH2O, and the total volume of the system is 50 μl. The PCR reaction program is as follows: first, pre-denature at 94 °C for 5 min; then denature at 94 °C for 30 s, anneal at 64 °C for 30 s, extend at 72 °C for 130 s, for a total of 35 cycles; finally, extend at 72 °C for 10 min and hold at 10 °C. After the PCR amplification is completed, 10 μl of 6× Loading Buffer produced by Takara Biotechnology (Dalian) Co., Ltd. is added to each PCR tube and gently flicked to mix evenly, and then the PCR products are electrophoretically detected using 1.5% agarose gel. The loading amount for each spotting well is 20 μl, and the electrophoresis gel image is as Figure 3As shown in the figure, the sample wells 1 and 14 are the DNA molecular weight standard DL2000, the sample wells 5 - 7 are the amplification products of Yangmai 16, the sample wells 8 - 10 are the amplification products of Doumai, the sample wells 11 - 12 are the amplification products of Shi 4185, and the sample wells 2 - 4 are the samples for other experiments carried out by the applicant.

[0043] (V) Gel Recovery, Vector Cloning and Sequencing of Target DNA Fragments of Different Varieties

[0044] For the PCR amplification products of the above three varieties, namely Yangmai 16, Doumai, and Shi 4185, the Thermo Scientific GeneJET Gel Extraction Kit (product catalog number: K0692) produced by Thermo Fisher Scientific (China) Co., Ltd. was used to excise and recover the target fragments, and the specific experimental steps were in accordance with the kit instructions.

[0045] The Zero Background pTOPO-Blunt Blunt-End Cloning Kit produced by Beijing Aidlab Biotechnologies Co., Ltd. was used to clone the target fragment gel recovery products of the above four varieties. The experimental process included steps such as ligation, transformation, and transformant screening. The experimental steps referred to the kit instructions, and the specific experimental steps were as follows:

[0046] 1. Ligation

[0047] The ligation reaction system was: 2 μl of the gel recovery product, 0.5 μl of the pTOPO-Blunt vector, 0.5 μl of 10×Enhancer, 2 μl of ddH2O, and the total volume of the reaction system was 5 μl. The ligation reaction was carried out at room temperature for 5 min.

[0048] 2. Transformation

[0049] The competent cells used in the transformation experiment were Trans5α cloning competent cells produced by Beijing TransGen Biotech Co., Ltd. The specific steps of the transformation experiment were: 1) Thaw the Trans5α competent cells at room temperature and gently flick them several times to make the cells evenly suspended. 2) Transfer 50 μl of the competent cells to a 1.5 ml sterile centrifuge tube, then add 5 μl of the ligation product, gently flick and mix well, and let it stand at room temperature for 5 min to complete the transformation. 3) Add 500 μl of LB liquid medium equilibrated to room temperature to the centrifuge tube, cover the centrifuge tube lid, and then incubate it in a shaking incubator at 37°C and 200 rpm for 15 min. 4) Centrifuge the bacterial solution at 1500 g for 1 min, aspirate and discard 300 μl of the supernatant, gently flick and mix the remaining bacterial solution, and spread it on an LB solid medium plate (containing 50 μg / mL ampicillin), and invert the plate and incubate it in a 37°C incubator overnight.

[0050] 3. Transformant Screening

[0051] After colonies grew on the culture medium in the previous step, 7 monoclonal colonies were picked from each plate and placed into a 2 ml sterile centrifuge tube. Then 700 μl of LB liquid medium (containing 50 μg / mL ampicillin) was added, the centrifuge tube lid was covered, and then it was cultured with shaking in a shaking incubator at 37 °C and 200 rpm for 8 h. After the culture ended, 1 μl of the bacterial liquid was taken from each tube of bacterial liquid for bacterial liquid PCR to verify whether the ligated DNA fragment was in line with the target DNA fragment length. The bacterial liquid PCR used the aforementioned 2×Taq PCRMix kit, and the PCR reaction system was: 2×Taq PCR Mix 5 μl, M13F primer (concentration: 10 μM) 0.3 μl, M13R primer (concentration: 10 μM) 0.3 μl, bacterial liquid 1 μl, ddH2O 3.4 μl, and the total volume of the system was 10 μl. Among them, M13F and M13R are common primers for genetic experiments. The primer sequence of M13F is: TGTAAAACGACGGCCAGT, and the primer sequence of M13R is: CAGGAAACAGCTATGACC. The PCR reaction procedure was: first pre-denature at 94 °C for 10 min; then denature at 94 °C for 30 s, anneal at 55 °C for 30 s, extend at 72 °C for 150 s, for a total of 30 cycles; finally extend at 72 °C for 5 min and keep it at 10 °C. After the PCR amplification ended, the PCR products were electrophoretically detected using 1.5% agarose gel, and the loading amount for each sample well was 5 μl. The electrophoretic gel image is as Figure 4 shown. The sample wells 1 and 26 are DNA molecular weight standard DL2000 (possibly due to unsatisfactory gel preparation, the band in sample well 1 failed to be normally visualized). The bacterial liquid PCR products of Yangmai 16, Doumai, and Shi 4185 are in sample wells 2 - 8, 9 - 15, and 16 - 22 respectively. The sample wells 23 - 25 are samples for other experiments carried out by the applicant. The sequenced bacterial liquids of Yangmai 16, Doumai, and Shi 4185 are the bacterial liquids corresponding to sample wells 6 - 8, 9 - 11, and 18 - 19.

[0052] 4. Sequencing of the target fragment

[0053] The bacterial liquid of the above positive clones was sent to Beijing Liuhe Huada Gene Technology Co., Ltd. for sequencing, and the sequencing was carried out bidirectionally using M13F and M13R primers. According to the sequencing results feedback by the company, the DNA sequences of the cloned fragments of Yangmai 16 and Doumai are exactly the same, which is Sequence 3 (SEQ ID No.3), with a length of 2124 bases, and is exactly the same as the base sequence from position 635165650 to position 635167773 on chromosome 2D in the Chinese Spring wheat genome version V1.0. The DNA sequence of the cloned fragment of Shi 4185 is Sequence 4 (SEQ ID No.4), with a length of 1968 bases. Sequence 3 and Sequence 4 were subjected to sequence alignment ( Figure 5) The results showed that Sequence 4 lacked a DNA fragment with a length of 156 bases compared to Sequence 3. This DNA fragment with a length of 156 bases corresponded to the base sequence from the 635167196th to the 635167351st on Chromosome 2D in the Chinese Spring Wheat Genome Version V1.0, and the distance between it and the transcriptional termination base of the 6-FEH gene was 591 bases.

[0054] SEQ ID No.3:

[0055]

[0056] SEQ ID No.4:

[0057]

[0058] Based on the above experimental results, through the cloning of the 6-FEH gene fragment and the downstream sequence on chromosome 2D in three varieties, namely Yangmai 16, Doumai, and Shi 4185, an "insertion / deletion" type allelic variation with a length of 156 base pairs was found downstream of the 6-FEH gene. The distance between this insertion / deletion variation and the base at the transcription termination point of the 6-FEH gene is 591 base pairs. In the present invention, the allelic genotype containing the above-mentioned 156-bp fragment in Yangmai 16 and Doumai is called the "Insertion" genotype, the allelic genotype without the above-mentioned 156-bp fragment in Shi 4185 is called the "Deletion" genotype, and the genotype with both the above-mentioned 156-bp fragment and without the above-mentioned 156-bp fragment is called the heterozygous genotype.

[0059] Example 2 Development of InDel molecular markers related to the 6-FEH gene on wheat chromosome 2D

[0060] Since the product fragment amplified by using the primer set 6-FEH_D4 is relatively long, and the PCR products amplified in different wheat varieties need to be electrophoresed for a long time to better distinguish fragments of different lengths, the efficiency of detecting InDel variation using the primer set 6-FEH_D4 is relatively low. Based on this, the applicant designed a new primer set and named it 6-FEH_DM1, which contains two primers, 6-FEH_DM1F and 6-FEH_DM1R. Among them, the sequence of 6-FEH_DM1F is: TGTCGGCAGGAATGTTCAC (SEQ ID No.5), and the sequence of 6-FEH_DM1R is: ATGTTTATTTGTCAACCTCACA (SEQ ID No.6). Using the primer set 6-FEH_DM1 can amplify the DNA sequence containing the above-mentioned InDel allelic variation region, and fragments with lengths of 417 bp, 261 bp, and both 417 bp and 216 bp can be amplified in different varieties, corresponding to the "Insertion" genotype, "Deletion" genotype, and heterozygous genotype, respectively.

[0061] The above primer set and the 2×Taq PCR Mix kit produced by Beijing Huitian Dongfang Technology Co., Ltd. were used for PCR experiments to screen the optimal annealing temperature of the primers. The PCR reaction system was as follows: 5 μl of 2×Taq PCR Mix, 0.3 μl each of the forward and reverse primers (concentration: 10 μM), 1 μl of genomic DNA template (Doumai, Shi 4185), 3.4 μl of ddH2O, and the total volume of the system was 10 μl. The PCR reaction procedure was as follows: First, pre-denature at 94°C for 5 min; then denature at 94°C for 30 s, anneal at 50 - 60°C (annealing temperature gradient: 50, 52, 54, 56, 58, 60°C) for 30 s, extend at 72°C for 60 s, for a total of 30 cycles; finally, extend at 72°C for 5 min and hold at 10°C. After the PCR amplification was completed, the PCR products were electrophoretically detected using 1.5% agarose gel, and the loading amount for each well was 5 μl. The electrophoresis gel image was as shown in Figure 6 shown. In the figure, well 1 was the DNA molecular weight standard DL2000, wells 2, 4, 6, 8, 10, 12 were the PCR products of Doumai, wells 3, 5, 7, 9, 11, 13 were the PCR products of Shi 4185, and the annealing temperatures corresponding to wells 2 - 3, 4 - 5, 6 - 7, 8 - 9, 10 - 11, 12 - 13 were 50, 52, 54, 56, 58, 60°C respectively. It can be seen from the figure that the optimal annealing temperature of the primer set 6-FEH_DM1 was 52 - 54°C. At the same time, it can be seen from the figure that the primer set 6-FEH_DM1 had a good effect in detecting the 156-bp InDel variation downstream of the 6-FEH gene in different wheat varieties.

[0062] For the primer set 6-FEH_DM1, the chromosome specificity of the primer was verified using the Chinese Spring nullisomic-tetrasomic materials. The PCR reaction system referred to the system of the aforementioned 2×Taq PCR Mix kit, and only the DNA template was replaced accordingly. The PCR procedure referred to the PCR procedure for screening the optimal annealing temperature of the 6-FEH_DM1 primer set, and only the annealing temperature was set at 53°C, with other program parameters remaining unchanged. After the PCR amplification was completed, the PCR products were electrophoretically detected using 1.5% agarose gel, and the loading amount for each well was 5 μl. The electrophoresis gel image was as shown in Figure 7As shown in the figure. In the figure, the sample wells 1 and 7 are DNA molecular weight standard DL2000, and the sample wells 2-4 are the PCR products of Chinese Spring nullisomic-tetrasomic lines M2AT2D, N2BT2A, and N2DT2B in sequence. The sample well 5 is the PCR product of wheat variety Chinese Spring, and the sample well 6 is the negative control (using ddH2O instead of DNA template). It can be seen from the figure that the above primer set can amplify the target bands in the nullisomic-tetrasomic lines M2AT2D and N2BT2A, but cannot amplify the corresponding bands in the nullisomic-tetrasomic line N2DT2B, indicating that the primer set is specific to wheat chromosome 2D.

[0063] Example 3 Application of Using InDel Marker 6-FEH_DM1 to Assist in Identifying the High and Low Contents of Wheat Stem WSC in Breeding

[0064] 1. Test Materials and Determination of Stem WSC Content

[0065] Fu et al. (2020) measured the stem WSC content of 166 wheat materials in the Huanghuai wheat region at different post-flowering stages under different environments. Their article was published in the journal Theoretical and Applied Genetics in 2020, and the article title is: Genome-wide association analysis of stem water-soluble carbohydrate content in bread wheat. The present invention uses the phenotypic data of the stem WSC content of 166 wheat materials at 10 days after flowering in this article to verify the application value of the InDel marker in assisting the molecular breeding related to identifying the high and low contents of wheat stem WSC. The above 166 wheat materials and their phenotypic data are listed in Table 1, and the specific methods for field experiments and phenotypic determination of the materials are as follows: The 166 wheat materials were planted in Dezhou, Shandong and Gaoyi, Hebei in 2016-2017, and in Luohe, Henan and Xinxiang, Henan in 2017-2018. The four environments are correspondingly recorded as 2017 Dezhou, 2017 Gaoyi, 2018 Luohe, and 2018 Xinxiang. The field experiments under each environment were all designed by a completely randomized block design, with 3 replicates, double-row plots, row length of 2m, row spacing of 20cm, and about 50 plants per row. Field management was carried out according to the local wheat production field management specifications. Record the flowering period of each plot. At 10 days after flowering, randomly cut 20 main stems from each plot, remove the leaves and ears, keep the stems, blanch at 105°C for 30 min, and then dry at 80°C. Refer to the method constructed by Wang et al. (2014) to determine the stem WSC content by near-infrared spectroscopy. Each sample was subjected to 3 technical replicates, and the average value was taken for statistical analysis.

[0066] 2. Detection of the genotypes of 166 wheat materials using the primer set of InDel marker 6-FEH_DM1

[0067] The genotypes of 166 wheat materials were detected using the InDel marker 6-FEH_DM1 of the present invention and its detection method. The electrophoresis gel images of the detection results of some wheat materials are as follows Figure 8 shown. In the figure, lane 1 is the DNA molecular weight standard DL2000. The genotypes of lanes 3, 5, 6, 8, and 9 are Insertion genotypes. The genotypes of lanes 4, 7, and 10 are Deletion genotypes. The genotype of lane 11 is a heterozygous genotype. It may be that the DNA template concentration in lane 2 was too low to amplify the target band. The genotype results of 166 wheat materials detected using the 6-FEH_DM1 marker are listed in Table 1. According to the genotype statistical results, among the 166 wheat materials, 32 wheat materials have the Deletion genotype, 130 wheat materials have the Insertion genotype, and the remaining 4 wheat materials are of heterozygous genotype. Since the number of heterozygous genotype materials is small and does not meet the requirements of statistical analysis, and at the same time, 2 wheat materials lack the phenotypic data of the WSC content in the stem at 10 days after anthesis, finally, 160 homozygous genotype (i.e., Insertion and Deletion genotypes) materials were used to verify the application value of the InDel marker 6-FEH_DM1

[0068] The t-test was performed on the WSC content in the stem at 10 days after anthesis of different genotype materials of 160 wheat materials using the PROC TTEST model in the SAS 9.2 statistical software. The results are as follows Figure 9 shown. Under the three environments of 2017 Dezhou, 2017 Gaoyi, and 2018 Xinxiang, and when analyzing using the BLUE (Best Linear Unbiased Estimation) value, the WSC content in the stem of the varieties with the Deletion genotype at 10 days after anthesis was significantly (P<0.05) higher than that of the varieties with the Insertion genotype. These results indicate that the primer set and genotype detection system of the InDel marker 6-FEH_DM1 can be used for molecular-assisted selection breeding aiming to increase the WSC content in wheat stems

[0069] Table 1 Genotype data of the 6-FEH_DM1 marker for 166 wheat materials and phenotypic data of the WSC content in the stem at 10 days after anthesis under different environments

[0070]

[0071]

[0072]

[0073]

[0074]

[0075] Note: The phenotypic data in the table are cited from the article: Genome-wide association analysis of stem water-soluble carbohydrate content in bread wheat. (Theoretical and Applied Genetics, 2020, 133: 2897-2914)

[0076] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0077] In addition, it should be noted that, among the various specific technical features described in the above specific embodiments, without conflict, they can be combined in any appropriate way. To avoid unnecessary repetition, the present invention will not separately describe various possible combination methods.

[0078] In addition, any combination can be made between various different embodiments of the present invention, as long as it does not violate the idea of the present invention, it should also be regarded as the content disclosed by the present invention.

Claims

1. An allelic variation related to the WSC content of wheat stalks, characterized in that, This allelic variation is an "insertion / deletion" type allelic variation with a sequence length of 156 bp at a position 591 bp downstream of the transcription termination base of the 6-FEH gene on chromosome 2D of wheat. The position of this 156-bp sequence in the Chinese Spring wheat genome version V1.0 is the base sequence from the 635167196th to the 635167351st on chromosome 2D. This 156-bp base sequence shows a difference of "present" and "absent" in different wheat varieties.

2. A molecular marker for detecting the allelic variation according to claim 1, characterized in that, Comprising: Two primer sequences, 6-FEH_D4F and 6-FEH_D4R; or Two primer sequences, 6-FEH_DM1F and 6-FEH_DM1R.

3. A reagent or kit for detecting the allelic variation according to claim 1 in wheat, characterized in that, Comprising the molecular marker described in claim 2.

4. Use of the molecular marker described in claim 2 in any of the following: (1) Detecting the genotype of allelic variation in the downstream sequence of the 6-FEH gene on chromosome 2D of wheat; (2) Assisting in identifying the high or low content of WSC in wheat stems; (3) Assisting in breeding wheat varieties with high WSC content in stems.

5. The method for detecting the genotype of wheat varieties using the molecular marker according to claim 2, characterized in that, The PCR product is amplified by the PCR amplification method. The allelic genotype of the product containing the 156-bp sequence is the Insertion genotype, the allelic genotype of the product without the 156-bp sequence is the Deletion genotype, and the genotype of the product composed of both the 156-bp sequence and the sequence without the 156-bp sequence is the heterozygous genotype.

6. A method for assisting in identifying the high or low content of WSC in wheat stalks, characterized in that, Using the method described in claim 5 to detect the genotype of the wheat stem genome, the WSC content in the stems of varieties with the Deletion genotype is significantly higher than that of varieties with the Insertion genotype.

7. A method for assisting in breeding wheat varieties with high WSC content in the stem, characterized in that, Using the method described in claim 5 to detect the genotype of wheat in each generation during the breeding process, and selecting materials with the Deletion or heterozygous genotype until a wheat variety with the Deletion genotype is bred.