RPA primer for detecting African swine fever virus, CRISPR / Cas12 system target spot, kit and application
By combining the CRISPR/Cas12 system targets and RPA primers, a "one-tube method" is developed to quickly detect ASFV, which solves the problems of equipment dependence and operation in the existing technology, and achieves fast, simple and highly sensitive ASFV detection, which is suitable for on-site applications in pig farms.
Patent Information
- Application Number
- CN202510454947.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-11
- Publication Date
- 2025-07-08
AI Technical Summary
The existing ASFV detection methods rely on complex laboratory equipment and professional and technical personnel, and are difficult to meet the rapid, simple and high-sensitivity detection needs of pig farms, and there is a risk of aerosol contamination.
Design the target of the CRISPR/Cas12 system to bind RPA primers, develop a "one-tube method" method to quickly detect ASFV, and achieve free extraction of nucleic acids in the sample through a nucleic acid rapid release agent, and use the CRISPR/Cas12 system to perform fluorescence detection or lateral flow chromatography test strip detection.
It realizes fast, simple and accurate ASFV nucleic acid detection within 10-30 minutes at a constant temperature of 37℃. The results can be observed by flashlight irradiation or lateral flow chromatography test strips. It does not rely on professional equipment, and the test results are highly consistent with qPCR, which is suitable for on-site use in pig farms.
Smart Images

Figure CN120272649A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of African swine fever virus detection, and particularly relates to RPA primers for detecting African swine fever virus, CRISPR / Cas12 system targets, kits and applications. Background Art
[0002] African swine fever (ASF) is an acute, febrile, highly virulent swine infectious disease caused by African swine fever virus (ASFV). Its clinical manifestations are high fever and bleeding. It can infect domestic pigs and wild boars of different breeds and ages, with a fatality rate as high as 95-100%. The virus can be transmitted through soft ticks of birds or through direct contact with infected pigs. Since its introduction into China in 2018, the widespread spread of ASF has dealt a fatal blow to the pig farming industry in China. ASFV has a double-stranded DNA molecule of 170-190 kb, containing 150-167 open reading frames and encoding nearly 200 proteins. ASFV is an enveloped virus, and the virus particle consists of five parts: outer capsid, capsid, inner capsid, nucleocapsid and core. The structure of ASFV is complex, and researchers have not fully understood the structures and functions of many of its proteins. So far, no reliable commercial vaccine has been developed globally, nor is there an effective treatment method for treating infected pigs. Currently, relying on strict biosafety prevention measures, virus transmission is blocked by rapid and accurate virus detection and comprehensive culling of diseased pigs. Therefore, early detection of the virus in the environment, equipment and infected pigs is crucial for blocking virus transmission.
[0003] ASF monitoring mainly relies on antibody and pathogen nucleic acid detection. In terms of antibody detection, in pigs infected with ASFV, immunoglobulin IgM and IgG can be detected 4 days and 6 - 8 days after infection respectively. IgM is produced earlier but in smaller quantities, while it takes about a week for IgG to be produced. This window period is fatal and unacceptable for early prevention and control of virus transmission because by the time antibodies can be detected, the virus has been infecting, replicating, and proliferating for at least a week and has already been discharged into the environment. Therefore, to detect the virus early, pathogen detection should be carried out on the environment or suspected infected pigs in a timely manner, such as sampling and testing daily or every half day. Commonly used ASFV detection methods include polymerase chain reaction (PCR), real-time quantitative PCR (RT-qPCR), hemadsorption test (HAT), and viral antigen. Among them, PCR shows LODs of 40 or 60 DNA copies per microliter respectively; RT-qPCR is 18 DNA copies. The sensitivity of HAT is significantly lower than the other two methods; however, HAT is the reference standard for WOAH to diagnose ASF. The above detection methods rely on a variety of laboratory instruments and equipment, with complex operation steps and requiring trained professional technicians, which greatly limits their application in the pig farm field and is difficult to meet the requirements of rapid virus detection.
[0004] In recent years, newly developed methods for detecting ASFV based on isothermal amplification such as LAMP, RPA, RAA, and CRISPR / Cas systems, although shortening the detection time and reducing the requirements for detection equipment, still require cumbersome pretreatment processes such as sample lysis, purification, and enrichment. The experimental operation still relies on professional technicians, and due to their dependence on isothermal amplification, there is a risk of aerosol contamination of the environment by the amplified products. Therefore, it is crucial to develop a simple detection method that does not rely on dedicated instruments, is easy to operate, has high sensitivity, is suitable for on-site use in farms, and can quickly screen out pathogens. Summary of the Invention
[0005] In view of this, the purpose of the present invention is to overcome the deficiencies of the above-mentioned existing technologies. By using a nucleic acid rapid release agent to achieve the purpose of nucleic acid extraction-free in samples, designing a CRISPR / Cas sub-optimal system and screening target sequences, and combining the RPA technology with the CRISPR / Cas sub-optimal system, a new "one-tube" method for rapid detection of African swine fever virus nucleic acid is developed.
[0006] To achieve the above purpose, the technical solution of the present invention is as follows:
[0007] The first aspect of the present invention is an RPA primer and a CRISPR / Cas12 system target for detecting African swine fever virus. The RPA primer is a primer pair composed of RPA F4 and RPA R1. Among them, the nucleotide sequence of RPA F4 is as shown in SEQ ID No.5, and the nucleotide sequence of RPA R1 is as shown in SEQ ID No.7; the CRISPR / Cas12 system target is crRNA4, and its nucleotide sequence is as shown in SEQ ID No.13.
[0008] The second aspect of the present invention is an African swine fever virus nucleic acid CRISPR-Cas12 detection kit, which includes the RPA primer and the CRISPR / Cas12 system target described in the first aspect.
[0009] The third aspect of the present invention is the application of the RPA primer and the CRISPR / Cas12 system target described in the first aspect in the preparation of a kit for detecting African swine fever virus nucleic acid.
[0010] The fourth aspect of the present invention is a method for detecting African swine fever virus, which includes the following steps:
[0011] (1) Extract the nucleic acid of the sample to be tested as the RPA amplification template;
[0012] (2) Prepare a CRISPR / Cas12 detection system for "one-tube" fluorescence detection or "one-tube" lateral flow chromatographic strip detection to determine whether the sample to be tested contains African swine fever virus;
[0013] Among them, the CRISPR / Cas12 detection system used for "one-tube" fluorescence detection contains the following components: the RPA primer and the CRISPR / Cas12 system target described in the first aspect, ssDNA probe and B Buffer; the CRISPR / Cas12 detection system used for "one-tube" lateral flow chromatographic strip detection contains the following components: the RPA primer and the CRISPR / Cas12 system target described in the first aspect, ssDNA probe, B Buffer and enzyme-free water.
[0014] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0015] (1) The present invention designs RPA primers and sub-optimal CRISPR / Cas system target sequences for rapid detection of ASFV nucleic acid, and can quickly, simply and accurately carry out rapid nucleic acid detection of ASFV samples.
[0016] (2) The present invention has established a new method for nucleic acid detection of ASFV by a rapid and simple "one-tube method". For this method, only incubation at a constant temperature of 37 °C for 10 - 30 minutes (depending on the viral load of the sample to be tested) is required. The result can be directly observed with the naked eye by irradiating with a flashlight with a light source of 480 - 520 nM or using a lateral flow chromatographic test strip. It does not rely on professional laboratories and instrument equipment. The test result has good consistency with the result of qPCR, and is expected to meet the market demands of different application scenarios, and solve the limitations and disadvantages of the application scenarios of traditional nucleic acid detection of ASFV.
[0017] (3) The technology of using the "one-tube method" for nucleic acid detection of ASFV in the present invention provides a more accurate and efficient virus detection strategy, points out the direction for the research and development of other virus detection technologies, and promotes the research and development of virology. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 Schematic diagram of the African swine fever detection process.
[0019] Figure 2 Schematic diagram of the design of RPA primers and target sequences.
[0020] Figure 3 Diagram of the screening results of RPA primers and target sequences.
[0021] Figure 4 Diagram of the sensitivity results of detecting ASFV by the "one-tube method".
[0022] Figure 5 Diagram of the specificity results of detecting ASFV by the "one-tube method".
[0023] Figure 6 Diagram of the evaluation of detecting ASFV clinical samples by the "one-tube method". DETAILED DESCRIPTION OF THE INVENTION
[0024] To facilitate the understanding of the present invention, the present invention will be described more comprehensively below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, these embodiments are provided to make the understanding of the disclosure of the present invention more thorough and comprehensive.
[0025] Unless otherwise defined, all professional terms used hereinafter have the same meaning as commonly understood by those skilled in the art. The professional terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the protection scope of the present invention.
[0026] Unless otherwise specifically stated, various raw materials, reagents, instruments, and equipment used in the present invention can be obtained through market purchases or can be prepared by existing methods.
[0027] Design of Sub-optimal CRISPR / Cas12 System Target Sequences for ASFV in Example 1
[0028] Sequence analysis of the ASFV strain (GenBank: MZ054172.1 (1492 - 1895bp), P72 gene) was performed using the Blast tool in the NCBI website database (www.ncbi.nlm.nih.gov). According to the results of sequence alignment, a 404bp gene fragment was selected to construct the P72 gene plasmid of ASFV (shown as SEQ ID No.1, synthesized by Shanghai Bioengineering Co., Ltd.), and RPA primers (shown as SEQ ID No.2 - 9) and sub-optimal CRISPR / Cas12 system target sequences (shown as SEQ ID No.10 - 13) were designed.
[0029] The detection process of this example is as Figure 1 shown. Among them, the RPA primers were designed using the Primer tool on the NCBI website, as Figure 2 shown. A total of 15 pairs of RPA primers (combinations of F - upstream primers and R - downstream primers in pairs) and 4 sub-optimal CRISPR / Cas12 system target sequences were designed in this example.
[0030] Example 2 Screening of RPA Primers and Sub-optimal CRISPR / Cas12 System Targets
[0031] First, using the P72 gene plasmid as the amplification template, the template was serially diluted to 1×10 3 copies / μL for the DNA isothermal amplification kit (purchased from Anpu Future Biotechnology Co., Ltd., product number: WLB8201KIT). The amplification system is as follows: 29.4μL A Buffer, 2μL each of the upstream and downstream primers (10μM), 5μL template, 9.1μL nuclease-free water. Finally, add 2.5μL B Buffer into the tube, cover the lid and invert it up and down 6 - 8 times. Spin (quickly centrifuge) the solution in the reaction tube to the bottom of the tube and incubate at 37°C for 30 minutes.
[0032] Use the above amplification products for agarose gel electrophoresis. First, take 5μL of the amplification products, then add 1μL of 6×Loading buffer and pipette to mix well. Finally, perform agarose gel electrophoresis (the concentration of the agarose gel is 1.5%) (electrophoresis at a voltage of 150V for 35 minutes), and observe the electrophoresis results and take pictures in the gel imager. The results are as Figure 3As shown in A, bright target bands were amplified by the primer sets of F3&R1, F4&R1, F4&R2, and F3&R3, and the lengths of the target bands were 184 bp, 170 bp, 185 bp, and 208 bp, respectively. Considering the timeliness of subsequent rapid detection of ASFV by the "one-tube method", finally, we selected the F4&R1 primer set with the shortest amplified fragment for subsequent experimental applications. Using the above-selected F4&R1 primer set, the sub-optimal CRISPR / Cas12 system target sequences were screened. When the template concentration was 1×10 3 copies / μL, a "one-tube method" real-time fluorescence detection system was carried out: 2 μL of ssDNA probe (2 - 6 μM), RNP (crRNA&Cas12a, 25 - 100 nM), 6 μL of template, 18 μL of RPA premix, 2 μL of B Buffer, and the fluorescence value was collected once every 1 minute for a total of 30 cycles at 37°C. The results showed that obvious fluorescence signal values could be detected by crRNA1, crRNA2, crRNA3, and crRNA4 ( Figure 3 B and 3C), among which the fluorescence values of crRNA3 and crRNA4 were the highest, but it was impossible to distinguish which crRNA had a better detection effect. Further, when the concentration was 1×10 0 copies / μL, no obvious fluorescence signal value was detected by crRNA1, lower fluorescence signal values were detected by crRNA2 and crRNA3, and the fluorescence signal value of crRNA4 was the highest ( Figure 3 D and 3E). Finally, the optimal RPA primers were the F4&R1 primer set (as shown in SEQ ID No.5 & SEQ ID No.7), and the target sequence was crRNA4 (as shown in SEQ ID No.13).
[0033] Example 3 Sensitivity of detecting ASFV by the "one-tube method"
[0034] First, the high-concentration P72 gene plasmid was serially diluted to 1×10 5 , 1×10 4 , 1×10 3 , 1×10 2 , 1×10 1 , 1×10 0 and 1×10 -1copies / μL, with the negative control being NC (nuclease-free water); qPCR, "one-tube" fluorescence, and lateral flow chromatographic test strip readings were performed respectively, and finally the sensitivities of the three methods for detecting ASFV were compared. Among them, (1) The qPCR kit was 2X M5 HiPer Realtime PCR Super mix with Low Rox (purchased from Beijing Polymer Beauty Biotechnology Co., Ltd.). The reaction system was: 2X M5 HiPer Realtime PCR Super mix with Low Rox 10 μL, 0.5 μL each of the upstream and downstream primers (10 μM), 5 μL of the template, and nuclease-free water was added to make up to 20 μL; qPCR conditions: 95 °C, 60 seconds, 1 cycle; 95 °C, 15 seconds, 65 °C, 30 seconds, 40 cycles. (2) "One-tube" fluorescence reaction system: 2 μL (2 - 6 μM) of ssDNA probe (FAM-TTATTATTATT-BHQ), RNP (crRNA4&Cas12a, 25 - 100 nM), 6 μL of the template, 18 μL of RPAF4&R1 premix, 2 μL of B Buffer, incubated at 37 °C for 30 minutes, and the results were observed by irradiating with a 488 nM flashlight (positive shows green fluorescence, negative shows no green fluorescence). (3) "One-tube" lateral flow test strip (purchased from Tulu Biotechnology) reaction system: 1 μL (10 μM) of ssDNA probe (FAM-TTATTATTATT-Biotin), RNP (crRNA4&Cas12a, 25 - 100 nM), 6 μL of the template, 18 μL of RPAF4&R1 premix, 2 μL of B Buffer, nuclease-free water was added to make up to 30 μL, incubated at 37 °C for 30 minutes, and the lateral flow chromatographic test strip was inserted to read the results (positive shows both "T" and "C" lines, negative shows only the "C" line and no "T" line).
[0035] The detection results of the three methods are as Figure 4 shown. The sensitivity of the qPCR method was 1×10 -1 copies / μL( Figure 4 A); The sensitivity of "one-tube" fluorescence reading was 1×10 -1 copies / μL( Figure 4 B and 4C), which was consistent with the qPCR method; The sensitivity of the "one-tube" lateral flow test strip reading was 1×10 0 copies / μL( Figure 4 D), slightly lower than the qPCR method and the "one-tube" fluorescence reading results.
[0036] Example 4 Specificity of the "One-Tube" Method for Detecting ASFV
[0037] Using the nucleic acids of African swine fever virus (ASFV), porcine reproductive and respiratory syndrome virus (PRRSV), porcine parvovirus (PPV), Japanese encephalitis virus (JEV), porcine circovirus (PCV) and pseudorabies virus (PRV) as amplification templates, the "one-tube method" fluorescence and lateral flow chromatographic strip assays were respectively performed to verify the specificity of this method.
[0038] The results are as Figure 4 shown. Both the "one-tube method" fluorescence and lateral flow chromatographic strip assays were able to accurately read the positive results of ASFV, and there was no obvious cross-reaction with the nucleic acids of the other 5 pig-infecting pathogens ( Figure 5 A and 5B), indicating that the "one-tube method" fluorescence and lateral flow chromatographic strips have good specificity.
[0039] Example 5 Evaluation of the "one-tube method" for detecting ASFV clinical samples
[0040] To verify the effect of the "one-tube method" in detecting ASFV real samples, 20 samples infected with African swine fever virus (including 9 plasma samples, 4 whole blood samples and 7 nasal swab samples) were collected in this example for application evaluation. First, the 20 samples were incubated at 40 °C for 5 minutes using a rapid nucleic acid release agent (purchased from Amp Future (Changzhou) Biotechnology Co., Ltd.); then, the 20 samples were simultaneously detected using qPCR method, "one-tube method" fluorescence and lateral flow chromatographic strip assays (the specific method is shown in Example 3). The results are as Figure 6 shown in A and 6B, where PC is the positive control group, NC is the negative control group not infected with ASFV. The positive detection rates of the qPCR method and the "one-tube method" fluorescence method were 100% (20 / 20), and the positive detection rate of the "one-tube method" lateral flow chromatographic strip assay was 90% (18 / 20) ( Figure 6 C). The reason for the 2 false negatives may be that the components of the whole blood samples after treatment with the nucleic acid release agent are relatively complex, and individual components interfere with the detection results of the lateral flow chromatographic strip for reading low virus load samples.
[0041] The above are only examples for better explaining the present invention, and are not intended to limit it. Any modification or equivalent replacement without departing from the spirit and scope of the present invention shall fall within the scope covered by the present invention.
[0042] SEQ ID No.1:
[0043] ATGCAGCCCACTCACCACGCAGAGATAAGCTTTCAGGATAGAGATACAGCTCTTCCAGACGCATGTTCATCTATATCTGATATTAGCCCCGTTACGTATCCGATCACATTACCTATTATTAAAAACATTTCCGTAACTGCTCATGGTATCAATCTTATCGATAAATTTCCATCAAAGTTCTGCAGCTCTTACATACCCTTCCACTACGGAGGCAATGCGATTAAAACCCCCGATGATCCGGGTGCGATGATGATTACCTTTGCTTTGAAGCCACGGGAGGAATACCAACCCAGTGGTCATATTAACGTATCCAGAGCAAGAGAATTTTATATTAGTTGGGACACGGATTACGTGGGGTCTATCACTACGGCTGATCTTGTGGTATCGGCATCTGCTATTAACTT(404bp)
[0044] SEQ ID No.2:
[0045] RPA-F1:CAGCTCTTCCAGACGCATGTTCATCTATATCTG
[0046] SEQ ID No.3:
[0047] RPA-F2:TCCAGACGCATGTTCATCTATATCTGATATTA
[0048] SEQ ID No.4:
[0049] RPA-F3:CTGATATTAGCCCCGTTACGTATCCGATCAC
[0050] SEQ ID No.5:
[0051] RPA-F4:CGTTACGTATCCGATCACATTACCTATTAT
[0052] SEQ ID No.6:
[0053] RPA-F5:CGTAACTGCTCATGGTATCAATCTTATCGA
[0054] SEQ ID No.7:
[0055] RPA-R1: AAGGTAATCATCATCGCACCCGGATCATCG
[0056] SEQ ID No.8:
[0057] RPA-R2: GTGGCTTCAAAGCAAAGGTAATCATCATCG
[0058] SEQ ID No.9:
[0059] RPA-R3: ACCACTGGGTTGGTATTCCTCCCGTGGCTTC
[0060] SEQ ID No.10:
[0061] TGCAGCTCTTACATACCCTT
[0062] SEQ ID No.11:
[0063] CATACCCTTCCACTACGGAG
[0064] SEQ ID No.12:
[0065] CACTACGGAGGCAATGCGAT
[0066] SEQ ID No.13:
[0067] CAGCTCTTACATACCCTTCC。
Claims
1. An RPA primer for detecting African swine fever virus and a CRISPR / Cas12 system target, characterized in that, The RPA primer is a primer pair composed of RPA F4 and RPA R1. Among them, the nucleotide sequence of RPA F4 is shown in SEQ ID No. 5, and the nucleotide sequence of RPA R1 is shown in SEQ ID No. 7; the target of the CRISPR / Cas12 system is crRNA4, and its nucleotide sequence is shown in SEQ ID No.
13.
2. A CRISPR-Cas12 detection kit for African swine fever virus nucleic acid, characterized in that, It includes the RPA primer and the CRISPR / Cas12 system target described in claim 1.
3. Use of the RPA primer and the CRISPR / Cas12 system target described in claim 1 in the preparation of a kit for detecting African swine fever virus nucleic acid.
4. A method for detecting African swine fever virus, characterized in that, It includes the following steps: (1) Extract the nucleic acid of the sample to be tested as the RPA amplification template; (2) Prepare a CRISPR / Cas12 detection system for "one-tube" fluorescence detection or "one-tube" lateral flow chromatography strip detection to determine whether the sample to be tested contains African swine fever virus; Among them, the CRISPR / Cas12 detection system used for "one-tube" fluorescence detection contains the following components: the RPA primer and the CRISPR / Cas12 system target described in claim 1, ssDNA probe and B Buffer; the CRISPR / Cas12 detection system used for "one-tube" lateral flow chromatography strip detection contains the following components: the RPA primer and the CRISPR / Cas12 system target described in claim 1, ssDNA probe, B Buffer and enzyme-free water.
Citation Information
Cited By
RPA-CRISPR / Cas12a-based AngHV visual detection kit and detection method
CN121294741A