Primer probe combination for detecting and / or distinguishing Newcastle disease virus and application thereof

Abstract

The invention provides a primer probe combination for detecting and / or distinguishing Newcastle disease virus and application thereof, in the primer probe combination, primers comprise an upstream primer NDV-M-F with a nucleotide sequence shown as SEQ ID NO.1 and a downstream primer NDV-M-R with a nucleotide sequence shown as SEQ ID NO.2; the nucleotide sequence of the probe is as shown in SEQ ID NO. 7. The primer and the probe in the combination are used for detecting NDV by adopting a cdPCR technology, the combination has the advantages of being good in linearity, high in sensitivity, strong in specificity, good in repeatability and the like, and the detection limit of the NDV-M gene in a sample is as low as 2.67 copie / mu L; the variable coefficients of intra-batch and inter-batch repeated tests are both less than 4%, and the kit is suitable for early accurate detection of NDV (Newcastle Disease Virus).

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and particularly relates to a primer-probe combination for detecting and / or differentiating Newcastle disease virus and its application. Background Art

[0002] Newcastle disease (ND) is an acute and highly contagious disease caused by Newcastle disease virus (NDV) infecting various poultry. It is listed as a notifiable animal disease by the World Organization for Animal Health and as a Class II animal disease by the Ministry of Agriculture and Rural Affairs of China. Infection with NDV can affect multiple systems of animals, including the respiratory system, gastrointestinal system, nervous system, and reproductive system, and may ultimately lead to a mortality rate of up to 100%. Although the widespread use of vaccines has reduced the incidence of typical ND year by year, atypical ND still occurs from time to time. So far, there have been four large-scale outbreaks of Newcastle disease globally. Therefore, strengthening the detection of NDV in poultry and taking corresponding measures in a timely manner for positive groups is an important means for farmers to reduce the huge economic losses caused by NDV infection.

[0003] NDV belongs to the order Mononegavirales, family Paramyxoviridae, subfamily Paramyxovirinae, genus Aviparamyxovirus, and species Avian paramyxovirus type 1 of the genus Aviparamyxovirus Avian Paramyxovirus type 1,APMV-1 ), and is an enveloped single-stranded negative-sense RNA virus. The HN protein of NDV can bind to sialic acid receptors on the surface of red blood cells, so NDV can agglutinate red blood cells. The agglutination property of the virus is a powerful tool for diagnosing the disease. However, when the virus content is low, this method is prone to missed detection, and how to detect NDV in the early stage of the disease is also one of the more difficult problems. Although many detection methods for NDV have been reported, common methods include real-time fluorescence quantitative PCR and ELISA. These methods can detect NDV during the disease onset period, and the detection limit of NDV is usually 10-100 copie / μL. For the detection of very low-load NDV, no effective method has been found yet. Summary of the Invention

[0004] In view of this, in order to achieve the detection of very low-load NDV, based on the conserved sequence of the NDV M gene, the present invention designed a pair of specific primers and a TaqMan probe, and established a cdPCR method with high specificity, high sensitivity, good repeatability and capable of absolute quantification, providing strong technical support for the early diagnosis of NDV infection.

[0005] To achieve the above technical objectives, the technical solution adopted in this application is as follows: In a first aspect, the present invention provides a primer-probe combination for detecting and / or differentiating Newcastle disease virus. In the primer-probe combination, the primers include: an upstream primer NDV-M-F with a nucleotide sequence as shown in SEQ ID NO.1, and a downstream primer NDV-M-R with a nucleotide sequence as shown in SEQ ID NO.2; the nucleotide sequence of the probe is as shown in SEQ ID NO.7.

[0006] Preferably, the 5' end of the probe is labeled with a fluorescent group FAM, VIC, ROX, Atto 425, Cy5, Cy5.5, and the 3' end is labeled with a fluorescent quenching group BHQ.

[0007] In a second aspect, the present invention provides the application of the primer-probe combination described in the first aspect in the preparation of a reagent or kit for detecting and / or differentiating Newcastle disease virus.

[0008] In a third aspect, the present invention provides a reagent or kit for detecting and / or differentiating Newcastle disease virus, wherein the reagent or the kit contains the primer-probe combination described in the first aspect.

[0009] Preferably, it further includes: necessary tools for cooperating with the primer-probe combination to achieve the detection and / or differentiation of Newcastle disease virus.

[0010] In a fourth aspect, the present invention provides a method for non-diagnostically detecting and / or differentiating Newcastle disease virus, including the following steps: S1. Prepare a standard plasmid containing Newcastle disease virus; S2. Mix the primer-probe combination described in claim 1 or 2 and the standard plasmid in step S1 to prepare a cdPCR sample; S3. Coat the cdPCR sample on a chip, perform amplification by digital PCR technology, and detect and / or differentiate Newcastle disease virus according to the amplification results.

[0011] Preferably, the cdPCR sample further includes 10×DiditalAmp® PCR Mix UDG and ddH2O.

[0012] Preferably, the volume ratio of each component in the cdPCR sample is: 10×DiditalAmp® PCR Mix UDG: upstream primer: downstream primer: probe: ddH2O: standard plasmid = 1.5: 0.5: 0.5: 0.25: 10.25: 2.

[0013] Preferably, the annealing temperature used for the amplification is 50 - 60°C.

[0014] More preferably, the annealing temperature used for the amplification is 55 - 60°C.

[0015] Compared with the prior art, the beneficial effects of the present invention are as follows: The present invention designs multiple sets of primer-probes for the NDV gene, and finally screens out an optimal combination. By using the primers and probes in this combination and adopting the cdPCR technology to detect NDV, it has the advantages of good linearity, high sensitivity, strong specificity, good repeatability, etc. Among them, the detection limit for the NDV-M gene in the sample is as low as 2.67 copie / μL; the coefficient of variation of the within-batch and between-batch repeated tests is less than 4%, and it is applicable to the accurate detection of the early stage of NDV. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 It is the optimization result of different primer-probe combinations for detecting Newcastle disease virus by cdPCR in Example 1 of the present invention. In the order from left to right in the figure: the first group of primer and probe one combination, the third group of primer and probe three combination, and the second group of primer and probe two combination.

[0017] Figure 2 It is the optimization result of detecting Newcastle disease virus by cdPCR in Example 2 of the present invention.

[0018] Figure 3 It is the result of the cdPCR sensitivity experiment in Example 3 of the present invention.

[0019] Figure 4 It is the standard curve of cdPCR in Example 3 of the present invention. Figure 5 It is the within-batch repeatability experiment of cdPCR in Example 3 of the present invention.

[0020] Figure 6 It is the between-batch repeatability experiment of cdPCR in Example 3 of the present invention.

[0021] Figure 7 It is the specificity experiment of cdPCR in Example 3 of the present invention.

[0022] Figure 8 It is the detection experiment of positive nucleic acid samples in Example 4 of the present invention. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0023] In the embodiments of the present invention, the instruments and equipment used are: the cdPCR sample preparation instrument, the AccuONE Amplifier, and the AccuONE-200 digital PCR biochip reader are all products of Zhende Biotechnology (Shanghai) Co., Ltd.

[0024] In the embodiments of the present invention, the virus nucleic acid samples used are: NDV, Avian influenza virus (AIV), Infectious laryngotracheitis virus (ILTV), Infectious bronchitis virus (IBV), and Avian leukosis virus (ALV), all of which are stored in this laboratory. These viruses are currently publicly available and can also be obtained through commercial channels. The reagents used include: Digital PCR chip kit and 10×DiditalAmp® PCR MixUDG, which are products of Zhende Biotechnology (Shanghai) Co., Ltd.

[0025] In addition, in the description of the present invention, it should be noted that for those not specifying specific conditions in the embodiments, they are carried out according to conventional conditions or the conditions recommended by the manufacturer. For reagents or instruments without indicating the manufacturer, they are all conventional products that can be purchased commercially.

[0026] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. The following is an explanation rather than a limitation of the present invention.

[0027] Example 1:

[0028] This example provides a primer-probe combination, and based on this primer-probe combination, a reagent and method for detecting and / or differentiating Newcastle disease virus are established, specifically as follows: I. Primers and probes The SnapGene software was used to align the complete genome sequence of NDV in GenBank, and the conserved sequences in the specific coding region of the M gene were selected to design primers and probes. Three groups of primers were designed using oligo7, specifically as follows: The first group: NDV-M-F1: CTCAGTGATGTGCTCGGACC (SEQ ID NO.1); NDV-M-R1: CCTGGGGAGAGGCATTTGCTA (SEQ ID NO.2); The second group: NDV-M-F2: GCCTGCTACCCTATAGCAAAT (SEQ ID NO.3); NDV-M-R2: CGGCTTGAATGATGACTTTCAC (SEQ ID NO.4); The third group: NDV-M-F3: ATCTGTTGGGCTCAGTGATG (SEQ ID NO.5); NDV-M-R3: GAGAGGCATTTGCTATAGGGTAG (SEQ ID NO.6); Three probe sequences were also designed: The 5'-end of the probe was labeled with the fluorescent group FAM, and the 3'-end was labeled with the fluorescent quenching group BHQ. Probe 1: FAM-TTCTCTAGCAGTGGGACAGCCT-BHQ (SEQ ID NO.7); Probe 2: FAM-CAGGTTGCCAAGATACTCTGGAGCC-BHQ (SEQ ID NO.8); Probe 3: FAM-AAAGGAGCAAGTAGCTTAGTCCGTGC-BHQ (SEQ ID NO.9); All primers and probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0029] The corresponding group of primers and probes were combined respectively to amplify and analyze the NDV gene, as follows: (1) The first group of primers and Probe 1 were combined, and the expected amplified fragment size was 124 bp; (2) The second group of primers and Probe 2 were combined, and the expected amplified fragment size was 97 bp; (3) The third group of primers and Probe 3 were combined, and the expected amplified fragment size was 128 bp; II. Preparation and Dilution of Standard Products Using the NDV positive nucleic acid sample stored in our laboratory as a template, the NDV M gene was amplified. The recovered product was ligated to the Ultra-Universal TOPO Cloning Vector, and then transformed into DH5α competent cells. The positive clone recombinant strain was screened, the plasmid was extracted, and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing identification. At the same time, the concentration of the standard plasmid was measured using a spectrophotometer, and the copy number was calculated. In this example, the copy number of the standard plasmid was 1.7×10 12 copies / μL, and the standard plasmid was serially diluted 10-fold with ddH2O, with a total of 9 dilution degrees (1.7×10 11 ~1.7×10 3 copies / μL).

[0030] III. Optimization of cdPCR Reaction System and Conditions Prepare the reaction mixture system: 1.5 μL of 10×DiditalAmp® PCR Mix UDG, 0.5 μL each of the forward and reverse primers, 0.25 μL of the probe, 10.25 μL of ddH2O, 2.0 μL of the standard plasmid, with a final volume of 15.0 μL. Uniformly coat the sample on the chip using a cdPCR sample preparation instrument, and then place the chip on an AccuONE Amplifier digital PCR amplifier for amplification. Amplification conditions: 95°C for 5 min; 95°C for 30 s, 60°C for 45 s, for a total of 40 cycles.

[0031] IV. Analysis of Amplification Results The amplification results are as Figure 1 shown. For combination (1), the separation between the negative and positive wells is the largest, and the amplification efficiency reaches 108%; for combination (2), the separation between the negative and positive wells is the smallest, and the amplification efficiency reaches 86%; for combination (3), the separation between the negative and positive wells is relatively small, and the amplification efficiency reaches 100%.

[0032] Comprehensive analysis shows that the above three groups of primers and probes all meet the reasonable range of G / C% at 40 - 60%, and the distances of the three groups of primers and probes are close. The size of the PCR product meets the reasonable range of 90 - 130 bp, the primer lengths are all controlled within 20 - 23 bases, and the probe lengths are 22 - 26 bases. In addition, there are 4 consecutive Gs in the reverse primer of the first group of primers. According to the general principle of primer design, the occurrence of repeated sequences, especially more than 4 consecutive Gs, needs to be avoided. Therefore, the first group of primers was initially used as a control primer to evaluate the design effects of other groups of primers. However, the amplification results of the first group of primers and probe one are the best instead. Therefore, finally, combination (1) is selected as the primer-probe combination for subsequent experiments in this example.

[0033] Example 2:

[0034] In this example, the primer-probe combination (1) obtained in Example 1 is used: NDV-M-F: CTCAGTGATGTGCTCGGACC; NDV-M-R: CCTGGGGAGAGGCATTTGCTA; Probe one: FAM-TTCTCTAGCAGTGGGACAGCCT-BHQ. Explore the annealing temperature by setting the annealing temperatures to 50, 55, and 65°C for comparison with the optimal amplification temperature (the amplification results at the annealing temperature of 60°C for combination (1) are already available in Example 1). For other conditions, refer to Example 1. After amplification, use an AccuONE-200 digital PCR biochip reader for data analysis.

[0035] The results are as Figure 2As shown, when the annealing temperature was 65°C, amplification was not successful; when it was 50°C, 55°C, and 60°C, the amplification results met the requirements of the cdPCR method (the threshold difference between negative and positive wells > 50). When the annealing temperature was 60°C, the amplification efficiency of the primer was the highest and the separation between negative and positive wells was relatively large. Therefore, 60°C was the optimal annealing temperature for the amplification system.

[0036] Finally, the reagents / kits for detecting and / or differentiating Newcastle disease virus determined in this example, and the method include: primer pair: NDV-M-F: CTCAGTGATGTGCTCGGACC; NDV-M-R: CCTGGGGAGAGGCATTTGCTA; probe: FAM-TTCTCTAGCAGTGGGACAGCCT-BHQ; reaction mixture system: 1.5 μL of 10×DiditalAmp® PCR Mix UDG, 0.5 μL each of upstream and downstream primers, 0.25 μL of probe, 10.25 μL of ddH2O, 2.0 μL of standard plasmid, with a final volume of 15.0 μL. The sample was evenly coated on the chip using a cdPCR sample preparation instrument, and then the chip was placed on an AccuONE Amplifier digital PCR amplifier for amplification. Amplification conditions: 95°C for 5 min; 95°C for 30 s, 60°C for 45 s, for a total of 40 cycles.

[0037] Example 3:

[0038] In this example, the reagents / kits and method for detecting and / or differentiating Newcastle disease virus determined in Example 2 were used for sensitivity, repeatability, and specificity tests, as follows: (1) Sensitivity verification The NDV-M plasmid standard was prepared using the method of Example 1, and the standard was serially diluted 10-fold (1.7×10 7 ~1.7×10 3 copies / μL), and cdPCR detection was performed using the optimized method to test the lowest detection limit of this method.

[0039] The results are shown in Figure 3 , the actual copy number of the amplification product was calculated, and then a standard curve showing the relationship between the actual copy number value of the amplification product and the copy number value of the standard plasmid was established (as shown in Figure 4 ). Linear relationship formula: y = 1.445x + 78.928, correlation coefficient R² = 0.9987. The results indicate that the cdPCR method established in this experiment has a good linear relationship and high sensitivity, and the lowest detection limit can reach 2.67 copies / uL.

[0040] (2) Repeatability verification Select copies of 1.7×107 ~1.7×10 5 copies / μL of the NDV-M standard plasmid at 3 concentration gradients were simultaneously subjected to cdPCR detection, with 3 replicates set for each sample to verify the within-batch repeatability of the method; one of the samples was subjected to 3 cdPCR detections, with 3 replicates set each time to verify the between-batch repeatability of the method.

[0041] The results of the within-batch repeatability experiment are as Figure 5 shown. Then, the within-batch repeat coefficient of variation was calculated respectively; the standard plasmid with a copy number of 1.7×10 6 copies / μL was amplified 3 times respectively. The results of the between-batch repeatability experiment are as Figure 6 shown. Then, the between-batch repeat coefficient of variation was calculated. It was found that both the within-batch repeat coefficient of variation and the between-batch repeat coefficient of variation were less than 4%, indicating that the repeatability of this method was good. The within-batch and between-batch test means, variances and coefficients of variation obtained are shown in Table 1.

[0042] Table 1 cdPCR repeatability results

[0043] (3) Specificity verification Using the positive nucleic acid samples of NDV, AIV, ILTV, IBV, and ALV stored in this laboratory as templates, the optimized reagents / kits and methods finally determined in Example 2 were used to perform cdPCR detection on the aforementioned several virus nucleic acid samples to verify the specificity of this method.

[0044] The results are as Figure 7 shown, indicating that only the NDV positive nucleic acid template was amplified positively, and the other pathogen nucleic acids were all negative, indicating that the established detection method was specific.

[0045] Example 4: In this example, 15 oropharyngeal / anal swabs were randomly collected from a chicken farm in Xiuwen County, Guiyang. The samples were extracted for RNA and reverse transcribed into cDNA, and 5 positive nucleic acid samples stored in the laboratory were added at the same time. Using these 20 nucleic acid samples as templates, the reagents and methods for detecting and / or differentiating Newcastle disease virus determined in Example 2 were used for cdPCR detection. At the same time, the fluorescence RT-qPCR method disclosed in the reference (\"Establishment and Application of a Universal Fluorescent RT-PCR Detection Method for Newcastle Disease Virus\", author: Ke Junhong, master's thesis of Tarim University) was used for detection (the primer-probe used was combination two in Table 2-2, and its final optimized reaction system and reaction program).

[0046] The detection results are shown in Table 2. All 5 positive nucleic acid samples detected by cdPCR were positive, and all 15 sampling samples from Xiuwen County were negative; among the 5 positive nucleic acid samples detected by RT-qPCR, only 1 was shown to be positive, and all 15 sampling samples from Xiuwen County were negative. Among the samples positive by cdPCR, the NDV content of 4 samples was below the detection limit of fluorescence RT-qPCR and was not detected by the fluorescence RT-qPCR method, indicating that the cdPCR method has higher detection sensitivity and is especially suitable for the detection and analysis of low-copy number samples.

[0047] Table 2 Detection Results of Clinical Samples

[0048] Among these 20 samples, the concentrations of 5 positive nucleic acid samples are as Figure 8 shown. The viral loads of 4 positive nucleic acid samples are low, and the accurate diagnosis of NDV is closely related to the viral load. The viral load of early NDV is extremely low, and the primer-probe combination of the present invention can accurately detect all 5 positive nucleic acid samples.

[0049] In summary, the reagent and method for detecting and / or differentiating Newcastle disease virus established by the present invention have good linearity, high sensitivity, strong specificity, and good repeatability, are suitable for the accurate detection of NDV, provide technical support for the early detection of NDV infection, and also provide an effective means for in-depth exploration of the pathogenic mechanism of NDV.

[0050] The above-described embodiments merely represent several implementation manners of the present invention. The description is relatively specific and detailed, but it should not be construed as a limitation on the scope of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the appended claims.

Claims

1. A primer-probe combination for detecting and / or differentiating Newcastle disease virus, characterized in that, In the primer-probe combination, the primers include: an upstream primer NDV-M-F with a nucleotide sequence as shown in SEQ ID NO.1, and a downstream primer NDV-M-R with a nucleotide sequence as shown in SEQ ID NO.2; the nucleotide sequence of the probe is as shown in SEQ ID NO.

7.

2. The primer-probe combination according to claim 1, wherein The 5'-end of the probe is labeled with a fluorescent group FAM, VIC, ROX, Atto 425, Cy5, Cy5.5, and the 3'-end is labeled with a fluorescent quenching group BHQ.

3. Use of the primer-probe combination according to claim 1 or 2 in the preparation of a reagent or kit for detecting and / or differentiating Newcastle disease virus.

4. A reagent or kit for detecting and / or differentiating Newcastle disease virus, characterized in that, The reagent or the kit contains the primer-probe combination according to claim 1 or 2.

5. The reagent or kit according to claim 4, wherein It further includes: Necessary tools for cooperating with the primer-probe combination to achieve detection and / or differentiation of Newcastle disease virus.

6. A method for detecting and / or differentiating Newcastle disease virus for non-diagnostic purposes, characterized in that, It includes the following steps: S1. Prepare a standard plasmid containing Newcastle disease virus; S2. Mix the primer-probe combination according to claim 1 or 2 and the standard plasmid in step S1 to prepare a cdPCR sample; S3. Coat the cdPCR sample on a chip, perform amplification by digital PCR technology, and detect and / or differentiate Newcastle disease virus according to the amplification result.

7. The method according to claim 6, wherein The cdPCR sample further includes 10×DiditalAmp®PCR Mix UDG and ddH2O.

8. The method according to claim 7, wherein The volume ratio of each component in the cdPCR sample is: 10×DiditalAmp® PCR Mix UDG: upstream primer: downstream primer: probe: ddH2O: standard plasmid = 1.5: 0.5: 0.5: 0.25: 10.25:

2.

9. The method according to claim 6, wherein The annealing temperature used for the amplification is 50-60°C.

10. The method according to claim 9, wherein The annealing temperature used for the amplification is 55-60°C.

Images