Clostridium ethanolicum protein feed additive

By performing site-directed mutation of the aldol dehydrogenase of Clostridium ethanol, the protein yield of the strain was improved, the problem of low protein yield of Clostridium ethanol was solved, and efficient preparation of soybean meal replacement was achieved, which reduced feed costs and improved breeding benefits.

CN120283874APending Publication Date: 2025-07-11SHANDONG JIURUI AGRICULTURALGROUP CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510454092.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-11
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

The existing Clostridium ethanol strains are inhibited due to the accumulation of ethanol production during the fermentation process, and the bacterial density is low, resulting in a low yield of Clostridium ethanol protein, making it difficult to effectively replace soybean meal as feed protein raw material.

Method used

CRISPR/Cas9 gene editing technology performed site-directed mutation of Clostridium ethanol protein aldol dehydrogenase, mutated Lys at 158 to Glu, constructed an aldol dehydrogenase mutant, increased the protein yield of the strain, and mixed it with other feed raw materials to prepare Clostridium ethanol protein feed additives.

Benefits of technology

The protein content of the mutant strain was increased by 45.85%, the dry weight was increased by 90.01%, and the feed-meat ratio as feed nitrogen source was reduced by 6.60%, which significantly improved the yield and economicality of the ethanol Clostridium ethanol prepared by fermentation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120283874A_ABST
    Figure CN120283874A_ABST
Patent Text Reader

Abstract

The invention provides an ethanol clostridium protein feed additive, and belongs to the technical field of feed. Through a CRISPR / Cas9 gene editing technology, site-directed mutagenesis is carried out on an aldol dehydrogenase gene of clostridium ethanolicum, and an amino acid site mutated strain is screened. The protein content of the zymophyte liquid of the clostridium ethanolicum mutant strain is increased by 45.85% compared with that of an unmutated wild strain. The dry weight of the clostridium ethanolicum wild type strain after fermentation is 14.32 g / L, the dry weight of the clostridium ethanolicum mutant strain after fermentation is 27.21 g / L, and the protein content of the mutant strain is increased by 90.01% compared with that of an unmutated wild type strain. The feed conversion ratio of white feather broilers fed by the feed prepared by using the mutant strain clostridium ethanol protein as a feed nitrogen source is 1.84: 1, which is close to 1.83: 1 of the feed prepared by using soybean meal as the nitrogen source, and the clostridium ethanol protein can be used as a soybean meal substitute for preparing the feed.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of feeds, and particularly relates to a Clostridium autoethanogenum protein feed additive. Background Art

[0002] Protein is the main component of cells and tissues and is crucial for the growth of animals' muscles, bones, skin, hair, etc. Protein is indispensable in feeds and has an important impact on the growth, immunity, reproduction, and production performance of animals. Soybean meal has a high crude protein content and is the main protein raw material for making livestock and poultry feeds. For a long time, soybean meal has been in a dominant position as the main form of nitrogen source supply in livestock and poultry feeds. However, in recent years, the continuously rising price of soybean meal has become the main factor for the increase in feed prices. Therefore, developing other protein raw materials with sufficient supply and low price as substitutes for soybean meal in feeds is both an opportunity and a challenge for the current development of the feed industry.

[0003] Clostridium autoethanogenum is an anaerobic bacterium that can utilize carbon monoxide and carbon dioxide as carbon sources. As a single-cell protein, Clostridium autoethanogenum can be fermented in large quantities, and its application as a feed protein has received attention in the industry. The crude protein content in Clostridium autoethanogenum is as high as over 80%, and the proportion of 18 amino acids in the protein reaches 94%, belonging to the type of simple protein; the content and structural proportion of 10 essential amino acids are close to those of fish meal and are superior to soybean meal, having excellent characteristics of feed protein raw materials. Clostridium autoethanogenum can utilize a large amount of carbon monoxide in industrial tail gas to produce cell protein and ethanol. Industrial tail gas not only has a very low cost but also has a wide range of sources, including steel mills, ferroalloy plants, calcium carbide plants, etc., and the resource quantity is very rich. Since Clostridium autoethanogenum can be completely inactivated by exposure to air, the cells can be centrifugally concentrated and spray-dried to obtain a Clostridium autoethanogenum protein product, and the production cost is much lower than that of single-cell protein products such as yeast and microalgae. Compared with single-cell proteins such as yeast and lactic acid, Clostridium autoethanogenum has a significant advantage of being economical and environmentally friendly because it can utilize harmful gases such as carbon monoxide and carbon dioxide as carbon sources for bacteria multiplication. In the existing Clostridium autoethanogenum strains, the growth of cells is inhibited due to the accumulation of ethanol production during fermentation, and the cell density is relatively low, resulting in a low yield of Clostridium autoethanogenum protein. Therefore, it is necessary to transform Clostridium autoethanogenum to achieve high-density fermentation to obtain a high yield of Clostridium autoethanogenum protein for feed preparation, so as to achieve the purpose of reducing the substitution of feed soybean meal. Summary of the Invention

[0004] The purpose of the present invention is to provide a Clostridium autoethanogenum protein feed additive, belonging to the technical field of feeds.

[0005] To achieve the above purpose, the present invention provides the following technical solutions:

[0006] Firstly, the present invention provides a Clostridium autoethanogenum protein feed additive, and the Clostridium autoethanogenum is a Clostridium autoethanogenum with site-directed mutation of aldehyde-alcohol dehydrogenase.

[0007] Furthermore, the amino acid sequence of the site-directed mutant of the aldol dehydrogenase is SEQ ID NO.1.

[0008] Furthermore, the Clostridium autoethanogenum protein can be used as a soybean meal substitute for feed preparation.

[0009] Furthermore, the preparation method of the feed is as follows: 50% corn, 15% wheat bran, 30% Clostridium autoethanogenum protein, 1.5% bone meal, 3% yeast powder, 0.5% salt. The prepared feed raw materials are stirred and mixed evenly by a mixer, dried, crushed by a crusher, and granulated.

[0010] Second, the present invention provides a mutant of Clostridium autoethanogenum aldol dehydrogenase, and the amino acid sequence of the Clostridium autoethanogenum aldol dehydrogenase mutant is SEQ ID NO.1.

[0011] Third, the present invention provides a gRNA for constructing a site-directed mutant of Clostridium autoethanogenum aldol dehydrogenase, and the nucleotide sequence of the gRNA is SEQ ID NO.2.

[0012] Fourth, the present invention provides a donor for constructing a site-directed mutant of Clostridium autoethanogenum aldol dehydrogenase, and the nucleotide sequence of the donor is SEQ ID NO.3.

[0013] The beneficial effects of the present invention are as follows: By using the CRISPR / Cas9 gene editing technology, Clostridium autoethanogenum is electrotransformed, and a strain with amino acid site mutation is screened. Lys at the 158th position of the amino acid sequence of Clostridium autoethanogenum aldol dehydrogenase is mutated to Glu. The protein content of the wild-type strain of Clostridium autoethanogenum after fermentation is 45.85%, and the protein content after the cell lysate of the mutant strain of Clostridium autoethanogenum is 66.87%. The protein content of the mutant strain is increased by 45.85% compared with the non-mutated wild-type strain. The dry weight of the wild-type strain of Clostridium autoethanogenum after fermentation is 14.32 g / L, and the dry weight of the mutant strain of Clostridium autoethanogenum after fermentation is 27.21 g / L. The protein content of the mutant strain is increased by 90.01% compared with the non-mutated wild-type strain. The feed conversion ratio of the feed prepared with the wild strain of Clostridium autoethanogenum protein as the feed nitrogen source for white - feather broilers is 1.97:1. The feed conversion ratio of the feed prepared with the mutant strain of Clostridium autoethanogenum protein as the feed nitrogen source for white - feather broilers is 1.84:1, which is close to 1.83:1 of the feed with soybean meal as the nitrogen source. The feed conversion ratio of the feed prepared by the mutant strain of Clostridium autoethanogenum aldol dehydrogenase constructed in the present invention is reduced by 6.60% compared with that of the wild - type Clostridium autoethanogenum. However, under the same fermentation process conditions, the mutant strain of Clostridium autoethanogenum can be used as a soybean meal substitute to prepare feed. The technology of efficiently fermenting and preparing Clostridium autoethanogenum protein feed additive can effectively reduce the feed cost and improve the breeding efficiency. Description of the Drawings

[0014] Figure 1 : Corresponding relationship among the three sequences of aldehyde alcohol dehydrogenase gene GS1, donor, and gRNA.

[0015] Figure 2 : Plasmid map of pT7-dCas9-adh vector.

[0016] Figure 3 : Detection of protein content in the fermentation broth of Clostridium autoethanogenum.

[0017] Figure 4 : Detection of dry weight after fermentation of Clostridium autoethanogenum. Specific implementation mode

[0018] Example 1: Protein structure modification and mutant design based on computer-aided design

[0019] The GenBank accession number of the amino acid sequence of aldehyde alcohol dehydrogenase of Clostridium autoethanogenum is: OVY51647.1. At the same time, referring to the protein UniProtKB:P0A9Q7 with a similar structure, the Discovery Studio software was used to analyze the protein amino acid sequence and perform homology modeling. The enzyme active site was analyzed, and the basic amino acid tyrosine Lys at position 158 was mutated to the acidic amino acid Glu by site-directed mutagenesis. The amino acid sequence of the aldehyde alcohol dehydrogenase mutant is SEQ ID NO.1.

[0020] Example 2: Construction of Clostridium autoethanogenum with site-directed mutation of aldehyde alcohol dehydrogenase gene

[0021] 1.1 Construction of site-directed mutation vector of aldehyde alcohol dehydrogenase gene

[0022] According to the aldehyde alcohol dehydrogenase gene in the whole genome sequence of Clostridium autoethanogenum GenBank:LITR01000002.1, gRNA was designed to guide Cas9 to cut downstream of the DNA site encoding Lys at position 158 of the aldehyde alcohol dehydrogenase gene of Clostridium autoethanogenum to generate a double-stranded DNA gap. The nucleotide sequence of gRNA SEQ ID NO.2: gtaaggttaaaatctgcaag conforms to the design principle of the gRNA sequence GN20NGG.

[0023] In order to introduce a site-directed mutation to mutate Lys at position 158 to Glu, the donor sequence SEQ ID NO.3 was designed. The middle is the mutant DNA sequence corresponding to the gRNA sequence, and the upstream and downstream are homologous arm sequences. To prevent the inserted site-directed mutation sequence from being cut by the gRNA-Cas9 system again, degenerate codons were introduced at the donor corresponding gRNA sequence sites. The corresponding relationship among the three sequences of aldehyde alcohol dehydrogenase gene adh, donor, and gRNA is as Figure 1 .

[0024] Construct a binary vector pT7-dCas9-adh for site-directed mutagenesis of the aldehyde dehydrogenase gene in Clostridium autoethanogenum, and co-electroporate it with the donor gene introducing mutations into Clostridium autoethanogenum, thereby exerting gene cleavage and homologous recombination to insert the site-directed mutation sequence. In this vector, the T7 promoter is used to initiate the expression of the Cas9 gene; the J23119 promoter is used to initiate the transcription of gRNA. The vector contains a kanamycin sulfate resistance gene for antibiotic screening of transformants. The plasmid map of the pT7-dCas9-adh vector is as shown in Figure 2 。

[0025] 1.2 Preparation of electrocompetent cells of Clostridium autoethanogenum

[0026] 1.2.1 Under anaerobic conditions, inoculate Clostridium autoethanogenum into 5 mL of modified ATCC 1754 medium (using CO / CO2 as the carbon source, strictly anaerobic), add 1-2% glycine at the initial stage of cultivation to increase cell wall permeability, and statically cultivate at 37 °C until the OD 600 reaches 0.4-0.6 (mid-logarithmic phase).

[0027] 1.2.2 Take 1-2 mL of the bacterial solution, centrifuge at 5000×g for 5 minutes at 4 °C, and discard the supernatant.

[0028] 1.2.3 Gently wash twice with pre-cooled electroporation buffer (containing 0.3 M sucrose + 1 mM MgCl2) to remove medium impurities.

[0029] 1.2.4 Suspend with a buffer containing lysozyme (0.1-1 mg / mL) and treat the cell wall in an ice bath for 10 minutes.

[0030] 1.3 Electroporation of Clostridium autoethanogenum

[0031] Resuspend the cells with 100 μL of pre-cooled electroporation buffer, add 1 μg of pT7-dCas9-adh plasmid DNA and 5 μg of donor gene (volume ≤ 10 μL). Voltage: 2.0-2.5 kV (such as Bio-Rad Gene Pulser, 2 mm electroporation cuvette); capacitance / resistance: 25 μF, 200-400 Ω; time constant: 4-5 ms. Immediately after electroporation, add 1 mL of pre-cooled recovery medium (containing 0.3 M sucrose) and transfer to an anaerobic environment.

[0032] 1.4 Recovery and screening

[0033] Cultivate statically anaerobically at 37 °C for 2-4 hours, and plate for screening: Take 100-200 μL of the bacterial solution and spread it on a solid medium containing 50 μg / mL kanamycin sulfate, and anaerobically culture for 3-7 days (depending on the growth rate).

[0034] 1.5 Screening and genotype identification of gene mutation strains

[0035] Pick a single colony from the kanamycin sulfate plate and inoculate it into 5 mL of modified ATCC 1754 medium (using CO / CO2 as the carbon source, strictly anaerobic), and incubate statically at 37 °C for 16 hours.

[0036] Extract the genome using a bacterial DNA extraction kit, and amplify the DNA sequence where the target site is located using the primer pair donorF / donorR. The reaction system is as follows:

[0037] DNA template 100.0 - 200.0 ng

[0038]

[0039] ddH2O to 50.0 μL

[0040] PCR reaction program:

[0041] 95 °C for 5 min

[0042] 95 °C for 30.0 s

[0043] 56 °C for 30.0 s for 30 cycles

[0044] 72 °C for 10.0 s

[0045] 72 °C for 5 min

[0046] Recover the PCR products of each plant, ligate them to the pMD 19-T vector, and then entrust a sequencing company to perform sequencing to screen for strains with site-directed mutations in the aldol dehydrogenase gene.

[0047] Example 3: Preparation of Clostridium autoethanogenum protein by fermentation of Clostridium autoethanogenum with aldol dehydrogenase gene mutation

[0048] 1.1 Medium preparation Add 10 g of peptone, 5 g of yeast extract, 20 g of glucose, 1 g of potassium dihydrogen phosphate, 0.2 g of magnesium sulfate, 5 g of sodium chloride, and 2 g of calcium carbonate to each liter of distilled water, adjust the pH to 5.8 - 6.0, and autoclave at 121 °C for 20 minutes. The cooled medium is poured into an anaerobic jar, and a mixed gas (40% CO, 30% CO2, 10% H2, 20% N2) is filled to remove oxygen. Add resazurin anaerobic indicator to ensure an anaerobic environment.

[0049] 1.2 Inoculation Respectively inoculate the wild-type Clostridium autoethanogenum and the Clostridium autoethanogenum C158 strain with the aldol dehydrogenase gene mutation in an amount of 7% by volume into the anaerobic jar.

[0050] 1.3 Fermentation culture Set the fermentation parameters as follows: temperature 37°C, pressure 1.5 atm, stirring speed 150 rpm, gas flow rate 0.5 vvm (volume of gas / volume of liquid / minute), and ferment for 7 days. After the culture is completed, spray-dry the fermentation broth into dry powder.

[0051] 1.4 Protein content detection Use the BCA method to detect the protein content, and repeat the detection 3 times for each sample.

[0052] 1.4.1 Dilute the BSA standard Dilute the BSA standard with PBS. See Table 1.

[0053] Table 1 Preparation of standards

[0054]

[0055] 1.4.2 Prepare the BCA working solution

[0056] 1.4.2.1 Use the following formula to determine the total volume of the working solution required

[0057] (Number of standards + Number of samples to be tested) × (Number of experimental repetitions) × (Volume of working solution used for each sample) = Total volume of working solution required

[0058] Taking 12 samples to be tested as an example:

[0059] (9 standards + 12 samples to be tested) × (2 experimental repetitions) × (2.0 ml) = 84 ml of working solution

[0060] 1.4.2.2 Mix 90 ml of BCA reagent A with 1.8 ml of BCA reagent B (the ratio of reagent A to reagent B = 50:1) to prepare the working solution.

[0061] 1.4.2.3 Detection

[0062] 1.4.2.3.1 Take 0.1 ml of each diluted concentration of the standard and the sample to be tested dissolved at 1 mg / mL, and add them to the labeled test tubes.

[0063] 1.4.2.3.2 Add 2.0 ml of the working solution to each test tube and mix well.

[0064] 1.4.2.3.3 Seal the test tubes and incubate at 37°C for 30 minutes.

[0065] 1.4.2.3.4 Cool all the test tubes to room temperature.

[0066] 1.4.2.3.5 Set the detection wavelength of the spectrophotometer to 562 nm, and use a cuvette filled only with deionized water to zero the instrument. Then, measure the absorbance values of all samples in sequence within 10 minutes.

[0067] 1.4.2.3.6 Subtract the average absorbance value of the blank standard at 562 nm from the absorbance values of each standard and the samples to be measured at 562 nm.

[0068] 1.4.2.3.7 Plot the absorbance values of the standards after blank correction at 562 nm against their concentrations (μg / ml), with the concentration as the abscissa and the absorbance value as the ordinate, to draw a standard curve (the R2 value should not be lower than 0.9900), and obtain a quadratic equation. Substitute the absorbance value of each sample to be measured into the equation to calculate the total protein content. It can be seen from Figure 3 that the protein content after fermentation of the wild-type strain of Clostridium ethanolicus is 45.85%, and the protein content after cell disruption of the mutant strain of Clostridium ethanolicus is 66.87%. The protein content of the mutant strain is increased by 45.85% compared with the non-mutated wild-type strain.

[0069] 1.5 Repeat fermentation for 3 batches under the same fermentation parameters, and measure the dry weight after spray drying of the fermentation broth. It can be seen from Figure 4 that the dry weight after fermentation of the wild-type strain of Clostridium ethanolicus is 14.32 g / L, and the dry weight after fermentation of the mutant strain of Clostridium ethanolicus is 27.21 g / L. The protein content of the mutant strain is increased by 90.01% compared with the non-mutated wild-type strain.

[0070] Example 4: Test on the effect of the feed prepared from the protein of the aldehyde alcohol dehydrogenase mutant strain Clostridium ethanolicus on the growth performance of white - feather broilers

[0071] 1.1 Feed preparation

[0072] Feed 1: 50% corn, 15% wheat bran, 30% soybean meal, 1.5% bone meal, 3% yeast powder, 0.5% salt. The proportioned feed raw materials are stirred and mixed evenly by a mixer, dried, crushed by a crusher, and granulated;

[0073] Feed 2: 50% corn, 15% wheat bran, 30% protein of the aldehyde alcohol dehydrogenase mutant strain Clostridium ethanolicus, 1.5% bone meal, 3% yeast powder, 0.5% salt. The proportioned feed raw materials are stirred and mixed evenly by a mixer, dried, crushed by a crusher, and granulated;

[0074] Feed 3: 50% corn, 15% wheat bran, 30% protein of the wild - type strain Clostridium ethanolicus, 1.5% bone meal, 3% yeast powder, 0.5% salt. The proportioned feed raw materials are stirred and mixed evenly by a mixer, dried, crushed by a crusher, and granulated.

[0075] 1.2 Animal experiment

[0076] (1) 300 one-day-old healthy white - feather broilers were randomly divided into 3 groups, with 100 broilers in each group, and raised in isolation.

[0077] (2) They were fed twice a day at 8:00 and 17:00, with free access to food and water. The experimental period was 40 days. During the feeding period, they were immunized and managed according to the conventional immunization program for white - feather broilers. At the end of the experiment, the feed - to - meat ratio of the experimental chickens was calculated.

[0078] Table 2 Experiment on the effect of the feed prepared with the Clostridium acetobutylicum mutant strain on the growth performance of white - feather broilers

[0079] Grouping Nitrogen source Feed conversion ratio Feed 1 Soybean meal 1.83:1 Feed 2 Mutant strain ethanol clostridial protein 1.84:1 Feed 3 Wild strain ethanol clostridial protein 1.97:1

[0080] As can be seen from Table 2, the feed - to - meat ratio of the white - feather broilers fed with the feed prepared with the wild - type strain of Clostridium acetobutylicum protein as the feed nitrogen source was 1.97:1. The feed - to - meat ratio of the white - feather broilers fed with the feed prepared with the mutant - strain Clostridium acetobutylicum protein as the feed nitrogen source was 1.84:1, which was close to 1.83:1 of the feed with soybean meal as the nitrogen source. The feed - to - meat ratio of the feed prepared with the aldehyde - alcohol dehydrogenase mutant strain of Clostridium acetobutylicum constructed in the present invention was reduced by 6.60% compared with that of the feed prepared with the wild - type Clostridium acetobutylicum. However, under the same fermentation process conditions, the protein yield of the mutant strain was significantly higher than that of the wild - type strain. This Clostridium acetobutylicum can be used as a substitute for soybean meal to prepare feed.

Claims

1. A Clostridium autoethanogenum protein feed additive, characterized in that The Clostridium autoethanogenum is a Clostridium autoethanogenum with site-directed mutagenesis of aldehyde-alcohol dehydrogenase, and the amino acid sequence after site-directed mutagenesis of the aldehyde-alcohol dehydrogenase is SEQ ID NO.

1.

2. The Clostridium autoethanogenum protein feed additive according to claim 1, wherein The Clostridium autoethanogenum protein can be used as a soybean meal substitute for feed preparation.

3. The Clostridium autoethanogenum protein feed additive according to claim 1, wherein The preparation method of the feed is as follows: 50% corn, 15% wheat bran, 30% Clostridium autoethanogenum protein, 1.5% bone meal, 3% yeast powder, 0.5% salt. The feed raw materials in the ratio are stirred and mixed evenly by a mixer, dried, crushed by a crusher, and granulated.

4. An acetol alcohol dehydrogenase mutant of Clostridium autoethanogenum, characterized in that, The amino acid sequence of the Clostridium autoethanogenum aldehyde-alcohol dehydrogenase mutant is SEQ ID NO.

1.

5. A gRNA for constructing site-directed mutagenesis of alcohol dehydrogenase in Clostridium autoethanogenum, characterized in that, The nucleotide sequence of the gRNA is SEQ ID NO.

2.

6. A donor for constructing site-directed mutagenesis of aldehyde alcohol dehydrogenase in Clostridium autoethanogenum, characterized in that, The nucleotide sequence of the donor is SEQ ID NO.3.