American ginseng Chinese forest frog oil product as well as preparation method and application thereof

By improving the preparation method of American ginseng snow clam oil drinks, and using mutant papain and ethanol extraction technology, the problems of high price, allergic risk and unstable effects of American ginseng snow clam oil drinks have been solved, and the efficient extraction and stability of active ingredients have been achieved. It has the effects of moistening the lungs and strengthening the spleen, nourishing qi and blood, alleviating fatigue and enhancing immunity.

CN120283955APending Publication Date: 2025-07-11TONGHUA KANGYUAN BIOLOGICAL TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510443866.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-10
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

The existing American ginseng snow clam oil drinks have problems such as expensive, allergic risks, differences in effect, uneven quality and uncertain long-term safety, and the extraction rate and stability of active ingredients need to be improved.

Method used

Improved preparation methods, including homogenization and enzymatic treatment of snow clam oil powder, ethanol extraction of American ginseng, formulation of jujube, rock sugar and potassium sorbate, and mutant papain is used to improve the extraction rate and stability of active ingredients.

Benefits of technology

It improves the extraction rate and stability of the active ingredients of snow clam oil, and the product has shown good results in moistening the lungs and spleen, nourishing qi and blood, relieving fatigue and enhancing immunity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120283955A_ABST
    Figure CN120283955A_ABST
Patent Text Reader

Abstract

The invention relates to the field of food and functional food, in particular to a preparation method and application of a product containing American ginseng and Chinese forest frog oil. The preparation method of the Chinese forest frog oil is optimized, and the Chinese forest frog oil is subjected to enzymolysis by adopting mutated papain, so that the extraction rate and the stability of active ingredients are remarkably improved. The prepared American ginseng Chinese forest frog oil product is suitable for body weakness and premature senility caused by spleen and lung weakness and kidney essence insufficiency as well as nourishing and body building of people with sub-health, postoperative weakness, qi and blood insufficiency and hypovigor, and the immunity of the organism is improved. The tea has good effects of moistening lung and strengthening spleen, reinforcing qi and nourishing blood, relieving fatigue and enhancing immunity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of food, and particularly to a preparation method and application of a product containing American ginseng and snow frog oil. Background Art

[0002] American ginseng (Panax quinquefolius) is native to North America and was introduced into China as early as the 18th century and has become an important tonic medicinal material in traditional Chinese medicine. American ginseng is rich in active ingredients such as ginsenosides, polysaccharides, amino acids, and trace elements, and has various pharmacological effects such as enhancing immunity, anti-fatigue, antioxidant, and improving cardiovascular function. Among them, ginsenosides are the main active ingredients of American ginseng and have effects such as regulating the immune system, anti-inflammatory, and anti-tumor.

[0003] Snow frog oil, also known as forest frog oil or Rana temporaria chensinensis oil, is a natural nutrient extracted from the oviducts of female forest frogs (Rana chensinensis). Snow frog oil is regarded as a precious medicinal material for nourishing yin and moistening the lungs, tonifying the kidney and replenishing essence in traditional Chinese medicine, and is especially suitable for relieving dry cough due to lung dryness, improving skin condition, and delaying aging. Snow frog oil is rich in collagen, amino acids, unsaturated fatty acids, and various vitamins, and has extremely high nutritional value and biological activity. Among them, collagen plays a significant role in skin health and repair, while unsaturated fatty acids help regulate blood lipids and enhance cardiovascular health.

[0004] With the improvement of people's health awareness, the functional beverage market has expanded rapidly. Functional beverages not only meet the taste needs of consumers but also have specific health care effects, such as enhancing immunity, improving sleep, and anti-fatigue. As traditional medicinal materials, American ginseng and snow frog oil are gradually applied to the development of modern functional beverages. Through scientific extraction and formula optimization, American ginseng and snow frog oil beverages have become new healthy products that combine traditional medicinal effects and modern food technology.

[0005] The preparation process of American ginseng and snow frog oil beverages has evolved from traditional to modern. In the early stage, simple decoction or soaking methods were mainly used to extract active ingredients, but the efficiency was low and the loss of active ingredients was large. With the development of modern food processing technology, technologies such as low-temperature extraction, ultrasonic-assisted extraction, and membrane separation have been widely used in the extraction process of American ginseng and snow frog oil, significantly improving the extraction rate and stability of active ingredients. In addition, the application of technologies such as aseptic filling and low-temperature concentration also ensures the quality and safety of the beverages.

[0006] At present, the research on American ginseng and snow frog oil drinks mainly focuses on the extraction of active ingredients, function verification, and product development. Research shows that the combination of American ginseng and snow frog oil has a synergistic effect, which can better play the effects of enhancing immunity, anti-fatigue, beauty, etc. At the same time, the market demand for functional drinks continues to grow, especially for sub-healthy people, sports enthusiasts, and consumers who pay attention to beauty.

[0007] Despite the many advantages of American ginseng and snow frog oil drinks, there are still the following problems: high price: the raw material cost is high, resulting in a high product price, which limits the popularization; allergy risk: some people may be allergic to snow frog oil or American ginseng; effect difference: due to individual differences, the effect may not be obvious in some people; uneven quality: the quality of products on the market is different, and some products are doped with low-efficiency ingredients; long-term safety needs to be studied: the potential risks of long-term drinking still need more research support, etc. Therefore, optimizing the preparation process and improving the extraction rate and stability of active ingredients are currently a difficult problem. Summary of the Invention

[0008] The purpose of the present invention is to provide a preparation method of American ginseng and snow frog oil drink, which comprises the following process steps:

[0009] (1) Preparation of snow frog oil: S1. Accurately weigh the snow frog oil powder and add an appropriate amount of pure water to soak and expand for 18 - 24 h, then homogenize 5 times at 12000 rpm, 20 s each time. Heat the homogenized snow frog oil to boiling for 4 - 6 h, stop heating, and obtain the primary snow frog oil liquid.

[0010] S2. Enzymatic hydrolysis: Add an appropriate amount of pure water to the snow frog oil obtained in step S1, stir evenly, then add 0.1 - 0.5% papain (the proportion of papain accounts for 0.1 - 0.5% of the mass of the primary snow frog oil liquid), adjust the PH to 7.5, heat to 50 - 55 °C for enzymatic hydrolysis for 3 hours (continuously stir during enzymatic hydrolysis), boil and inactivate for 15 minutes, and filter and concentrate through a 20 - 50 mesh sieve to the weight of the crude drug to obtain snow frog oil.

[0011] (2) Preparation of American ginseng extract: Take an appropriate amount of American ginseng and crush it. Mix the American ginseng powder with an ethanol solution (usually with a concentration of 50 - 70%) in proportion, stir and extract at a lower temperature (usually 60 - 70 °C) for 1 - 2 hours, then filter through a 20 - 50 mesh sieve, and concentrate to the weight of the crude drug to obtain the American ginseng extract.

[0012] (3) Product formulation: Weigh 5 - 10 parts of American ginseng, 5 - 10 parts of snow frog oil, 5 - 8 parts of Chinese dates, 5 - 10 parts of rock sugar, and 1 - 2 parts of potassium sorbate in proportion, and the balance is water. All of the above are parts by mass. Heat and decoct at 100 °C, sterilize at high temperature, and then subpackage.

[0013] Among them, in step S1, the mass ratio of snow frog oil powder to water is 1-5:100-200 (W / V);

[0014] Preferably it is 1:100 (W / V);

[0015] Among them, in step S2, the amount of water added is 70%-150% of the mass of the initial snow frog oil solution;

[0016] Preferably it is 80%;

[0017] Among them, in step S2, the amino acid sequence of papain is as shown in SEQ ID NO.1.

[0018]

[0019] Its nucleotide sequence is as shown in SEQ ID NO:2;

[0020]

[0021]

[0022] Optionally, the papain can be selected from its wild type or mutants.

[0023] Preferably, the mutation positions of papain are one or more of D80E, V149Q or R226A.

[0024] More preferably, the mutations of papain are one or more of D80E and V149Q.

[0025] More preferably, the mutation site of papain is D80E / V149Q.

[0026] Among them, the amino acid sequence of the enzyme mutant D80E is as shown in SEQ ID NO.3.

[0027] The amino acid sequence of the enzyme mutant V149Q is as shown in SEQ ID NO.4.

[0028] The amino acid sequence of the enzyme mutant D80E / V149Q is shown in SEQ ID NO.5.

[0029] The above mutation positions are all based on the wild type papain (SEQ ID NO:1) as a template.

[0030] Among them, in step S2, the proportion of papain is 0.2-0.5% (W / V), and the more preferred proportion is 0.2%.

[0031] Among them, in the preparation process of American ginseng, the ratio of American ginseng to ethanol is 1:4 (w / v);

[0032] More preferably, it is 1:3 (w / v).

[0033] The second object of the present invention is to provide a American ginseng and snow frog oil product prepared by the above method, which comprises components such as American ginseng, snow frog oil, Chinese dates, rock sugar, potassium sorbate, etc.

[0034] Specifically, its composition is: 5-10 parts of American ginseng, 5-10 parts of snow frog oil, 5-8 parts of Chinese dates, 5-10 parts of rock sugar, 1-2 parts of potassium sorbate, and the balance is water. The above ratios are all in mass-volume parts.

[0035] Furthermore, the product can be in the form of oral liquid, beverage, capsule, food, etc., and they are all prepared by conventional methods in the art.

[0036] Furthermore, it can be a health care product, functional food or food with health care functions containing the above components, etc.

[0037] The third aspect of the present invention is to provide the application of the above American ginseng and snow frog oil product.

[0038] The product of the present invention is applicable to people with physical weakness, premature aging caused by spleen and lung weakness and kidney essence deficiency, as well as sub-health, weakness after surgery, qi and blood deficiency, and energy decline for tonifying the body and enhancing the body's immunity. It has the functions of moistening the lungs and strengthening the spleen, replenishing qi and nourishing blood, and tonifying the kidney and benefiting essence.

[0039] The present invention has the following advantages:

[0040] 1. The preparation method of the American ginseng and snow frog oil product of the present invention is simple and efficient, and does not require complex processes.

[0041] 2. The method of the present invention improves the extraction rate and stability of the active ingredients of snow frog oil

[0042] 3. The American ginseng and snow frog oil product obtained by the method of the present invention has good effects in moistening the lungs and strengthening the spleen, replenishing qi and nourishing blood, relieving fatigue, and enhancing immunity. Description of the Drawings

[0043] Figure 1 Western electrophoresis of enzyme mutants. Among them, band 1 is the D80E enzyme mutant, band 2 is the V149Q enzyme mutant, band 3 is the R226A enzyme mutant, and band 4 is the D80E / V149Q enzyme mutant.

[0044] Figure 2 Enzyme activity detection chart. Among them, 1-5 are the enzyme activities of papain WT and mutants D80E, V149Q, R226A, and D80E / V149Q respectively.

[0045] Figure 3 Graph of the swimming time of mice with load.

[0046] Figure 4 The area under the curve of lactic acid in mouse serum.

[0047] Figure 5 The contents of IgG and IgM in mouse serum. Specific implementation manners

[0048] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, but the protection scope of the present invention is not limited thereto.

[0049] In the following embodiments, various processes and methods not described in detail are all conventional methods well known in the art. The sources, trade names of the reagents used, and those for which it is necessary to list their components are indicated when they first appear. For the same reagents used later, without special instructions, they are the same as the content indicated for the first time; the reagents, materials, etc. involved, unless otherwise specified, are obtained through commercial channels.

[0050] Example 1 Design of gene and construction of recombinant cloning vector

[0051] Screening of papain mutants In order to improve the enzyme activity of wild-type papain (GenBank: AAA72774.1, amino acid sequence is SEQ ID NO: 1, and the coding nucleotide sequence is SEQ ID NO: 2), the applicant screened a large number of mutations of amino acids near the active site of the enzyme through directed evolution technology.

[0052] Design the following PCR primers:

[0053] F: GGC AATTCT TGCTTTTCGTTGCAATCTGTCT (the underlined part is the recognition site of restriction endonuclease EcoRI, SEQ ID NO: 6);

[0054] R: ATA GCGGCCGC TACGTATGTAACCGTTCTCACC (the underlined part is the recognition site of restriction endonuclease NotI, SEQ ID NO: 7).

[0055] Using the papain gene (SEQ ID NO: 2) as a template, PCR amplification was performed with the above primers using the GeneMorph II Random Mutagenesis PCR Kit (Stratagene). The PCR products were recovered by gel electrophoresis, digested with EcoRI and NotI, and then ligated to the pET21a vector digested with the same enzymes. The ligation products were transformed into Escherichia coli BL21(DE3), and spread on LB + Amp plates. The plates were incubated at 37 °C in an inverted position. After the appearance of transformants, the colonies were picked one by one with toothpicks and transferred to 96-well plates. 150 μL of LB + Amp medium containing 0.1 mM IPTG was added to each well, and the plates were incubated at 37 °C and 220 rpm for about 6 h. The supernatant was discarded by centrifugation, and the cells were resuspended in buffer. The cells were lysed by repeated freezing and thawing to obtain an Escherichia coli cell lysate containing papain.

[0056] 50 μL of the lysate was taken and transferred to two new 96-well plates. The papain activity and protein content were measured at 37 °C, and the specific activity of different mutants was calculated.

[0057] The experimental results showed that the mutation sites with significantly improved enzyme activity at 37 °C were: D80E, V149Q or R226A.

[0058] On this basis, papain mutants containing one or two combinations of the above mutation sites D80E, V149Q or R226A were obtained.

[0059] Example 2 Construction of Papain Mutants and Recombinant Strains

[0060] The nucleotides of the above enzyme mutants were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The wild type (wt) and its variants were successfully cloned into the plasmid pET-30a(+). Meanwhile, 6 His tags were added to the N-terminus of the genes during the construction of the expression plasmids. The successfully constructed recombinant plasmids were transformed into Escherichia coli BL21(DE3) cells, denoted as E.coli BL21(DE3) / pET-30a(+)-WT, E.coli BL21(DE3) / pET-30a(+)-mutD80E, E.coli BL21(DE3) / pET-30a(+)-mutV149Q, E.coli BL21(DE3) / pET-30a(+)-mutR226A, coli BL21(DE3) / pET-30a(+)-mutD80E / V149Q. Single colonies of the recombinants were picked, cultured in medium, identified by colony PCR, verified by restriction enzyme digestion and sequencing, and the wild-type and mutant engineering bacteria were selected and preserved.

[0061] Example 3 Expression of Papain in Recombinant Engineering Bacteria

[0062] Three strains of each type of strain were selected and cultured in liquid LB medium (containing 5 μg / mL erythromycin), incubated statically at 30 °C overnight. The next day, they were inoculated into 100 mL of LB liquid medium (containing 5 μg / mL erythromycin) at an inoculation amount of 5%, and incubated statically at 30 °C. When the OD600 reached about 0.5, 100 μL of 0.3 M CuSO4 filtered and sterilized was added in a laminar flow hood, and then incubated statically at 30 °C for 4 h, and then incubated at 16 °C for 24 h. 90 μL of the supernatant of the recombinant strain cell wall lysate was taken respectively, and each was mixed with 30 μL of 4× Protein Loading Buffer, and boiled at 100 °C for 10 min. Centrifuged at 4 °C and 12 000 rpm for 5 min, the sample treatment solution was collected and purified by ion exchange chromatography.

[0063] Specifically, 10.0 mL of the concentrated solution of papain and its mutants was passed through a HiTrap Q HP anion column pre-equilibrated with 10 mmol / L Tris-HCl (pH 8.0), and then linearly gradient eluted with 10 mmol / L Tris-HCl (pH 8.0) containing 1 mol / L NaCl. The enzyme activity was detected by colorimetry, and at the same time, the purity of the protein solution eluted by gradient was detected by SDS-PAGE gel electrophoresis.

[0064] As Figure 1 shown, SDS-PAGE was performed on papain, and a clear and bright band of about 38.9 Kda was obtained, indicating that the above mutants were all successfully expressed and had a high purity.

[0065] As Figure 2 shown, the average extracellular enzyme activities of WT, D80E, V149Q, R226A and D80E / V149Q were 336.7 U / mL, 395.2 U / mL, 376.4 U / mL, 106.9 U / mL, 446.7 U / mL respectively.

[0066] From Figure 2 it can be seen that the enzyme activities of mutants D80E and V149Q were significantly improved compared with the wild type (P < 0.05), and the enzyme activity of mutant D80E / V149Q was significantly improved compared with the wild type (P < 0.01).

[0067] * indicates P < 0.05, ** indicates P < 0.01.

[0068] The mutants with better enzyme activities were selected for the experiment of enzymatically hydrolyzing forest frog oil. The specific grouping is as follows:

[0069] Wild group: Using wild-type papain;

[0070] Mutant 1 group: Using papain containing D80E / V149Q;

[0071] Mutation group 2: Papain containing D80E was used.

[0072] Mutation group 3: Papain containing V149Q was used.

[0073] Preparation of snow frog oil in Example 4

[0074] S1. Accurately weigh 10 g of snow frog oil powder and add it to 500 ml of pure water for soaking for 18 - 24 h. Then homogenize it 5 times at 12,000 rpm, 20 s each time. Heat the homogenized snow frog oil to boiling for 4 - 6 h, and stop heating to obtain the primary snow frog oil solution.

[0075] S2. Enzymatic hydrolysis: Add pure water with a volume fraction of 80% to the snow frog oil obtained in step S1, stir evenly, then add 0.2% papain (the proportion of papain is 0.2% of the mass of the primary snow frog oil solution), adjust the pH to 7.5, heat to 50 - 55 °C for enzymatic hydrolysis for 3 h (stir continuously during enzymatic hydrolysis), boil for inactivation for 15 minutes, and filter and concentrate through a 20 - 50 mesh sieve to the weight of the crude drug to obtain snow frog oil.

[0076] Characterization of active ingredients

[0077] The content of active ingredients such as protein, fat, moisture, ash, etc. in snow frog oil was determined by the national standard method.

[0078] 1. Determination of protein content (Kjeldahl method)

[0079] Digestion: Weigh an appropriate amount of snow frog oil sample (about 0.5 - 1.0 g) and put it into a Kjeldahl flask. Add concentrated sulfuric acid and a catalyst (such as copper sulfate and potassium sulfate), and heat in a digestion furnace until the sample is completely digested and the solution becomes transparent blue - green.

[0080] Distillation: Transfer the digestion solution to a distillation device, add an excessive amount of sodium hydroxide solution to release ammonia. Absorb the distilled ammonia with boric acid solution.

[0081] Titration: Titrate the absorbent with a standard hydrochloric acid solution, and record the titration end point. Calculate the nitrogen content based on the consumption of hydrochloric acid, and then convert it to the protein content.

[0082] 2. Determination of fat (Soxhlet extraction method)

[0083] Weigh an appropriate amount of snow frog oil sample (about 2 - 5 g) and put it into a filter paper tube.

[0084] Extraction: Put the filter paper tube into a Soxhlet extractor and add an appropriate amount of petroleum ether. Heat and reflux for extraction for 6 - 8 h to completely dissolve the fat in the solvent.

[0085] Evaporation and weighing: Transfer the extract to a flask with a known weight, evaporate the solvent. Weigh after drying and calculate the fat content.

[0086] The moisture and ash contents were determined by oven drying method and dry ashing method respectively. The determinations were carried out using conventional operating methods in the art.

[0087] Table 1 Characterization of the main components in snow frog oil

[0088]

[0089] --: indicates that the component is unknown or not measured

[0090] As can be seen from Table 1, the contents of protein, fat, ash, etc. in the enzymatically hydrolyzed snow frog oil of mutant group 1 were higher than those of the wild-type group, and the contents of protein, fat, ash, etc. in the enzymatically hydrolyzed snow frog oil of mutant group 2 were slightly higher than those of the wild-type group. It shows that both mutant 1 and mutant 2 enzymatic hydrolyses can effectively improve the active components and stability in snow frog oil.

[0091] Example 5 Preparation of American ginseng snow frog oil product

[0092] Preparation of American ginseng extract: Take 20 g of American ginseng and crush it. Mix the American ginseng powder with an ethanol solution (usually with a concentration of 50 - 70%) in a ratio of 1:3, stir and extract at a lower temperature (usually 60 - 70 °C) for 1 - 2 hours, then filter through a 20 - 50 mesh sieve, and concentrate to the weight of the crude drug to obtain the American ginseng extract.

[0093] Preparation of Chinese date extract: Take 50 g of Chinese dates, wash them, decoct twice with water and then filter, concentrate to the weight of the crude drug to obtain the Chinese date extract.

[0094] Preparation of rock sugar syrup: Take 300 g of rock sugar and add pure water to make syrup.

[0095] Product formulation: Charge 10 parts of American ginseng, 10 parts of snow frog oil, 8 parts of Chinese dates, 5 parts of rock sugar, and 2 parts of potassium sorbate according to the mass ratio, with the balance being water, heat and decoct at 100 °C, sterilize at high temperature, and then package.

[0096] Among them, product 1 was prepared from wild-type papain;

[0097] Product 2 was prepared from papain mutant 1;

[0098] Product 3 was prepared from papain mutant 2;

[0099] Product 4 was prepared from papain mutant 3;

[0100] Example 6 Animal experiment

[0101] Fifty healthy adult C57BL / 6 mice, weighing 18 - 22 g, with half males and half females, were randomly divided into 5 groups, with 10 mice in each group:

[0102] Negative control group: gavaged with normal saline.

[0103] Experimental group 1: gavaged with American ginseng and snow frog oil product 1;

[0104] Experimental group 2: gavaged with American ginseng and snow frog oil product 2;

[0105] Experimental group 3: gavaged with American ginseng and snow frog oil product 3;

[0106] Experimental group 4: gavaged with American ginseng and snow frog oil product 4;

[0107] The above dosages were all 150 mg / kg·d. The experiment lasted for 28 days, and gavage was performed once a day at a fixed time.

[0108] 1. Load-bearing swimming experiment

[0109] Objective: To evaluate the effect of American ginseng and snow frog oil products on the anti-fatigue ability of mice.

[0110] Procedure: On the 28th day of the experiment, a load-bearing swimming experiment was conducted on the mice.

[0111] A lead block equivalent to 5% of the body weight was tied to the tail of the mice.

[0112] The mice were placed in a swimming tank (water temperature 25 ± 1°C), and the time from when the mice entered the water to exhaustion (sinking in the water for 10 seconds and unable to float) was recorded.

[0113] The swimming times of the mice in each group were compared to evaluate the anti-fatigue effect of American ginseng and snow frog oil products.

[0114] The effects of the products described in Table 2 on the load-bearing swimming time and weight gain

[0115]

[0116] P: Comparison between each experimental group and the negative control or experimental group 1 *: Comparison with the negative control, P < 0.05

[0117] **: Comparison with the negative control, P < 0.01 #: Comparison with experimental group 1, P < 0.05.

[0118] As shown in Table 1, after intragastric administration of different American ginseng and snow frog oil products to mice for 28 days, there were differences in the weight gain of mice in each experimental group compared with the negative control, but there was no significant difference (P>0.05). The swimming time of mice in experimental groups 1-3 was longer than that of the negative control group, and the differences were significant (P<0.05 and P<0.01). At the same time, the swimming time of experimental group 2 was also significantly longer than that of experimental group 1 (P<0.05). This indicates that the American ginseng and snow frog oil products in experimental groups 1-3 can all extend the weight-bearing swimming time of mice. That is, the American ginseng and snow frog oil products prepared by enzymatic hydrolysis with papain mutant 1 can significantly increase the anti-fatigue ability of mice, and are significantly higher than the wild-type group. The American ginseng and snow frog oil products prepared by enzymatic hydrolysis with papain mutant 2 can significantly increase the anti-fatigue ability of mice, which is basically the same as the wild-type group.

[0119] 2. Biochemical index detection

[0120] Objective: To evaluate the effect of American ginseng and snow frog oil products on fatigue-related metabolism by detecting the lactic acid content in serum.

[0121] Steps: 20 μl of blood was collected 30 min after the last administration of the test substance to the mice, and then the mice were stopped after swimming in water at 30°C without load for 10 min, and 20 μl of blood was immediately collected. After resting for 20 min, another 20 μl of blood was collected. The blood lactic acid values at the three time points were measured respectively, and the area under the blood lactic acid curve of each group was calculated according to the calculation formula of the area under the blood lactic acid curve.

[0122] Area under the blood lactic acid curve = 1 / 2×(lactic acid value before swimming + lactic acid value in blood after 0 min of swimming)×10 + 1 / 2×(lactic acid value in blood after 0 min of swimming + lactic acid value in blood after resting for 20 min after swimming)×20 = 5×(lactic acid value before swimming + 3×lactic acid value in blood after 0 min of swimming + 2×lactic acid value in blood after resting for 20 min after swimming).

[0123] The lactic acid (LA) in serum was detected using a serum lactic acid detection kit purchased from Shanghai Shuangying Biotechnology Co., Ltd.

[0124] The lactic acid content of mice in each group was compared to analyze the regulatory effect of American ginseng and snow frog oil products on fatigue metabolism.

[0125] Effect of the products described in Table 3 on the lactic acid content of mice

[0126]

[0127] P: Comparison of each experimental group with the negative control or experimental group 1 *: P<0.05 compared with the negative control

[0128] **: P<0.01 compared with the negative control ##: P<0.01 compared with experimental group 1.

[0129] As shown in Table 2, it shows that the American ginseng and snow clam oil products in Experimental Groups 1 - 3 can all reduce the accumulation of lactic acid after exercise. Further, the American ginseng and snow clam oil products prepared by enzymatic hydrolysis with papain mutant 1 can reduce the accumulation of lactic acid in mice after exercise, and are significantly higher than the wild - type group (P < 0.01). The American ginseng and snow clam oil products prepared by enzymatic hydrolysis with papain mutant 2 can significantly reduce the accumulation of lactic acid in mice after exercise, but there is no significant difference from the wild - type group. It shows that the above - mentioned American ginseng and snow clam oil products can improve exercise endurance and exercise load adaptability.

[0130] 3. Serum immunoglobulin detection

[0131] Objective: To evaluate the regulatory effect of American ginseng and snow clam oil products on the humoral immune function of mice.

[0132] Steps: Take the blood of mice after intragastric administration of American ginseng and snow clam oil products for 28 days, and separate the serum.

[0133] Use an ELISA kit to detect the content of immunoglobulins (IgG, IgM) in the serum. The kit is purchased from Shanghai Xinyu Biotechnology Co., Ltd.

[0134] Compare the immunoglobulin levels of mice in each group, and analyze the effect of American ginseng and snow clam oil products on humoral immunity.

[0135] The effect of the products described in Table 4 on the content of IgG and IgM in the serum of mice

[0136]

[0137] P: Comparison between each experimental group and the negative control or Experimental Group 1 *: Comparison with the negative control, P < 0.05

[0138] **: Comparison with the negative control, P < 0.01 ##: Comparison with Experimental Group 1, P < 0.01

[0139] #: Comparison with Experimental Group 1, P < 0.05.

[0140] As shown in Table 4, the American ginseng and snow clam oil products in Experimental Groups 1 - 3 can all enhance the immune ability of mice to a certain extent. Among them, Experimental Group 3 is particularly significant, and the contents of IgG and IgM are significantly higher than those of the negative control group or the wild - type group (P < 0.01). It shows that the above - mentioned American ginseng and snow clam oil products can significantly enhance the immune ability of the body.

[0141] The American ginseng and snow frog oil products prepared from papain mutants 1-2 have significant effects in enhancing the anti-fatigue ability and immunity of the body, and are superior to the wild-type group. This may be because the active ingredients such as essential amino acids, vitamins, minerals, fatty acids, etc. in the snow frog oil obtained by enzymatic hydrolysis of the mutants are more and more stable, thus promoting metabolism and maintaining physiological functions more significantly. It has good application value in foods or health products for moistening the lungs and strengthening the spleen, supplementing qi and nourishing blood, relieving fatigue, and enhancing immunity.

[0142] The preferred specific embodiments of the present invention have been described in detail above. It should be understood that those of ordinary skill in the art can make many modifications and variations according to the concept of the present invention without creative labor. Therefore, all technical solutions that can be obtained by those skilled in the art in the technical field of the present invention based on the concept of the present invention through logical analysis, reasoning or limited experiments on the basis of the prior art should be within the protection scope determined by the claims.

Claims

1. A preparation method of American ginseng and snow frog oil product, characterized in that, Use papain or its mutants to enzymatically hydrolyze the oil of Rana chensinensis. The sequence of wild-type papain is shown in SEQ ID NO:1, and the mutants have one or more of D80E, V149Q, or R226A relative to the wild type.

2. The method according to claim 1, wherein the enzyme mutant is D80E, V149Q, or a combination of both.

3. The method according to claim 1, wherein the enzyme mutant is D80E / V149Q.

4. The method according to claim 1, wherein the amino acid sequence of the enzyme mutant is shown in SEQ ID NO:3-5.

5. The method according to claim 1, which comprises the following steps: 1). Preparation of the oil of Rana chensinensis: S1. Accurately weigh the powder of the oil of Rana chensinensis and add an appropriate amount of pure water to soak it for 18-24h. Then homogenize it at 12000rpm for 5 times, 20s each time. Heat the homogenized oil of Rana chensinensis to boiling for 4-6h, stop heating, and obtain the primary liquid of the oil of Rana chensinensis. S2. Enzymatic hydrolysis: Add an appropriate amount of pure water to the oil of Rana chensinensis obtained in step S1, stir evenly, then add 0.1-0.5% papain (the proportion of papain accounts for 0.1-0.5% of the mass of the primary liquid of the oil of Rana chensinensis), adjust the PH to 7.5, heat to 50-55°C for enzymatic hydrolysis for 3 hours (continuously stir during enzymatic hydrolysis), boil and inactivate for 15 minutes, and filter and concentrate through a 20-50 mesh sieve to the weight of the crude drug to obtain the oil of Rana chensinensis. 2). Preparation of American ginseng extract: Take an appropriate amount of American ginseng and crush it. Mix the powder of American ginseng with an ethanol solution (usually with a concentration of 50-70%) in proportion, stir and extract at a lower temperature (usually 60-70°C) for 1-2 hours, then filter through a 20-50 mesh sieve, and concentrate to the weight of the crude drug to obtain the American ginseng extract. 3). Preparation of Chinese date extract: Take 30-100g of Chinese dates, wash them, decoct them twice with water and then filter, and concentrate to the weight of the crude drug to obtain the Chinese date extract. 4). Preparation of rock sugar syrup: Take 100-500g of rock sugar and add pure water to make syrup. 5). Product formulation: Weigh 5-10 parts of American ginseng, 5-10 parts of the oil of Rana chensinensis, 5-8 parts of Chinese dates, 5-10 parts of rock sugar, 1-2 parts of potassium sorbate in proportion, and the balance is water. All of the above are in parts by mass. Heat and decoct at 100°C, sterilize at high temperature, and then subpackage.

6. The method according to claim 5, wherein the ratio of the oil of Rana chensinensis to water in step S1 is 1-5:100-200 (W / V).

7. The method according to claim 5, wherein the amount of water added in step S2 is 70%-150% of the mass of the primary liquid of the oil of Rana chensinensis.

8. The American ginseng and oil of Rana chensinensis product prepared by the method according to any one of claims 1-7.

9. The product according to claim 8, and its specific form can be one or more of oral liquid, beverage, capsule, and food.

10. The application of the product according to claim 8 or 9 in moistening the lungs and strengthening the spleen, replenishing qi and nourishing blood, relieving fatigue, and enhancing immunity.