Application of FBXO45 inhibitors in the preparation of drugs for treating psoriasis

Abstract

This invention discloses the application of FBXO45 inhibitors in the preparation of drugs for treating psoriasis, belonging to the field of biomedical technology. This invention is the first to discover that FBXO45 is specifically and highly expressed in psoriasis patient lesions and imiquimod-induced mouse model lesions, and that skin-specific knockout of FBXO45 significantly alleviates psoriasis phenotypes (such as epidermal thickening, inflammatory factor expression, and immune cell infiltration), confirming that FBXO45 is a potential therapeutic target for psoriasis. Through virtual screening and molecular docking based on the FBXO45 protein structure, it was found that CD437 specifically binds to FBXO45 and inhibits its substrate recognition function. In vitro experiments show that CD437 can inhibit the expression level of FBXO45 protein in HaCaT cells, reduce the expression of inflammatory factors such as TNF-α, and induce apoptosis; in an imiquimod-induced mouse model, topical application of CD437 significantly alleviated skin lesion symptoms (such as reducing PASI scores and epidermal thickness). Therefore, this invention provides a novel small-molecule therapeutic strategy targeting FBXO45 for psoriasis.

Description

Technical Field

[0001] This invention belongs to the field of pharmaceutical technology, specifically relating to the application of FBXO45 inhibitors in the preparation of drugs for treating psoriasis. Background Technology

[0002] Psoriasis is a chronic inflammatory disease mediated by the immune system, with a prevalence of 2% to 3%. It is a complex disease involving genetic, environmental, and immune factors. On the one hand, psoriasis damages the health of patients, with a significantly increased chance of co-existing autoimmune diseases, mental illnesses, and metabolic syndromes; it also damages the patient's appearance, severely affecting their normal social activities and causing a heavy psychological burden. On the other hand, psoriasis is highly prone to relapse and is considered a stubborn skin disease that endangers human health.

[0003] The pathological features of psoriasis mainly include abnormal keratinocyte proliferation, reduced differentiation and apoptosis, and chronic inflammatory infiltration. Its core pathological mechanism involves excessive activation of the interleukin-23 (IL-23) / T helper 17 cell (Th17) axis, leading to the release of pro-inflammatory factors such as IL-17 and tumor necrosis factor-alpha (TNF-α), resulting in epidermal thickening, angiogenesis, and immune microenvironment dysregulation. Although existing treatments (such as corticosteroids and biologics) can alleviate symptoms, many challenges remain: topical treatments have side effects such as skin atrophy; traditional systemic drugs carry risks of hepatotoxicity and nephrotoxicity; and the high cost, drug resistance, and potential infection risks of biologics limit their long-term application. Furthermore, existing therapies are insufficiently effective for some refractory patients, and individualized treatment strategies are still incomplete. Therefore, developing safer, more effective, and more economically accessible novel targeted drugs remains an unmet clinical need.

[0004] FBXO45 is a member of the FBXO family, a highly conserved F-box protein characterized by an F-box domain of approximately 40 amino acids. It is also a component of E3 ubiquitination ligases, and its classic function is to ubiquitinate substrate proteins, enabling their degradation via the proteasome. In addition, FBXO45 may also function as a scaffold protein, independent of E3 ubiquitination enzymes. Studies have found that high expression of FBXO45 may be associated with poor prognosis in certain tumors, such as liver cancer, pancreatic cancer, esophageal cancer, and non-small cell lung cancer, but there are no reports of a direct association between FBXO45 and psoriasis.

[0005] CD437 was initially identified as a selective retinoic acid receptor gamma (RARγ) agonist, belonging to the retinol-like compound family, with the structure shown in Formula I. Early research primarily focused on its ability to regulate cell differentiation and proliferation through a RARγ-dependent pathway, particularly its potential therapeutic role in tumors. Currently, there are no reports of CD437 being associated with psoriasis.

[0006] Summary of the Invention

[0007] In order to overcome the shortcomings of the prior art, the purpose of this invention is to provide the application of FBXO45 inhibitors in the preparation of drugs for treating psoriasis, so as to solve the technical problems of high cost, large side effects and easy drug resistance in existing treatments for psoriasis.

[0008] To achieve the above objectives, the present invention employs the following technical solution:

[0009] The first aspect of the present invention discloses the use of FBXO45 inhibitors in the preparation of drugs for the prevention and treatment of psoriasis.

[0010] Preferably, the FBXO45 inhibitor is a small molecule chemical inhibitor or siRNA targeting FBXO45.

[0011] More preferably, the small molecule chemical inhibitor is CD437 or a pharmaceutical composition of a pharmaceutically acceptable salt thereof.

[0012] More preferably, the dosage of CD437 is 10 mg / kg.

[0013] Preferably, the siRNA is siRNA-1 or siRNA-2; the nucleotide sequence of siRNA-1 is shown in SEQ ID NO.38 and SEQ ID NO.39, and the nucleotide sequence of siRNA-2 is shown in SEQ ID NO.40 and SEQ ID NO.41.

[0014] More preferably, the siRNA dosage is 2.5 nmol / 25g.

[0015] Preferably, the drug is a drug that reduces the expression of psoriasis-related inflammatory factors.

[0016] More preferably, the psoriasis-associated inflammatory factor is TNF-α.

[0017] Preferably, the drug is a drug that promotes apoptosis.

[0018] Preferably, the drug is a drug that can reduce the proportion of cells in the S phase.

[0019] In a second aspect, the present invention discloses a psoriasis prevention and treatment drug, comprising CD437 and pharmaceutical excipients, wherein the drug is in the form of a cream or a gel.

[0020] Preferably, the pharmaceutical excipient is selected from any one or more of fructose, lactose, ribose, arabinose, glucose, mannitol, xylitol, sorbitol, small molecule dextran, calcium gluconate, potassium phosphate, amino acids, and sodium chloride.

[0021] A third aspect of the invention discloses a psoriasis prevention and treatment composition comprising CD437 and other drugs for treating psoriasis.

[0022] Preferably, the dosage form of the drug is a cream or a gel.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] The application of the FBXO45 inhibitor provided by this invention in the preparation of drugs for treating psoriasis reveals for the first time that FBXO45 can serve as a key target for psoriasis treatment, and verifies that its gene knockout or targeted inhibition has a mitigating effect on the psoriasis phenotype. Specifically: FBXO45 high expression in psoriatic lesions was confirmed through clinical samples and imiquimod (IMQ)-induced animal models; conditional Fbxo45 knockout mice were used to demonstrate that FBXO45 deficiency can alleviate the psoriasis phenotype (such as reducing epidermal thickness, reducing Psoriasis Area and Severity Index (PASI) scores, and reducing the expression levels of inflammatory factors such as IL-17, IL-23, and TNF-α); and HaCaT cell models were used to demonstrate that FBXO45 knockdown can inhibit cell proliferation, inhibit the activity of NF-κB and JAK / STAT3 signaling pathways, and reduce the expression of inflammatory factors (TNF-α, IL1B, CXCL8, and IL23A, etc.). Therefore, FBXO45 inhibitors have the potential for use in the treatment of psoriasis.

[0025] Furthermore, through molecular docking and virtual screening, a novel target of CD437, FBXO45 (independent of its traditional target RARγ), was discovered. CD437 can alleviate the pathological phenotype of psoriasis by inhibiting FBXO45 protein. The alleviating effect of CD437 on the psoriasis phenotype was experimentally verified: using a HaCaT cell model, it was demonstrated that CD437 can reduce FBXO45 protein levels; using a HaCaT cell model, it was demonstrated that CD437 can inhibit the expression of the psoriasis inflammatory factor TNF-α (TNF-α decreased by ≥50%), promote apoptosis, and inhibit the cell cycle; using an IMQ-induced mouse psoriasis model, it was demonstrated that CD437 can alleviate the psoriasis phenotype. In vivo IMQ psoriasis model experiments demonstrated that topical application of CD437 (containing CD437 or pharmaceutically acceptable salts thereof) at concentrations of 0.1–10 mg / mL, 1–2 times daily, can improve the psoriasis phenotype, reduce PASI scores, and has no significant skin irritation side effects. Therefore, CD437 can be used as an FBXO45 inhibitor for the treatment of psoriasis, thus broadening the clinical application scenarios of this molecule and its derivatives. Attached Figure Description

[0026] Figure 1 Figure 1 shows the correlation between FBXO45 expression levels and psoriasis based on bioinformatics analysis. A: Comparison of FBXO45 transcriptional expression levels in lesion and non-lesion areas of patients who did not receive aggressive psoriasis treatment (NN: normal skin tissue; PN: unaffected skin tissue adjacent to lesions; PP: lesion tissue); B: Comparison of FBXO45 expression levels in lesion and non-lesion areas of psoriasis patients before and after treatment (PN: unaffected skin tissue adjacent to lesions; PP: lesion tissue).

[0027] Figure 2 Immunohistochemical staining results of FBXO45 on normal skin (Vehicle) and psoriatic lesions (IMQ) in normal individuals, psoriasis patients, and an IMQ-induced psoriasis mouse model; where A: human tissue, B: mouse tissue.

[0028] Figure 3 Figure 1: Effect of FBXO45 epidermal-specific knockout on the phenotype of an IMQ-induced mouse psoriasis model; A: Experimental flowchart; B: Phenotypic appearance of mouse dorsal skin before and after IMQ modeling; C: PASI score; D: Epidermal thickness statistics; E: Hematoxylin and eosin (H&E) staining, and immunohistochemical staining of Fbxo45 and Ki67 in dorsal skin lesions; F: Expression levels of inflammatory factors in dorsal skin lesions.

[0029] Figure 4 Figure 1: Effects of FBXO45 knockdown on the in vitro proliferation of HaCaT cells, inflammatory signaling pathways, and expression levels of psoriasis-related inflammatory factors; A: In vitro proliferation experiments of HaCaT cells after FBXO45 knockdown (top) and knockout (bottom), KO#1 represents #1 FBXO45 sgRNA knockout, KO#2 represents #2 FBXO45 sgRNA knockout; B: Western blot analysis of the expression of JAK / STAT signaling pathway, NF-κB signaling pathway, and cell cycle-related proteins after FBXO45 knockdown; C: qRT-PCR analysis of changes in the expression of psoriasis-related factors after FBXO45 knockdown or knockout.

[0030] Figure 5 : Molecular docking results of FBXO45 and the small molecule drug CD437; where blue represents the SPRY domain of the FBXO45 protein and yellow represents the CD437 molecule;

[0031] Figure 6 : Western blot analysis of FBXO45 expression level in HaCaT cells after CD437 treatment; β-Tublin was used as an internal control.

[0032] Figure 7 Figure: Results of TNF-α expression level detection after CD437 treatment of HaCaT cells;

[0033] Figure 8 Figure 1: Apoptosis detection results of HaCaT cells after CD437 treatment; A: Control group, B: 10μM CD437 treatment, C: 20μM CD437 treatment, D: Result statistics;

[0034] Figure 9 : Cell cycle detection results after CD437 treatment of HaCaT cells; A: Control group, B: 10μM CD437 treatment, C: 20μM CD437 treatment, D: Result statistics;

[0035] Figure 10 Figure showing the alleviating effect of CD437 on IMQ-induced psoriasis phenotype in mice;

[0036] Figure 11 H&E staining of skin lesions on the back of mice after CD437 treatment. Detailed Implementation

[0037] To enable those skilled in the art to understand the features and effects of the present invention, the following descriptions and definitions are only general descriptions of the terms and expressions mentioned in the specification and claims. Unless otherwise specified, all technical and scientific terms used herein have the ordinary meaning understood by those skilled in the art regarding the present invention, and in the event of any conflict, the definitions in this specification shall prevail.

[0038] In this paper, we use the open-source GEO database (https: / / www.ncbi.nlm.nih.gov / geo / ) for bioinformatics analysis.

[0039] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Furthermore, it should be understood that after reading this description, those skilled in the art can make various alterations or modifications to the invention, and these equivalent forms also fall within the scope defined by the appended claims.

[0040] The following examples use instruments and equipment conventional in the art. Experimental methods in the following examples, unless otherwise specified, are generally performed under standard conditions or as recommended by the manufacturer. All raw materials used in the following examples are conventional commercially available products with specifications in the art, unless otherwise stated.

[0041] Example 1: Investigating the correlation between FBXO45 and psoriasis

[0042] I. Bioinformatics Analysis

[0043] Data sets related to psoriasis were downloaded from the Gene Expression Omnibus (GEO) database. GSE13355 collected biopsy samples from 58 psoriasis patients and 64 healthy controls, and performed microarray analysis. GSE30999 collected skin biopsy samples (n=170) from 85 patients with moderate to severe psoriasis, and performed microarray analysis on them.

[0044] Analysis results as follows Figure 1 As shown in Figure A, the expression level of FBXO45 was higher in lesion sites that did not receive aggressive psoriasis treatment compared with matched non-lesion sites (P < 0.0001).

[0045] GSE201827 contains gene expression profiles of psoriatic lesions and adjacent normal skin in 29 psoriasis patients before and after treatment with the IL17 antibody Secukinumab, and RNA-seq analysis of FBXO45 expression was performed.

[0046] Analysis results as follows Figure 1As shown in Figure B, before treatment with the IL17 antibody Secukinumab, the expression of FBXO45 in the lesion area of ​​psoriasis patients was higher than that in the non-lesion area. After treatment, the expression of FBXO45 in the lesion area was downregulated compared with that before treatment (P < 0.0001).

[0047] The above bioinformatics analysis showed that FBXO45 was highly expressed in the skin lesions of psoriasis patients, and that the expression level of FBXO45 in the skin lesions was downregulated after treatment compared with that before treatment. FBXO45 is highly correlated with psoriasis.

[0048] II. Immunohistochemical staining

[0049] Skin paraffin blocks from patients with psoriasis diagnosed clinically and histopathologically at the Second Affiliated Hospital of Xi'an Jiaotong University, as well as paraffin blocks from normal skin tissue, were collected as specimens for FBXO45 immunohistochemical staining.

[0050] 1. Dewaxing paraffin sections to water: Immerse the sections in xylene I for 20 min, xylene II for 20 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, and 75% ethanol for 5 min, then wash with water;

[0051] 2. Antigen retrieval: Tissue slides were placed in an autoclave filled with citric acid (pH 6.0) antigen retrieval solution for antigen retrieval. The autoclave was timed for 2.5 min. After natural cooling, the slides were placed in PBS (pH 7.4) and washed three times on a decolorizing shaker for 5 min each time.

[0052] 3. Blocking endogenous peroxidase: Place the slides in 0.3% methanol hydrogen peroxide solution and incubate at room temperature in the dark for 20 min. Then, place the slides in PBS (pH 7.4) and wash them three times on a decolorizing shaker for 5 min each time.

[0053] 4. BSA or serum blocking: After slightly drying the slide, draw a circle around the tissue with a histochemical pen (to prevent antibody from flowing away), add 5% BSA to the circle, and block at room temperature for 1 hour.

[0054] 5. Add primary antibody: Gently shake off the blocking solution, add the prepared primary antibody in a certain ratio to the slide, and incubate the slide flat in a humidified chamber at 4°C overnight (add a small amount of water to the humidified chamber to prevent antibody evaporation);

[0055] 6. Add secondary antibody: Place the slide in PBS (pH 7.4) and wash three times on a decolorizing shaker for 8 min each time; after slightly drying the slide, add biotin-conjugated secondary antibody to the circle, cover the tissue, and incubate at room temperature for 50 min; then place the slide in PBS (pH 7.4) and wash three times on a decolorizing shaker for 8 min each time; after slightly drying the slide, add HRP-labeled streptavidin triple antibody to the circle, cover the tissue, and incubate at room temperature for 50 min; then place the slide in PBS (pH 7.4) and wash three times on a decolorizing shaker for 8 min each time.

[0056] 7. DAB staining: Place the slide in PBS (pH 7.4) and wash it three times on a decolorizing shaker for 5 minutes each time; after slightly drying the slide, add freshly prepared DAB staining solution to the circle, control the staining time under a microscope, the positive color is brownish-yellow, and rinse the slide with tap water to stop the staining.

[0057] 8. Counterstaining cell nuclei: Harris hematoxylin counterstain for about 3 minutes, wash with tap water, differentiate with 1% hydrochloric acid alcohol for a few seconds, rinse with tap water, and return to blue with running water;

[0058] 9. Dehydration and mounting: Immerse the sections in 75% alcohol for 6 min, 85% alcohol for 6 min, anhydrous ethanol I for 6 min, anhydrous ethanol II for 6 min, xylene I for 7 min, and xylene II for 7 min in sequence to dehydrate and clear the sections. Remove the sections from the xylene and let them dry slightly before mounting with neutral resin.

[0059] 10. Microscopic examination, image acquisition and analysis.

[0060] Staining results as follows Figure 2 As shown in Figure A, the results indicate that in normal human skin tissue, FBXO45 is expressed in small amounts only in the basal layer cells of the epidermis and dermal immune cells, while in psoriatic lesions, FBXO45 is expressed in large quantities throughout the epidermis and infiltrating immune cells.

[0061] From IMQ-induced psoriasis mice (8-week-old female C57 mice, 5 mice in each of the control and IMQ groups, with 2cm×3cm of hair removed from the back; blank matrix was applied to the control group, and IMQ 62.5mg / mouse was applied to the IMQ group, evenly applied to the back and gently massaged for absorption), normal skin and psoriatic lesions were taken for FBXO45 immunohistochemical staining.

[0062] Immunohistochemical staining results as follows Figure 2 As shown in Figure B, the results indicate that the expression level of FBXO45 in the skin lesions of the IMQ psoriasis mouse model was significantly higher than that in normal tissues, and it was mainly expressed in the epidermal layer.

[0063] These results suggest that high expression levels of FBXO45 in the epidermal layer of the skin may be closely related to the occurrence of psoriasis.

[0064] Example 2: Investigating the relationship between FBXO45 knockout mice and psoriasis

[0065] I. Construction of a skin-specific FBXO45 knockout animal model

[0066] C57BL / 6J-Fbxo45 em1(flox)Cya Mice were purchased from Cyagen (Suzhou) Biotechnology Co., Ltd., and a mouse genotyping kit was also provided. The Mouse Direct PCR Kit (for Genotyping) was purchased from Genotyping Inc., catalog number TSE014.

[0067] 1. Breed a sufficient number of FBXO45 fl / fl,K14-Cre Mice and FBXO45 fl / fl Mice. Step 1: Pair (flox / +) heterozygous mice to obtain (flox / flox) homozygous mice. Step 2: Pair systemic or tissue-specific Cre tool mice with (flox / +) heterozygous mice or (flox / flox) homozygous mice to obtain [flox / +, Cre(+ / -)] mice. Step 3: Pair [flox / +, Cre(+ / -)] mice with (flox / +) or (flox / flox) mice to obtain [flox / flox, Cre(+ / -)] mice.

[0068] 2. Identification of mice bred in step 1. The steps are as follows: ① Obtain mouse genomic DNA. Cut off the tail or toes of the mice and place them in sterile 1.5 mL Eppendorf tubes. Add the tissue lysis buffer shown in Table 1 to each Eppendorf tube containing the sample, incubate at 55℃ for 30 min, and then heat at 98℃ for 3 min. After thoroughly mixing the lysate, centrifuge at 12000 rpm / min for 5 min in a refrigerated centrifuge at 4℃. Use the supernatant as a template for direct PCR amplification. ② Identify the mouse genotype. (flox / flox) homozygous mice: (flox / +) heterozygous mice were mated to obtain (flox / flox) homozygous mice, which were then subjected to PCR amplification. The primers are shown in SEQ ID NO.1 and SEQ ID NO.2 in Table 2. The PCR amplification system and program are shown in Tables 3 and 4, respectively. The amplified PCR products were run on 1% DNA agarose gel electrophoresis at 130V for 20 min. The band size was observed under ultraviolet light. The PCR results are interpreted as shown in Table 5. [flox / +,Cre(+ / -)] mice: [flox / +,Cre(+ / -)] mice were obtained by mating tissue-specific K14Cre tool mice with flox / flox homozygous mice. PCR amplification was then performed using primers shown in Table 2 (SEQ ID NO. 3 and SEQ ID NO. 4). The PCR amplification system and program are shown in Tables 6 and 7, respectively. The amplified PCR products were run on 1% DNA agarose gel at 130V for 20 min, and the band size was observed under UV light. The PCR results are interpreted as shown in Table 8. [flox / flox,Cre(+ / -)] mice: [flox / flox,Cre(+ / -)] mice were obtained by mating flox / +,Cre(+ / -) mice with flox / flox mice. After obtaining DNA from mouse tails, the (flox / flox,cre) genotype was determined using F1 / R1 and K14-Cre specific primers. Cre was then induced into the nucleus using Tamoxifen. Skin tissue was then collected, and the deletion effect was assessed using F1 / R2. Simultaneously, mouse propagation was carried out. Primers are shown in SEQ ID NO.1 and SEQ ID NO.5 in Table 2. The PCR amplification system and procedure are shown in Table 4. The amplified PCR products were run on a 1% DNA agarose gel at 130V for 20 minutes. Band size was observed under UV light. The PCR results are interpreted as shown in Table 9.

[0069] Table 1 Tissue lysis fluid

[0070] Components Required for a single sample DNA release 4μL Lysis Buffer 200μL

[0071] Table 2 Sequence List

[0072] Primer name Primer sequence 5'-3' Serial Number F1 CCCTTGTTCATTGTAACCTGGCTT SEQ ID NO.1 R1 TATTTGGCAACTAAACCCCATCTCT SEQ ID NO.2 K14Cre-F CGATGGGAAAGTGTAGCCTGCA SEQ ID NO.3 K14Cre-R TCCAGGTATGCTCAGAAAACGCC SEQ ID NO.4 R2 TGCATTTGTTGTGATAAGGTGAGC SEQ ID NO.5 TNF-α(human)-F TCCTTCAGACACCCTCAACC SEQ ID NO.6 TNF-α(human)-R AGGCCCCAGTTTGAATTCTT SEQ ID NO.7 GAPDH(human)-F CTCCTCCACCTTTGACGCTG SEQ ID NO.8 GAPDH(human)-R TCCTCTTGTGCTCTTGCTGG SEQ ID NO.9

[0073] Table 3 PCR amplification system (50 μL)

[0074] reagent components Sample volume (μL) Gold Mix (Green) 25 F1 (10μM) 0.75 R1 (10μM) 0.75 Mouse DNA 1.0

[0075] Table 4 Gene PCR Amplification Procedure

[0076]

[0077]

[0078] Table 5 Interpretation of PCR Results

[0079] genotype Band size flox / flox 337bp flox / + 337bp and 267bp WT 267bp

[0080] Table 6. PCR amplification system (50 μL)

[0081] reagent components Sample volume (μL) Gold Mix (Green) 25 K14Cre-F (10μM) 0.75 K14Cre-R (10μM) 0.75 Mouse DNA 1.0

[0082] Table 7 Gene PCR Amplification Procedure

[0083]

[0084] Table 8 Interpretation of PCR Results

[0085] genotype Band size K14-Cre 449bp - No strip

[0086] Table 9 Interpretation of PCR Results

[0087] genotype Band size FBXO45 skin-specific deletion 255bp

[0088] II. Psoriasis Modeling

[0089] 1. Dissolve tamoxifen in corn oil to obtain a tamoxifen solution with a concentration of 12.5 mg / mL.

[0090] 2. Take approximately 6W of FBXO45 floxfl / fl，K14-Cre and FBXO45 fl / fl After grouping, the mice were weighed and the dosage was calculated. Each group of mice was injected with tamoxifen for 9 consecutive days at the same time every day. The dosage of tamoxifen was 50 mg / kg.

[0091] 3. After a one-week rest period, the mice in each group were carefully shaved in the central area of ​​their backs using a pet-specific electric epilator, creating a 2cm x 3cm exposed area. A mild depilatory cream was then used to remove the surface vellus hair. 5% IMQ cream (62.5mg per 2cm x 3cm area) was applied to the backs of the mice continuously for 7 days. The control group mice had petroleum jelly applied to their backs. The experimental flowchart is shown below. Figure 3 As shown in Figure A.

[0092] 4. On the eighth day, mice were euthanized by cervical dislocation, and skin tissue from the backs of mice in each group was collected and photographed.

[0093] Results of psoriasis modeling in FBXO45 epidermal-specific knockout mice and psoriasis modeling in non-knockout mice are as follows: Figure 3 As shown in Figure B, the results indicate that epidermal-specific knockout of FBXO45 alleviates the psoriasis phenotype in IMQ mice.

[0094] 5. The PASI score for psoriasis was performed on mice in each group daily. The PASI score is as follows: Figure 3 As shown in Figure C, the results indicate that FBXO45 epidermal-specific knockout mice had significantly lower PASI scores after psoriasis modeling compared to non-knockout mice.

[0095] 6. Take the back skin of each group of mice, fix it in paraformaldehyde, embed it in paraffin, and then section it for immunohistochemistry and H&E staining. Measure the thickness of the mouse back skin, extract RNA from the mouse back, and detect the expression of inflammatory factors in the back skin.

[0096] III. Paraffin Embedding and Sectioning

[0097] 1. Tissue Collection: Fresh mouse skin tissue was fixed in 4% paraformaldehyde for more than 24 hours. The tissue was removed from the fixative and trimmed in a fume hood using a scalpel. The trimmed tissue and corresponding labels were placed in a dehydration box.

[0098] 2. Dehydration: Place the dehydration box into the basket and dehydrate it in the dehydrator by sequentially applying alcohol in the following order: 75% alcohol for 1 hour, 85% alcohol for 1 hour, 95% alcohol for 1 hour, 95% alcohol for 1 hour, anhydrous ethanol I for 1 hour, anhydrous ethanol II for 1 hour, xylene I for 1 hour, xylene II for 1 hour, wax I for 1 hour, and wax II for 1 hour.

[0099] 3. Embedding: The paraffin-impregnated tissue is embedded in an embedding machine. First, the molten wax is placed into the embedding frame. Before the wax solidifies, the tissue is removed from the dehydration box and placed into the embedding frame according to the requirements of the embedding surface. It is then cooled on a -20℃ freezing stage. After the wax solidifies, the wax block is removed from the embedding frame and trimmed.

[0100] 4. Sectioning: Use a paraffin microtome to cut thin sections with a thickness of 4μm, and spread the sections flat on warm water.

[0101] 5. Take the tissue section off the glass slide, dry it in an oven with water-based wax, and then store it.

[0102] IV. H&E staining

[0103] 1. Dewaxing paraffin sections to water: Place the sections in xylene I for 8 min, xylene II for 8 min, anhydrous ethanol I for 6 min, anhydrous ethanol II for 6 min, 95% ethanol for 6 min, 85% ethanol for 6 min, and 75% ethanol for 5 min in sequence, and then rinse with running water.

[0104] 2. Hematoxylin staining of cell nuclei: Slices are stained with Harris hematoxylin for 3-8 minutes, washed with tap water, then differentiated with 1% hydrochloric acid alcohol for a few seconds, rinsed with tap water, and the blue color is restored by running water.

[0105] 3. Eosin staining of cytoplasm: Immerse the sections in eosin staining solution for 1-3 minutes.

[0106] 4. Dehydration and mounting: Immerse the sections in 75% alcohol for 30 seconds, 85% alcohol for 30 seconds, 95% alcohol for 1 minute, 95% alcohol II for 2 minutes, anhydrous ethanol I for 5 minutes, anhydrous ethanol II for 5 minutes, xylene I for 5 minutes, and xylene II for 7 minutes to dehydrate and clear the sections. Remove the sections from the xylene and let them air dry slightly before mounting them with neutral resin.

[0107] 5. Microscopic examination, image acquisition and analysis.

[0108] The thickness of the mouse dorsal skin was measured using software after H&E staining. Results are as follows: Figure 3 As shown in Figure D, the skin of FBXO45 epidermal-specific knockout mice was significantly thinner. After the psoriasis model was established, the skin on the back of FBXO45 epidermal-specific knockout mice was also significantly thinner than that of the non-knockout group.

[0109] H&E staining and immunohistochemical staining, such as Figure 3 As shown in Figure E, compared with wild-type mice, FBXO45 knockout mice exhibited reduced epidermal thickness. Following IMQ psoriasis modeling, FBXO45 knockout mice showed significant remission of the psoriasis pathological phenotype compared to control mice, with decreased PASI scores, reduced scaling, thinner skin, weakened epidermal cell proliferation (reduced Ki67 signaling), and reduced inflammatory cell infiltration.

[0110] V. Extraction of total RNA from tissues

[0111] RNase-free centrifuge tubes and pipette tips were used throughout the experiment. Mouse back skin was collected in 1.5 mL Eppendorf tubes, and 1 mL of Trizol was added. After adding grinding beads, the tissue was ground using a tissue homogenizer until homogeneous. 200 μL of pre-chilled chloroform was added to each tube, vortexed for 15 seconds, and allowed to stand at room temperature for 3 minutes to allow for clear separation. The tubes were then centrifuged at 4°C and 12000 rpm for 15 minutes. 400 μL of the supernatant was slowly aspirated into a new Eppendorf tube, and 500 μL of pre-chilled isopropanol was added. The tube was inverted 60 times to ensure thorough mixing, and allowed to stand at room temperature for 20 minutes. The tubes were then centrifuged at 4°C and 12000 rpm for 10 minutes. Then discard the supernatant. A white RNA precipitate will be visible at the bottom of the tube. Add 800 μL of pre-chilled 75% ethanol and invert the tube 60 times to allow the white precipitate to float. Centrifuge at 4°C, 12000 rpm / min for 10 min. Finally, discard the supernatant again and allow the white RNA precipitate to cool until translucent. Add 30 μL of DEPC water to ice to dissolve the RNA. Measure the RNA concentration using a NanoDrop microspectrophotometer. Store the extracted RNA sample at -80°C.

[0112] VI. Reverse transcription of cDNA

[0113] Referring to Table 10, 1 μg of extracted RNA sample was used to perform reverse transcription to synthesize cDNA using a cDNA synthesis kit. After mixing the reaction solution, the sample was briefly centrifuged. The PCR tube was then placed in a PCR instrument, and the reaction was carried out according to Table 11. After the reaction was completed, the cDNA sample was stored at -20℃ for later use.

[0114] Table 10. Reverse transcription synthesis of cDNA (20 μL reaction system)

[0115] reagent components Volume / Total RNA 1μg 5×iScript RT Supermix 4μL Nuclease-free water <![CDATA[16μL-V RNA ]]>

[0116] Table 11 Reverse Transcription Procedure

[0117] reaction temperature Duration 37℃ 15min 85℃ 5s 4℃ keep

[0118] VII. RT-qPCR

[0119] Specific qPCR primers (sequences shown in Table 12) were designed and synthesized by Qingke Company. RT-qPCR reaction components were added according to Table 13. After thorough mixing, the reaction solution was briefly centrifuged and placed in a real-time quantitative PCR instrument for reaction. 2... - The ΔΔCt method is used to process data.

[0120] Table 12 qPCR primer sequences

[0121]

[0122] Table 13 RT-qPCR reaction system (10 μL / well)

[0123]

[0124]

[0125] qRT-PCR results are as follows Figure 3 As shown in Figure F, the results indicated that the transcriptional expression levels of psoriasis-related inflammatory factors (TNF-α, IL-17, IL-1β, IL-6, IL-23, IL-22, etc.) in the skin lesions of FBXO45 knockout mice were significantly lower than those in the control group. These results suggest that FBXO45 plays an important role in the pathogenesis and development of psoriasis.

[0126] Example 3: Effects of FBXO45 knockdown / knockout on the in vitro proliferation capacity of keratinocytes, inflammatory signaling pathways, and expression of psoriasis-related inflammatory factors.

[0127] I. Cell resuscitation

[0128] First, irradiate the clean bench with UV light for 30 minutes, and preheat the prepared 1640 complete culture medium to 37°C in a water bath. Then, rapidly rewarm the HaCaT cells (immortalized human keratinocyte cell line HaCaT, long-term stored in our laboratory's liquid nitrogen tank) taken from the liquid nitrogen tank in a 37°C water bath. Next, pipette the HaCaT cells into a 15mL centrifuge tube, add 4mL of 1640 complete culture medium, and mix thoroughly by pipetting. After preparation, centrifuge at 2000rpm for 4 minutes at room temperature, discard the supernatant, and thoroughly re-mix the HaCaT cell pellet with 10mL of 1640 complete culture medium. Transfer the suspension to a 10cm sterile culture dish and mix by shaking. Finally, place the culture dish in a cell culture incubator containing 5% CO2 at 37°C for further culture, changing the cell culture medium every other day.

[0129] II. Cell Passaging

[0130] When the HaCaT cell density reaches 80%–90%, passage the cells. Discard the old culture medium, wash once with sterile PBS, then add 3 mL of trypsin and incubate in a cell culture incubator for about 6 minutes. After observing under a microscope that the cells become rounded and their adhesion weakens, stop digestion with 2 mL of 1640 complete culture medium. Pipette the HaCaT cells and transfer them to sterile 15 mL centrifuge tubes. Balance the mixture and centrifuge at 2000 rpm at room temperature for 4 minutes. Discard the supernatant and thoroughly remix the cell pellet with 5 mL of 1640 complete culture medium. Transfer a certain volume of the suspension to a new 10 cm dish and add 1640 complete culture medium to a final volume of 10 mL. Gently shake the dish using a cross-shaped motion to distribute the HaCaT cells evenly, then incubate in a cell culture incubator.

[0131] III. Cell Plating

[0132] Count the digested HaCaT cells and seed each well of a six-well plate according to the required number of cells for the experiment, adding 2 mL of complete culture medium to each well. Shake the six-well plate using the cross-hatching method to mix thoroughly, then place it in a cell culture incubator for incubation.

[0133] IV. Cell cryopreservation

[0134] When the cell density in a 10cm dish reaches 80%–90% under a microscope, proceed with cell cryopreservation. Discard the old culture medium and wash once with PBS. Add 3mL of trypsin and incubate in a cell culture incubator for approximately 6 minutes. Once the cells become rounded and their adhesion weakens under a microscope, terminate the digestion with 2mL of 1640 complete culture medium. Pipette the cells and transfer them to sterile 15mL centrifuge tubes. Balance the mixture and centrifuge at 2000rpm for 4 minutes at room temperature. Discard the supernatant and thoroughly remix the cell pellet with 4mL of 1640 complete culture medium. Add 900μL of the suspension and 100μL of DMSO to each cryopreservation tube, then place the cryopreservation tubes in a cryopreservation box at -80℃ and freeze overnight. The following day, transfer them to a liquid nitrogen tank for storage.

[0135] V. Knock down / remove FBXO45

[0136] (1) siRNA knockdown of endogenous FBXO45

[0137] Three siRNAs were ordered from Gemma Gene Company (including siRNA-1 and siRNA-2 in Table 14, with sequences shown in SEQ ID NO.38 to SEQ ID NO.41, and a negative control siRNA with sequences shown in SEQ ID NO.42 and SEQ ID NO.43). The siRNAs in dry powder form were stored at -80°C.

[0138] Centrifuge each group of siRNAs at 12000 rpm / min for 5 min at room temperature. Add 62.5 μL LEPC water to each tube to prepare a 20 μM solution. Aliquot the solution into 1.5 mL Ep tubes and store at -80℃.

[0139] Table 14 List of siRNAs used to knock down FBXO45

[0140]

[0141] HaCaT cells were cultured in six-well plates, with 1.5 × 10⁶ cells per well. 5 Cells were seeded in 6 wells and transfected after cell adhesion. Two groups were set up: a Ctrl group transfected with negative control siRNA and an experimental group transfected with either of the two siRNAs mentioned above, each with three wells, used for protein and RNA extraction respectively. In each group, 13 μL of Opti-MEM medium and 2 μL of RNAiMAX Transfection Reagent (the volume for one well) were mixed in a 1.5 mL Eppendorf tube and incubated at room temperature for 5 min. In another 1.5 mL Eppendorf tube, 184 μL of Opti-MEM medium and 1.25 μL of siRNA (20 μM) were mixed. The contents of the two 1.5 mL Eppendorf tubes were then combined and incubated at room temperature for 20 min. The medium in the six-well plate was replaced with 200 μL per well, evenly added to the corresponding wells. The cells in the six-well plate were then placed in a cell culture incubator and cultured for 72 h. Protein samples were extracted, and the expression level of FBXO45 was detected by Western blot. RNA samples were collected and their FBXO45 expression level was detected by qRT-PCR to determine the knockout efficiency.

[0142] Test results as follows Figure 4 China B and Figure 4 As shown in Figure C, after knocking down FBXO45 in HaCaT with specific FBXO45 siRNA, both the mRNA and protein levels of FBXO45 decreased significantly.

[0143] (2) sgRNA knockout of endogenous FBXO45

[0144] 1) Design sgRNA for FBXO45 according to Table 15.

[0145] Table 15 List of sgRNAs used to knock out FBXO45

[0146]

[0147] 2) The lentiCRISPRV2 plasmid was digested with BsmBI enzyme overnight at 55°C.

[0148] 3) Use a DNA purification and recovery kit to recover the enzyme digestion products.

[0149] 4) sgRNA annealing. 95℃ for 2 min, 75℃ for 2 min, 55℃ for 2 min, 25℃ for 2 min.

[0150] 5) The annealed sgRNA is ligated with the enzyme-digested lentiCRISPRV2.

[0151] 6) Transform the ligation product into Stbl3 competent cells. Add 10 μL of the ligation product to 100 μL of Stbl3 competent cells and incubate on ice for 30 min. Heat shock at 42℃ for 45 s, incubate on ice for 2 min, add 1 mL of antibiotic-free LB, and incubate at 37℃ with shaking at 750 rpm for 1 h. Spread the mixture onto an Amp LB culture plate and invert it in a 37℃ incubator overnight.

[0152] 7) Single clone sequencing ligation successful.

[0153] 8) Transfect 3 μg LentiCRISPR-FBXO45, 3 μg plpVSVG, and psPAX2 plasmids into 293FT cells. Change the medium 24 h after transfection, and collect the supernatant virus 48 h after changing the medium.

[0154] 9) Infect HaCaT cells with the virus, and then screen the cells with Amp to obtain stable HaCaT cells with FBXO45 knocked out.

[0155] VI. CCK8 assay for cell proliferation

[0156] 1) Cell preparation

[0157] In a 96-well plate, seed 2000 cells / 100 μL per well, and add 200 μL of PBS to each well around the cells to prevent culture medium evaporation. Then return the 96-well plate to the incubator for further culture.

[0158] 2) Detection: After the cells have adhered to the plate for 24 hours, absorbance measurement will begin. Detection will be performed at the same time every day for a total of 5-6 days. Detection will be stopped when all cells in the 96-well plate have grown to full confluence.

[0159] (1) Remove the culture medium from the wells to be tested, and add 90 μL of cell culture medium and 10 μL of CCK8 solution to each well.

[0160] (2) Incubate in a cell culture incubator for 2 hours.

[0161] (3) Using 650nm as the reference wavelength, the absorbance at 450nm in the well was detected by an enzyme-linked immunosorbent assay (ELISA) reader.

[0162] (4) Data processing.

[0163] Test results as follows Figure 4 As shown in Figure A: After knocking down / knocking out FBXO45 in HaCaT cells, cell proliferation slowed down.

[0164] VII. Extracting cellular RNA

[0165] First, HaCaT cells were cultured in six-well plates. Once the cells reached 90% confluence, the culture medium was discarded, and the cells were washed once with 1 mL of PBS. Then, 1 mL of Trizol lysis buffer was added to each well. The six-well plates were placed on a shaker and gently shaken for 5 minutes. The lysis buffer was repeatedly pipetted to ensure complete lysis of the HaCaT cells, which were then collected into 1.5 mL Eppendorf tubes without RNase. The remaining steps for cell RNA extraction were the same as for tissue RNA extraction.

[0166] 8. Western blot

[0167] 1. Preparation of protein samples

[0168] Method 1: Culture the required cells in a six-well plate. After the necessary experimental treatments, discard the old culture medium and wash twice with 1 mL of pre-chilled PBS buffer, then aspirate the PBS. Add 100–200 μL of Western blot and IP cell lysis buffer to each well (add 1% PMSF protease inhibitor before use to prevent protein degradation). Place on ice for 10 min. Scrape cells from the ice using a cell scraper and collect them into a 1.5 mL Eppendorf tube. Place on ice for 10 min to allow for complete protein lysis. Centrifuge the tubes in a refrigerated centrifuge at 4°C and 12,000 rpm / min for 15 min, collecting the supernatant into a new Eppendorf tube. Quantify the extracted protein using a BCA protein quantification kit, adjusting different samples to a consistent concentration. Add 1 / 4 volume of 5× loading buffer (as shown in Table 16) to each tube, mix thoroughly, and then heat in a metal bath at 100°C for 10 min to denature the protein. Use the samples immediately or store at -20°C.

[0169] Table 16 Preparation of 5× loading buffer (100 mL system)

[0170] reagent components Final concentration content 1M Tris-HCl (pH 6.8) 250mM 25mL Glycerol 30％ 30mL Bromophenol blue 0.05％ 0.05g Sodium dodecyl sulfate 10％ 10g β-mercaptoethanol 5％ 5μL Sterilized ultrapure water / Quantitative volume replenishment

[0171] Method 2: Culture the required cells in a 6-well plate. After the necessary experimental treatments, discard the old culture medium and wash twice with 1 mL of pre-cooled PBS buffer, then aspirate the PBS. Add 1×LaemmliSample Buffer (as shown in Table 17) to the cells in the 6-well plate to lyse the cells. Place the 6-well plate on a shaker and shake gently for 5 min to ensure complete lysis. Collect the sample into a 1.5 mL centrifuge tube. Place the centrifuge tube in a metal bath at 100°C for 10 min to denature the proteins. Use the sample immediately or store it at -20°C.

[0172] Table 17 1×Laemmli Sample Buffer (10mL)

[0173] reagent components volume 2×Laemmli Sample buffer 5mL β-mercaptoethanol 0.5mL Deionized water 4.5mL

[0174] 2. Preparation of SDS-polyacrylamide gel. Prepare clean 1.0mm or 1.5mm glass plates according to experimental needs, and fix them on the gel preparation rack with clamps. First, prepare the separating gel according to Table 18, mix thoroughly, and add it along the gaps in the glass plate. Then, add anhydrous ethanol until it does not overflow the separating gel, press the separating gel flat, and let it stand at room temperature for 10-30 minutes until it solidifies. Discard the anhydrous ethanol on the separating gel, rinse the glass plate slightly with running water to remove excess anhydrous ethanol, and absorb excess water with absorbent paper. Prepare the stacking gel according to Table 19, mix thoroughly after adding each component, add it along the gaps in the glass plate, quickly insert the sample separating comb, and let it stand at room temperature for 10-30 minutes until the stacking gel solidifies.

[0175] Table 18 SDS-PAGE Separating Gel Preparation

[0176] reagent components 8% separating gel (10m system) 10% separating gel (10m system) Deionized water 4.6mL 4mL 30% Acrylamide 2.7mL 3.3mL 1.5M Tris-HCl (pH 8.8) 2.5mL 2.5mL 1.0M Tris-HCl (pH 6.8) / / 10% SDS 0.1mL 0.1mL 10% ammonium persulfate 0.1mL 0.1mL TEMED 4μL 4μL

[0177] Table 19 SDS-PAGE Concentrated Gel Preparation

[0178] reagent components Stacking gel (3mL system) Deionized water 2.1mL 30% Acrylamide 0.5mL 1.5M Tris-HCl (pH 8.8) / 1.0M Tris-HCl (pH 6.8) 0.38mL 10% SDS 0.03mL 10% ammonium persulfate 0.03mL TEMED 3.0μL

[0179] 3. Electrophoresis. Add sufficient 1×Running Buffer (as shown in Table 20) to both the inside and outside of the electrophoresis tank. Add the prepared protein samples one by one to the sample wells according to experimental needs, adding an appropriate volume (5μL~20μL) of protein sample to each well, with a protein amount of 10~30μg. Add 2.5μL of protein marker to indicate the protein molecular weight. Electrophoresis is performed at a constant voltage of 150V for 1 hour (adjust according to the gel concentration and protein molecular weight). When the bromophenol blue indicator band reaches the lower edge of the gel, turn off the power to stop electrophoresis.

[0180] Table 20 1×Running Buffer (1L system)

[0181] reagent components Content / Volume Tris-base 3.03g Glycine 14.4g SDS 1g Deionized water Adjust the volume to 1L

[0182] 4. Transfer. Activate a suitable PVDF membrane (5.2cm × 8.5cm) in methanol for at least 15 seconds, then place it in 1× Transfer Buffer (as shown in Table 21). Moisten the filter paper in the Transfer Buffer. After electrophoresis, open the glass plate, discard the stacking gel, and carefully place the separating gel onto the filter paper and the PVDF membrane (on the filter paper). Place another moistened filter paper on top of the gel, following the order of filter paper-PVDF membrane-gel-filter paper. During the operation, use a roller to remove air bubbles between the gel and filter paper. The operation should be quick to prevent the PVDF membrane from drying out. Transfer at 15V for 1 hour (adjust according to gel concentration and protein molecular weight).

[0183] Table 21 1× Transfer Buffer (1L system)

[0184] reagent components Content / Volume Tris-base 3.03g Glycine 14.4g methanol 200mL Deionized water Adjust the volume to 1L

[0185] 5. Blocking. After the transfer is complete, remove the PVDF membrane and place it in a 1% BSA / TBST blocking buffer (BSA dissolved in 1×TBST buffer as shown in Table 22), and shake it slowly on a shaker at room temperature for 1 hour.

[0186] Table 22 1×TBST buffer (1L system)

[0187] reagent components content Sodium chloride 8.00g Tris-base 2.24g Twain-20 1.00mL Sterilized ultrapure water Adjust the pH to 7.5–8.0 and calculate the volume to make up the difference.

[0188] 6. Primary antibody incubation. After blocking, cut the membrane into the desired bands according to the molecular weight indicated by the marker and the molecular weight of the target protein. Dilute the primary antibody with 1% BSA / TBST (BSA dissolved in 1×TBST buffer), then add it to the antibody incubation tank corresponding to the band, and incubate overnight at 4°C with gentle shaking.

[0189] 7. Secondary Antibody Incubation. The next day, transfer the primary antibody to a 15mL centrifuge tube. Add 1×TBST buffer to each antibody incubation tank and shake rapidly for 10 minutes on a shaker. Repeat three times. Prepare the appropriate secondary antibody according to the source of the primary antibody. Use 5% skim milk (dissolved in 1×TBST buffer). Add the corresponding secondary antibody to each antibody incubation tank and incubate slowly at room temperature for 1 hour. After the secondary antibody incubation is complete, discard the secondary antibody. Add 1×TBST buffer to each antibody incubation tank and shake rapidly for 10 minutes on a shaker. Repeat three times.

[0190] 8. Protein Expression Detection. Turn on the ECL chemiluminescence analyzer beforehand, adjust the parameters, mix ECL Western Blot solutions A and B in a 1:1 ratio, then completely immerse the bands in the mixture for several seconds before placing them in the chemiluminescence analyzer for image acquisition. Save the images and use software to perform grayscale analysis of the protein bands to analyze protein expression.

[0191] The Westren blot and qRT-PCR results are as follows: Figure 4 As shown in Figures B and C, knockdown of FBXO45 in HaCaT cells resulted in decreased expression of the NF-κB signaling pathway-related protein p-65 (Ser536), indicating inhibition of the NF-κB signaling pathway. Similarly, knockdown of the JAK / STAT signaling pathway led to decreased expression of the JAK / STAT signaling pathway-related protein p-stat3 (Tyr705), also indicating inhibition of the JAK / STAT signaling pathway. The expression of cell cycle-related proteins cyclin D1, CDK2, and CDK4 was also decreased. Furthermore, the mRNA levels of psoriasis-related inflammatory cytokines TNF-α, IL-1B, CXCL8, IL-23A, and CCL20 decreased after FBXO45 knockdown.

[0192] Example 4: The small molecule inhibitor CD437 (FBXO45) for the prevention and treatment of psoriasis.

[0193] I. Screening of CD437, a small molecule inhibitor of FBXO45

[0194] Based on AlphaFold3 prediction of the SPRY domain (residues 152-284) of FBXO45, PyMOL visualization analysis was used to identify the interaction interface of FBXO45 (residues 209-211, 245-248) as a potential drug target. Based on this, a radius... The docking box (center coordinates: X / Y / Z = -3.4 / 2.88 / 41.15) was used. The Topscience Database core library (covering 18078 compounds) was selected, and OpenBabel 3.1.1 was used for normalization, including desalting (retaining neutral molecules), Kekulaization (eliminating charge differences), and energy minimization, ultimately retaining 17022 candidate molecules to construct a virtual screening library. High-throughput docking was performed using AutoDock Vina 1.2.3 (GPU-accelerated mode). Molecules were sorted according to binding energy, and those with higher affinity were selected for subsequent experimental validation.

[0195] Screening revealed a strong affinity between CD437 and FBXO45, and the molecular docking results are as follows: Figure 5 As shown.

[0196] II. Effects of the small molecule inhibitor CD437 on FBXO45 expression.

[0197] HaCaT cells were treated with 10 μM CD437, and protein samples were collected for Western blot analysis to detect the expression of FBXO45.

[0198] The results are as follows Figure 6 As shown: CD437 can inhibit the expression of FBXO45 protein.

[0199] III. Effects of the FBXO45 small molecule inhibitor CD437 on the expression of inflammatory factors in HaCaT cells

[0200] HaCaT cells were treated with CD437 (purchased from Taoshu Company, product number T4371, CAS number 125316-60-1) at a concentration of 10 μM / mL. Meanwhile, HaCaT cells without CD437 treatment served as a control group. Total RNA was extracted from the cells, reverse transcribed, and then subjected to qRT-PCR.

[0201] Test results as follows Figure 7 As shown, the expression of TNF-α mRNA, a psoriasis-related inflammatory factor, decreased in the experimental group. This indicates that CD437 can directly inhibit the expression of the inflammatory factor TNF-α in HaCaT cells, and that CD437 has a certain anti-inflammatory effect.

[0202] IV. Effects of the FBXO45 small molecule inhibitor CD437 on HaCaT cell apoptosis

[0203] HaCaT cells were treated with different concentrations of CD437 (10 μM and 20 μM), with untreated HaCaT cells serving as a control. Cell culture medium from each group was collected into 15 mL centrifuge tubes. Each well was washed with 1 mL of PBS, and the PBS was collected into 15 mL centrifuge tubes. Then, 1 mL of trypsin was added to each well for digestion. After digestion, 2 mL of cell culture medium was added to stop the digestion reaction. All cells were pipetted off and collected into centrifuge tubes. The cells were centrifuged at 1000 × g for 5 min (preferably using a 305 μm centrifuge). The supernatant was discarded, and the cells were resuspended in 4 mL of pre-chilled PBS. The cells were centrifuged again at 1000 × g for 5 min. The supernatant was discarded, and the cells were resuspended in 50 μL of buffer. The cells were transferred into 1.5 mL Eppendorf tubes, and 2.5 μL of APC and 5 μL of PI were added. After incubation in the dark for 15 min, 200 μL of buffer was added to stop staining. Finally, flow cytometry analysis was performed.

[0204] Test results as follows Figure 8 As shown, the results indicate that CD437 can promote apoptosis in HaCaT cells.

[0205] V. Effects of the FBXO45 small molecule inhibitor CD437 on the HaCaT cell cycle

[0206] 1. After treating HaCaT cells with CD437, cells were collected for cell cycle analysis.

[0207] Collect cell culture medium into 15 mL centrifuge tubes. Wash each well of a 6-well plate with 1 mL of PBS, and collect the PBS into 15 mL centrifuge tubes. Add 1 mL of trypsin to each well for digestion. After digestion, add 2 mL of cell culture medium to stop the digestion reaction. Pipe off all cells using a pipette tip and collect them into centrifuge tubes. Centrifuge at 1000×g for 5 min (preferably using a 305 nm centrifuge). Discard the supernatant, add 1 mL of pre-chilled PBS to resuspend the cells, and centrifuge again at 1000×g for 5 min (using a 305 nm centrifuge). Discard the supernatant, reserving approximately 500 μL of PBS to resuspend the cells.

[0208] Cell fixation: Add 4.5 mL of pre-chilled 70% ethanol (pre-cooled at -20°C) to a centrifuge tube while vortexing, and fix at -20°C for 24 h. Centrifuge at 1000–1500 × g for 5 min and aspirate the supernatant. Resuspend the cells in 500 μL of pre-chilled PBS, centrifuge at 1000–1500 × g for 5 min, and aspirate the supernatant again.

[0209] 2. Prepare propidium iodide staining solution (add 0.5 mL staining buffer, 25 μL propidium iodide staining solution, and 10 μL L Nase to each sample). Add 500 μL of staining solution to each centrifuge tube, fully resuspend the cell pellet, transfer to a 1.5 mL centrifuge tube, incubate at 37°C in the dark for 30 min, and then perform flow cytometry detection.

[0210] Flow cytometry results as follows Figure 9 As shown, the results indicate that CD437 can arrest the cell cycle at G1 / S.

[0211] VI. Therapeutic effect of CD437, a small molecule inhibitor of FBXO45, on a mouse model of psoriasis.

[0212] Wild-type C57 mice aged 6-8 weeks were divided into groups of 5 mice each, with one group serving as a blank control (Vehicle). One group was an IMQ group, and the other was a CD437 treatment group (IMQ + CD437 10 mg / kg). The blank control group received a base cream, while the IMQ group received IMQ 60 mg / kg. The CD437 treatment group received IMQ for three days, followed by morning application of IMQ to continue the psoriasis model and afternoon application of CD437 for treatment. After four consecutive days of treatment, the mice were euthanized by cervical dislocation, and back skin was collected for H&E staining to assess the severity of the skin lesions on the back of the mice.

[0213] After modeling, the dorsal phenotype and H&E staining results of the mice are as follows: Figure 10 and Figure 11As shown, the results indicate that CD437 treatment in psoriasis mice significantly thinned the skin, improved hyperkeratosis and parakeratosis, reduced inflammatory factor infiltration, and decreased blood vessels.

[0214] In summary, FBXO45 expression is elevated in psoriatic lesions. Skin-specific knockout of FBXO45 significantly alleviated the psoriatic phenotype in knockout mice compared to non-knockout mice. H&E staining showed thinner epidermis, reduced inflammatory factor infiltration, and decreased vascularity. Screening for small molecule drugs targeting FBXO45 revealed that CD437 exhibited the strongest affinity. In HaCaT cells, CD437 inhibited the expression of the inflammatory factor TNF-α, promoted apoptosis, arrested the cell cycle at the G1 / S phase, and decreased the proportion of cells in the S phase. Treatment of psoriatic mice with CD437 significantly improved the psoriatic phenotype; H&E staining showed significantly thinner skin, reduced inflammatory factor infiltration, and decreased vascularity. Therefore, the small molecule drug CD437, targeting FBXO45, could be used in the prevention and treatment of psoriasis. Targeting FBXO45 is of significant importance in the prevention and treatment of psoriasis.

[0215] The above content is only for illustrating the technical concept of the present invention and should not be construed as limiting the scope of protection of the present invention. Any modifications made to the technical solution based on the technical concept proposed in this invention shall fall within the scope of protection of the claims of this invention.

Claims

1. The application of FBXO45 inhibitors in the preparation of drugs for the prevention and treatment of psoriasis, characterized in that, The FBXO45 inhibitor is a small molecule chemical inhibitor or siRNA targeting FBXO45; the small molecule chemical inhibitor is CD437 or a pharmaceutically acceptable salt thereof, and the siRNA is siRNA-1 or siRNA-2; the nucleotide sequence of siRNA-1 is shown in SEQ ID NO.38 and SEQ ID NO.39, and the nucleotide sequence of siRNA-2 is shown in SEQ ID NO.40 and SEQ ID NO.

41.

2. The application according to claim 1, characterized in that, The dosage of CD437 is 10 mg / kg.

3. The application according to claim 1, characterized in that, The dosage of siRNA was 2.5 nmol / 25 g.

4. The application according to claim 1, characterized in that, The drug is a drug that reduces the expression of psoriasis-related inflammatory factors, promotes cell apoptosis, and reduces the proportion of cells in the S phase.

Images