Sweet potato small peptide family gene IbCLE25 and application thereof in regulating drought resistance and salt tolerance
By cloning and transforming the sweet potato small peptide family gene IbCLE25, a recombinant vector was constructed and sweet potato transformed, which significantly improved the drought and salt tolerance of sweet potatoes, solved the cumbersome problem of the sweet potato variety improvement process, and achieved a significant improvement in drought and salt tolerance.
Patent Information
- Application Number
- CN202510399623.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-01
- Publication Date
- 2025-07-11
AI Technical Summary
The process of improving drought resistance and salt tolerance of sweet potatoes and breeding of new varieties is cumbersome and consumes a lot of manpower and material resources. There are few researches on the drought resistance and salt tolerance of sweet potatoes in sweet potatoes.
The sweet potato small peptide family gene IbCLE25 was cloned, and the recombinant vector pCAMBIA1301-IbCLE25 was constructed, and it was transformed into sweet potatoes through Agrobacterium mediation to obtain superexpressed sweet potato plants, improving drought resistance and salt tolerance.
The root length and fresh weight of genetically modified sweet potato plants have significantly improved under salt drought stress, and their drought resistance and salt tolerance have been significantly enhanced, providing technical reference for improving drought resistance and salt tolerance of sweet potatoes and selecting new varieties.
Smart Images

Figure CN120289577A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the fields of molecular biology and plant genetic engineering technology, and specifically relates to a sweet potato small peptide family gene IbCLE25 and its application in regulating drought and salt tolerance. Background Art
[0002] Sweet potato ( Ipomoea batatas (L.) Lam) is an important food, feed, industrial raw material and new energy crop, an annual or perennial dicotyledon, widely planted in more than 100 countries or regions in the world, and plays a crucial role in maintaining food security and energy security.
[0003] The Clavata3 / Embryo Surrounding Region-Related (CLE) family is a class of important hormone signals, and family members play a key role in the stem cell division and differentiation of root and shoot apical meristems, vascular (proto) cambium, hormone signal response, and stress resistance response. Sweet potato has strong stress resistance, and the cloning of stress resistance-related genes has gradually increased, but there is little research on the CLE family members providing drought and salt tolerance in sweet potato.
[0004] Currently, in the process of improving drought and salt tolerance varieties and breeding new varieties of sweet potato, the breeding process is cumbersome and time-consuming, and consumes a large amount of manpower and material resources, etc. Summary of the Invention
[0005] In view of the research gaps existing in the prior art, the present invention provides a sweet potato small peptide family gene IbCLE25 .
[0006] The present invention also provides an application of a sweet potato small peptide family gene IbCLE25 in regulating drought and salt tolerance.
[0007] The technical solution adopted by the present invention to achieve the above object is as follows: The present invention provides a sweet potato small peptide family gene for regulating plant drought and salt tolerance IbCLE25 , and its nucleotide sequence is as shown in SEQ ID NO.1.
[0008] Further, the above sweet potato small peptide family gene IbCLE25 , and its amino acid sequence (SEQ ID NO.2) is: VSKRKVPSGPBPJHN.
[0009] The present invention also provides a recombinant vector pCAMBIA1301- IbCLE25 containing the above sweet potato small peptide family gene IbCLE25 .
[0010] The present invention further provides a host cell containing the above-mentioned sweet potato small peptide family gene IbCLE25 .
[0011] The present invention also provides the application of the above-mentioned sweet potato small peptide family gene IbCLE25 in regulating the drought and salt tolerance of plants.
[0012] Preferably, the specific method adopted in regulating the drought and salt tolerance of plants is as follows: connecting the said sweet potato IbCLE25 gene to a vector, transforming it into sweet potato through Agrobacterium-mediated transformation to obtain an overexpressed sweet potato IbCLE25 transgenic plant.
[0013] The present invention also provides the application of the above-mentioned plant overexpression recombinant vector pCAMBIA1301- IbCLE25 in regulating the drought and salt tolerance of plants.
[0014] The present invention utilizes genetic engineering technology to clone and obtain the full length of the small peptide coding gene IbCLE25 from the salt-tolerant sweet potato variety "Jishu 26", constructs a cloning vector and a plant expression vector, and successfully transforms the sweet potato variety "Jishu 25" to obtain overexpressed sweet potato plants. It is found that, compared with the control plants, the drought and salt tolerance of the transgenic sweet potato plants are significantly improved. This will lay a foundation for further studying IbCLE25 the regulatory mechanism of genes in the stress resistance of sweet potato, and also provide a theoretical basis for using molecular means to improve the plant type of sweet potato and select new varieties, and at the same time has great application prospects.
[0015] The present invention takes the cDNA of the salt-tolerant sweet potato "Jishu 26" as a template to clone and isolate the small peptide coding gene IbCLE25 , and the full length of its ORF sequence is 339 bp, encoding 112 amino acids.
[0016] The present invention further constructs a plant overexpression recombinant vector PCAMBIA1301- IbCLE25 , transforms and obtains overexpressed IbCLE25 sweet potato plants, observes the transgenic sweet potato plants, and the results show that the root length and fresh weight of the transgenic sweet potato lines are significantly higher than those of the wild-type control after salt and drought stress, and the drought and salt tolerance are significantly improved. This lays a foundation for further studying IbCLE25 the function of in regulating the drought and salt tolerance of sweet potato, and also provides a reference for using molecular means to accelerate the breeding of new sweet potato varieties with drought and salt tolerance.
[0017] The beneficial effects of the present invention are as follows: by transforming the sweet potato small peptide coding gene IbCLE25 into the sweet potato variety "Jishu 25", after identification, a total of 13 overexpressed sweet potatoes IbCLE25Gene-positive plants. After salt and drought stress treatment, the root length and fresh weight of the transgenic lines were significantly higher than those of the wild type, and the drought and salt tolerance were significantly improved. It is indicated that the small peptide-encoding gene of sweet potato IbCLE25 regulates the drought and salt tolerance of sweet potato, which will provide technical references for the improvement of drought and salt tolerance of sweet potato and the breeding of new varieties. Brief Description of the Drawings
[0018] Figure 1 IbCLE25 Expression of the gene in sweet potato after salt and drought stress; Figure 2 DNA detection (A) and fluorescence quantitative PCR detection of transgenic sweet potato lines IbCLE25 Expression of the gene (B); where M is the DNA molecular Marker, W is the negative control water, P is the positive control (pCAMBIA1301- IbCLE25 ), WT is the genomic DNA of wild-type sweet potato plants, and L1-L13 are transgenic IbCLE25 gene-positive sweet potato plants; Figure 3 Phenotype and drought and salt tolerance of transgenic sweet potato plants; (A) Phenotype of tissue culture seedlings grown under control and salt and drought stress conditions for 4 w; (B-C) Root length and fresh weight. Detailed Implementation Modes
[0019] The present invention will be further described below in conjunction with specific embodiments.
[0020] Example 1 IbCLE25 Detection of the expression level of the gene in sweet potato after salt and drought stress The materials used in this example are the test-tube seedling materials of "Jishu 26" after salt and drought stress. After collection, they are quickly frozen in liquid nitrogen and stored in an ultra-low temperature refrigerator (-80°C).
[0021] 1) Extraction of Total RNA from various tissues of sweet potato It is carried out according to the instructions of the TaKaRa plant total RNA extraction kit. The specific operation is as follows: The various tissues of "Jishu 26" sweet potato stored at ultra-low temperature Quickly transfer to a mortar pre-cooled with liquid nitrogen, and grind the tissue with a pestle. Continuously add liquid nitrogen during the grinding process until it is ground into powder respectively; Add the powdered samples into 1.5 mL sterilized tubes containing 450 μl Buffer PE respectively, and pipette repeatedly until there is no obvious precipitate in the lysate; Centrifuge the lysate at 12,000 rpm and 4 °C for 5 min; Carefully aspirate the supernatant into a new 1.5 mL sterilized tube. Add 1 / 10 volume of Buffer NB to the supernatant, mix well by Vortex oscillation, and centrifuge at 12,000 rpm and 4 °C for 5 min; Carefully aspirate the supernatant into a new 1.5 mL sterilized tube, add 450 μL of Buffer RL, and mix the solution evenly with a pipette; Add 1.5 volumes of absolute ethanol to the mixed solution, mix the solution evenly with a pipette, and immediately transfer all the mixed solution into an RNA Spin Column; Centrifuge at 12,000 rpm for 1 min, discard the filtrate, and place the RNA Spin Column back into a 2 ml Collection Tube; Add 600 μL of 80% ethanol to the RNA Spin Column, centrifuge at 12,000 rpm for 30 s, and discard the filtrate; Add 50 μL of DNase I reaction solution to the center of the RNA Spin Column membrane, and let it stand at room temperature for 15 min; Add 350 μL of Buffer RWB to the center of the RNA Spin Column membrane, centrifuge at 12,000 rpm for 30 s, and discard the filtrate; Add 600 μL of 80% ethanol to the RNA Spin Column, centrifuge at 12,000 rpm for 30 s, and discard the filtrate; Re-place the RNA Spin Column on a 2 mL Collection Tube, centrifuge at 12,000 rpm for 2 min; Place the RNA Spin Column on a 1.5 mL RNase Free Collection Tube, add 30 μL of RNase Free dH2O to the center of the RNA Spin Column membrane, let it stand at room temperature for 5 min, and centrifuge at 12,000 rpm for 2 min to elute the RNA. The obtained RNA is stored in a -80 °C refrigerator for standby after concentration and purity detection.
[0022] Aspirate 2 μL of RNA and detect it by 1% agarose gel electrophoresis. The results show that the 28S and 18S bands are relatively clear, and the brightness of the 28S band is about twice that of the 18S band, indicating good RNA quality. Detect the RNA purity by a micro nucleic acid protein analyzer, OD 260 / OD 280 and OD260 / OD 230 All are between 1.8 and 2.1, with good integrity and can be used for reverse transcription.
[0023] 2) Synthesis of the first strand of reverse transcribed cDNA Before reverse transcribing RNA, perform electrophoresis to detect whether it is degraded, and use RNA / DNA calculator to measure the RNA concentration, according to the requirements of the RNA reverse transcription kit for RNA. The first strand of reverse transcribed cDNA uses the TaKaRa reverse transcription kit PrimeScript TM RT reagent Kit(Perfect Real Time), and the specific operation is carried out according to the kit instruction manual.
[0024] 3) Fluorescent quantitative analysis According to the IbCLE25 sequencing results of sweet potato, design fluorescent quantitative primers for sweet potato genes using BLAST in NCBI, use ACTIN as the internal reference gene, dilute the reverse transcribed cDNA by 10 times, take 1 μL as the template, and the fluorescent quantitative primers used are as follows: IbCLE25 -F (SEQ ID NO.3): 5’- TAAATATGGAGGAGACTATGACGAA -3’ IbCLE25 -F (SEQ ID NO.3): 5’- TAAATATGGAGGAGACTATGACGAA -3’ IbCLE25- R (SEQ ID NO.4) : 5’- CTGCTCTTCTGTTATGGATAGGGTC -3’ ACTIN-F (SEQ ID NO.5): 5’- AGCAGCATGAAGATTAAGGTTGTAGCAC -3’ ACTIN -R (SEQ ID NO.6) : 5’- TGGAAAATTAGAAGCACTTCCTGTGAAC -3’ Prepare the reaction solution according to the instruction manual of the SYBR Green Pro TaqHS qPCR Kit kit (Aikerui Biotechnology Co., Ltd.), and run the PCR program on the Roche Lightcycler®480 fluorescent quantitative instrument: 95℃ for 2 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 15 s, cycle 40 times; 37℃ for 1 s. After the reaction is completed, obtain the amplification curve, export the data, perform data analysis using Excel, and calculate the relative expression level using the 2 -ΔΔCq relative quantification method, and the data analysis results are as Figure 1 shown.
[0025] In Example 1, according to the analysis of fluorescence quantitative results, the expression level of the sweet potato IbCLE25 gene after salt and drought stress was determined. It can be seen from Figure 1 that the sweet potato IbCLE25 gene was up-regulated after salt and drought stress.
[0026] Example 2 Cloning of Gene and Construction of Recombinant Plasmid The plant materials used in this example were "Jishu 26" and "Jishu 25", which were stored in this experiment. The plant expression vector used in the experiment was pCAMBIA1301, which was stored in this experiment; the Escherichia coli strain used was Trans 5α, and the Agrobacterium strain was EHA105, purchased from Beijing Tsingke Biotechnology Co., Ltd., and was used for vector construction and transformation of sweet potato.
[0027] 1) Design and cloning of primers for the target gene According to the CDS sequence of the sweet potato IbCLE25 gene published in sweetpotato garden (see SEQ NO.1), primers for amplification were designed using Prime5.0, and restriction enzyme sites (Kpn I, Sal I) were added at both ends. The primer sequences were as follows: IbCLE25 - Kpn I -F (SEQ ID NO.7): 5'- GG GGTACC ATGGGTAGTAATTTGAGGAGTAGGA -3' (the underlined part is the Kpn I restriction enzyme site), IbCLE25 - Sal I -R (SEQ ID NO.8): 5'- CG GTCGAC TGGCTTGTCAAGCTCTCCTCT -3' (the underlined part is the Sal I restriction enzyme site).
[0028] Using cDNA as a template, the sweet potato IbCLE25 gene was cloned using LA Taq high-fidelity enzyme. The PCR amplification system (50 μL) was: 0.5 μl LA Taq, 10 μl Mg 2+Plus mix, 8 μL dNTP Mixture, 1 μL Forward Primer, 1 μL Reverse Primer, 2 μL Template DNA, 25.5 μL ddH2O. The PCR program is as follows: The reaction conditions are pre-denaturation at 94°C for 3 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 2 min, 34 cycles, total extension at 72°C for 10 min, and incubation at 4°C.
[0029] After the PCR reaction is completed, agarose gel electrophoresis is performed for detection and the target fragment is cut, and the gel is recovered and purified to obtain the PCR target amplification product. The DNA Gel Extraction Kit of Aikerui Biotech Company is used for the purification and recovery of the target fragment. The specific operation is as follows: Cut the single target band from the agarose gel and put it into a clean centrifuge tube, and weigh it; Add 3 volumes of solution GSB to the gel block (if the gel is 0.1 g, its volume can be regarded as 100 μL, then add 300 μL of GSB solution), place it in a 55°C water bath, and gently invert the centrifuge tube up and down continuously until the gel block is completely dissolved; Let the melted gel solution cool to room temperature, add 1 volume of isopropanol (if the gel is 0.1 g, then add 100 μL of isopropanol), and gently mix; Add the mixture to the centrifugal column, let it stand at room temperature for 1 min, centrifuge at 12,000 rpm for 1 min, discard the effluent, and then put the centrifugal column back into the collection tube; Add 650 μL of solution WB to the centrifugal column, centrifuge at 12,000 rpm for 1 min, and discard the effluent; Centrifuge at 12,000 rpm for 2 min to remove as much residual WB as possible, place the adsorption column at room temperature with the lid open for 5 min to completely dry; Put the centrifugal column into a clean centrifuge tube, suspend and drop 30 μL of ddH2O (ddH2O needs to be preheated in a 60 - 70°C water bath) at the middle position of the adsorption membrane, let it stand at room temperature for 2 min, and centrifuge at 12,000 rpm for 2 min to collect the DNA solution. Take 2 μL of the recovered and purified product, perform gel electrophoresis detection using 1.5% agarose, and the rest is placed in a -20°C refrigerator for subsequent ligation with the pCAMBIA1301 vector to construct the overexpression vector.
[0030] 3) Plasmid extraction: Extract the plasmid according to the instruction manual of the Tiangen Plasmid Mini Kit (Midiprep), and the specific steps are as follows: Take 10 mL of the overnight cultured bacterial solution, centrifuge at 12,000 rpm for 1 min, and discard the supernatant; take 500 μL of P1 solution (containing RNase A) and add it to the centrifuge tube with the bacterial cell pellet, and use a vortex mixer to thoroughly suspend the bacterial cell pellet; take 500 μL of P2 solution and add it to the centrifuge tube, gently invert the tube up and down to fully lyse the bacterial cells, take 700 μL of P3 solution and add it to the centrifuge tube, immediately gently invert the tube up and down to mix well, and when a white flocculent precipitate appears, centrifuge at 12,000 rpm for 10 min; take 500 μL of equilibration buffer BL and add it to adsorption column CP4, centrifuge at 12,000 rpm for 1 min, discard the waste liquid in the collection tube, put the adsorption column back into the collection tube, add the collected supernatant to filtration column CS in batches, centrifuge at 12,000 rpm for 2 min, carefully add the solution collected in the collection tube to adsorption column CP4 in batches, centrifuge at 12,000 rpm for 1 min, discard the waste liquid in the collection tube, and put adsorption column CP4 back into the collection tube; take 500 μL of deproteinization solution PD and add it to adsorption column CP4, centrifuge at 12,000 rpm for 1 min, discard the waste liquid in the collection tube, and put adsorption column CP4 back into the collection tube again; take 600 μl of washing buffer PW (containing absolute ethanol) and add it to adsorption column CP4, centrifuge at 12,000 rpm for 1 min, discard the waste liquid in the collection tube, put adsorption column CP4 back into the collection tube, and centrifuge at 12,000 rpm for 2 min to remove the residual washing buffer in the adsorption column; transfer adsorption column CP4 to a new 1.5 ml centrifuge tube, add 60 μL of ddH2O to the middle of the adsorption membrane; let it stand at room temperature for 2 min, centrifuge at 12,000 rpm for 1 min, and the solution collected in the centrifuge tube is the plasmid. Finally, measure the plasmid concentration to prepare for the next experiment.
[0031] 4) Double digestion reaction Digest the extracted pCAMBIA1301 plasmid with Kpn I and Sal I at 37 °C for 30 min, electrophoretically recover the linear vector, and store it at -20 °C for later use. The double digestion reaction system is 50 μL: 20 μL of pCAMBIA1301 plasmid, 5 μL of 5× buffer, 1 μL of Kpn I, 1 μL of Sal I, and 23 μL of ddH2O.
[0032] 5) Recombination reaction The recovered target gene and vector pCAMBIA1301 after digestion were detected by agarose gel electrophoresis. According to the detected purity and concentration, each reagent was added according to the ligation system. The ligation reaction system was: 7 μL of linearized pCAMBIA1301 vector, 3 μL of inserted fragment, 4 μl of T4 buffer, 2μl of T4, and ddH2O up to 20 μL. React at 37 °C for 30 min, place at room temperature (do not immediately place in the cooler), and transform into Escherichia coli competent Trans5α after 10 min.
[0033] 6) Transfer the ligation product into Escherichia coli Take out the competent cell Trans5α strain from the ultra-low temperature refrigerator and melt it on ice. Pipette 10 μL of the recombinant product into 100 μL of competent cells; place the centrifuge tube on ice for an ice bath for 10 min; perform a water bath in a 42 °C water bath, heat shock for 50 s, do not shake during this period; then immediately place it on ice for an ice bath for 2 min; add 500 μL of antibiotic-free liquid medium in the laminar flow hood, culture at 37 °C and 200 rpm for 60 min for recovery; centrifuge at 6000 rpm for 1 min, aspirate 350 μL of the supernatant; resuspend the precipitated bacteria and spread them on an LB plate (the concentration of Kana is 50 mg / L), and culture at 37 °C overnight.
[0034] 7) Identification of recombinants Pick a single colony on the plate and inoculate it into an LB liquid medium containing an antibiotic (Kana), and culture it overnight at 37 °C and 200 rpm with shaking. Perform colony PCR of the bacterial solution using the full-length primers of the target gene to screen for positive clones. The positive clones after screening were sent to Qingdao Qingke Biotechnology Co., Ltd. for sequencing. For the positive clones with correct sequencing results, after large-scale culture, the plasmid was extracted using the Tiangen plasmid extraction kit to prepare for the transformation of Agrobacterium tumefaciens competent cells.
[0035] In this Example 2, the cDNA of "Jishu 26" was used as a template to clone and isolate a small peptide-encoding gene IbCLE25 , its full-length ORF sequence is 339 bp, encoding 112 amino acids, and the recombinant vector pCAMBIA1301- IbCLE25 was successfully constructed for genetic transformation of sweet potato.
[0036] Example 3 Genetic transformation of sweet potato and identification of positive plant lines 1) Preparation and transformation of Agrobacterium tumefaciens EHA105 competent cells Steps for preparing competent cells: Pick a single colony and inoculate it into 10 mL of YEP liquid medium containing the antibiotic rifampicin. Incubate it overnight on a shaker at 28°C with a rotation speed of 180 - 250 rpm. Transfer 2 mL of the bacterial solution into 50 mL of YEP liquid medium containing the antibiotic rifampicin and continue culturing until the OD value reaches 0.3 - 0.4. Transfer the bacterial solution into a sterile centrifuge tube and ice-bath for 30 min. Centrifuge at 5000 rpm for 10 min and discard the supernatant. Add 2 mL of pre-cooled CaCl2 solution containing 15% glycerol and 0.1 mol·L -1 to gently suspend. Aliquot the Agrobacterium suspension into 1.5 mL sterile centrifuge tubes, 200 μL per tube, quickly freeze with liquid nitrogen and store at -80°C in the refrigerator for later use.
[0037] Specific steps for competent cell transformation: Take 10 μL of plasmid DNA and add it to 200 μL of thawed Agrobacterium competent cells on ice. Incubate on ice for 5 min, quickly freeze in liquid nitrogen for 5 min, and then water-bath at 37°C for 5 min. Add 800 μL of YEP liquid medium and shake at 28°C with a rotation speed of 100 rpm for 2 - 4 h. Centrifuge with a 5000 rpm centrifuge, pour off most of the supernatant, leaving about 50 μL, and resuspend the cells. Spread the bacterial solution on YEP solid medium containing the antibiotics rifampicin and kanamycin, incubate it inverted at 28°C for 48 - 72 h until single colonies grow on the plate. Pick a single colony, extract the plasmid, and perform PCR identification of the target gene. Send the identified positive clones to Qingdao Qingke Biotechnology Co., Ltd. for sequencing, select the positive colonies with correct sequencing results for shaking culture, add an appropriate amount of sterile 50% glycerol, and store at -80°C for later use.
[0038] 2) Induction of embryogenic callus and establishment of embryogenic cell suspension system of sweet potato variety Jishu 25: The harvested Jishu 25 sweet potato tubers are used to provide sweet potato shoot tips. Peel the shoot tip meristem and inoculate it on MS solid medium containing 2.0 mg / L 2,4-D. Incubate it in the dark at room temperature of 27±1°C to induce callus, and then perform multiplication and subculture to establish an embryogenic cell suspension system for transformation.
[0039] 3) Culture of Agrobacterium: Activate the Agrobacterium solution on a resistant plate, pick a single colony and inoculate it into 5 mL of YEP liquid medium added with the corresponding antibiotic. Incubate it with shaking at 28°C with a rotation speed of 200 rpm until the OD 600 value is in the range of 0.8 - 1.0.
[0040] 4) Preparation of the suspension cell line and infection of Agrobacterium tumefaciens: Select a suspension cell line in good condition that has grown for 8 - 12 weeks for grinding. After subculture for 3 d, take embryogenic suspension cell clusters with a diameter of about 0.7 - 1.4 mm for Agrobacterium infection and transformation.
[0041] 5) Co-culture and delayed culture: The suspension cell line after Agrobacterium infection was transferred to MS solid medium containing 30 mg / L acetosyringone (AS) and 2 mg / L 2,4-D for co-culture in the dark at a temperature of 27 ± 1°C. After 3 days of co-culture, the cell clusters were washed once with MS liquid medium containing 200 mg / L cefotaxime (CS) and 2 mg / L 2,4-D, soaked statically in MS liquid medium containing 100 mg / L CS and 2 mg / L 2,4-D for 30 min, and finally cultured with MS liquid medium containing 2 mg / L 2,4-D for 1 week. The culture conditions were 27 ± 1°C, 500 Lux light (13 h of light per day), and shaking culture at 100 rpm.
[0042] 6) Screening of resistant cell clusters: After delayed culture, the cell clusters were transferred to MS solid medium containing 5.0 mg / L hygromycin (Hyg), 100 mg / L CS and 2 mg / L 2,4-D for dark culture at a temperature of 27 ± 1°C, and the fresh medium was replaced every 2 weeks. After 4 weeks, the resistant cell clusters were transferred to MS solid medium containing 10.0 mg / L Hyg, 100 mg / L CS and 2 mg / L 2,4-D for co-culture for 4 - 8 weeks.
[0043] 7) Induction of somatic embryos: The resistant cell clusters with good growth status were transferred to MS medium containing 1.0 mg / L ABA and 100 mg / L CS to induce the growth of somatic embryos. The culture conditions were 27 ± 1°C, 3000 Lux light (13 h of light per day).
[0044] 8) Regeneration and identification of transgenic plants: The mature somatic embryos that turned green on the ABA medium after 2 - 4 weeks of induction, together with the callus, were transferred to MS solid medium and cultured until complete plants were formed at a temperature of 27 ± 1°C, with 13 h of light per day and a light intensity of 3000 Lux to obtain transgenic plants.
[0045] Trans IbCLE25 genic plants were identified using a combination of PCR detection and qRT-PCR detection.
[0046] The PCR detection method is as follows: DNA of sweet potato variety Jishu 25 and transgenic lines was extracted for PCR identification. Using the pCAMBIA1301- IbCLE25 vector plasmid as the positive control, water and wild-type sweet potato variety Jishu 25 as the negative control, and the primers are as follows: pCAMBIA1301-F (SEQ ID NO.9): 5'-GACGCACAATCCCACTATCC-3' pCAMBIA1301-R (SEQ ID NO.10): 5'-AAGGCGGGAAACGACAATC-3' The amplified PCR products were electrophoretically separated on 1% (w / v) agarose gel. PCR positive plants had a specific electrophoretic band, and the line numbers of PCR positive plants were recorded.
[0047] The qRT-PCR detection method was as follows: RNA was extracted from transgenic positive sweet potato plants, reverse transcribed to obtain cDNA, and qRT-PCR was performed, using Jishu 25 as the control WT.
[0048] In Example 3, through the Agrobacterium-mediated genetic transformation method, pCAMBIA1301- IbCLE25 overexpression recombinant vector linked with sweet potato IbCLE25 gene was transferred into sweet potato. The results were as Figure 2 shown. The results showed that only the positive control and the transgenic line candidates L1-L13 had electrophoretic bands near 300 bp, while the wild-type sweet potato and the negative control did not have bands. It was preliminarily determined that the transgenic positive sweet potato plants L1-L13 ( Figure 2 A) of the present invention were obtained. The qRT-PCR detection results showed that the expression level of the IbCLE25 gene in the positive transgenic sweet potato lines was significantly increased ( Figure 2 B).
[0049] Example 4 Functional identification of sweet potato IbCLE25 regulating drought and salt tolerance Phenotypic observations were made on transgenic plants and the control. The results were as Figure 3 shown. Compared with the wild type, the drought and salt tolerance of the transgenic sweet potato lines were significantly improved ( Figure 3 ). As Figure 3 shown: (A) shows the phenotypes and drought and salt tolerance of tissue culture seedlings grown for 4 weeks; (B-C) show the root length and fresh weight of tissue culture seedlings grown for 4 weeks.
Claims
1. A sweet potato small peptide family gene IbCLE25 for regulating plant drought and salt tolerance, characterized in that, The amino acid sequence of the sweet potato small peptide family gene IbCLE25 is: VSKRKVPSGPBPJHN; the nucleotide sequence is as shown in SEQ ID NO.
1.
2. A plant overexpression recombinant vector pCAMBIA1301- containing the sweet potato small peptide family gene as described in claim 1 IbCLE25 IbCLE25 . 3. A host cell containing the sweet potato small peptide family gene as described in claim 1 IbCLE25 4. Application of the sweet potato small peptide family gene as described in claim 1 IbCLE25 in regulating drought and salt tolerance of plants.
5. The application according to claim 4, wherein The specific method is as follows: Incorporate the sweet potato IbCLE25 gene into a vector, and transform it into sweet potato through Agrobacterium-mediated transformation to obtain sweet potato IbCLE25 overexpressing transgenic plants.
6. An application of the plant overexpression recombinant vector pCAMBIA1301- IbCLE25 in regulating drought and salt tolerance of plants.