Application of StTRM5 gene in improvement of potato tuber quality

Abstract

The invention relates to the technical field of biology, in particular to application of an StTRM5 gene in improving the quality of potato tubers. The invention discloses the StTRM5 gene capable of regulating and controlling the potato shape for the first time, and the potato shape change can be obviously caused by targeted knockout of the StTRM5 gene in potato C65, so that the StTRM5 gene has potential application value in control of the potato shape, can be utilized in production by utilizing a molecular improvement technology, and provides more choices for improvement of potato varieties.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly relates to StTRM5 the application of a gene in improving the quality of potato tubers. Background Art

[0002] Potato is the third largest food crop in the world and the fourth largest in China. Because of its advantages such as cold tolerance, barren tolerance, high and stable yield, wide adaptability, and comprehensive nutrition, it is widely planted worldwide and is of great significance for ensuring food security in China and the world. The tuber shape, i.e., the potato shape, is one of the important agronomic traits of potatoes and is also one of the important bases for identifying variety characteristics. The existing cultivated varieties have relatively regular potato shapes, generally round, oval or long. Different consumption habits and processed products have different requirements for the potato shape. For example, consumers in the Northeast region prefer round potato varieties, while consumers in the Central Plains and southern regions prefer long potato varieties; generally, long potato varieties are required for French fries, while round potato varieties are needed for potato chips. Therefore, breeding varieties with specific potato shapes to meet the needs of different consumers and processing is of great significance for promoting the all-round development of the potato industry. Summary of the Invention

[0003] Aiming at the deficiencies of the prior art, the present invention provides a StTRM5 gene for regulating the quality of potato tubers and the protein encoded thereby, and proves that it can significantly change the potato shape of potatoes, can be applied to the improvement of potato varieties, and provides more choices for potato shape breeding.

[0004] To achieve the above object, the present invention provides a protein encoded by a gene for regulating the quality of potato tubers, and the amino acid sequence of the protein is (a) or (b); StTRM5 (a) a protein consisting of the amino acids shown in SEQ ID NO. 1; (b) a derivative protein in which one or more amino acid residues of the amino acid sequence shown in SEQ ID NO. 1 are substituted and / or deleted and / or added and have the same function; In some specific embodiments, the present invention provides a protein having an amino acid sequence with 80% identity to the sequence shown in SEQ ID NO. 1 and having the ability to regulate the quality of potato tubers; preferably having 85% identity, more preferably having 90% identity, more preferably having 95% identity, and most preferably having 99% identity.

[0005] The present invention also provides a gene encoding the above-mentioned protein, and the nucleotide sequence of the gene is (a), (b) or (c); (a) the nucleotide sequence shown in SEQ ID NO. 2; ​(b) a nucleotide sequence that hybridizes with the nucleotide sequence shown in SEQ ID NO. 2 under stringent conditions and encodes it; (c) a nucleotide sequence that has more than 80% homology with the nucleotide sequence shown in SEQ ID NO. 2 and encodes it.

[0006] In some specific embodiments, StTRM5 the gene can regulate the shape change of potato tubers.

[0007] Those skilled in the art fully understand that since the same amino acid may be determined by multiple different codons, the nucleotide sequence encoding the above protein is not limited to one kind. It can be a nucleotide sequence obtained by synonymous mutation of one or more nucleotides in the mutant nucleotide sequence shown in SEQ ID NO. 2, which can also encode the mutant amino acid sequence of the present invention, or a nucleotide sequence that can encode the mutant amino acid sequence of the present invention according to codon optimization design.

[0008] In the present invention, the nucleic acid can be optimized or unoptimized, and the present invention does not make any limitation thereto.

[0009] In the present invention, the stringent conditions refer to the conditions under which the probe hybridizes with its target sequence to a detectable degree exceeding that of hybridization with other sequences. The stringent conditions are sequence-dependent and vary with the environment. By strictly controlling the hybridization or washing conditions, the target sequence that is 100% complementary to the probe can be identified. The stringent conditions can be selectively adjusted to allow for some sequence mismatches, so as to detect a lower degree of similarity.

[0010] In some specific embodiments, the nucleotide sequence of the gene of a protein provided by the present invention has 80% identity with the sequence shown in SEQ ID NO. 2; preferably 85% identity, more preferably 90% identity, more preferably 95% identity, and most preferably 99% identity.

[0011] The recombinant vector, expression cassette, transgenic cell line or recombinant bacterium containing the above gene also belongs to the protection scope of the present invention.

[0012] The application of any of the above proteins, genes, recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria in potato tuber improvement breeding also belongs to the protection scope of the present invention.

[0013] Further, by knocking out StTRM5 the gene, the shape of potato tubers can be significantly changed.

[0014] Further, the knockout is achieved by targeting and knocking out the gene through the Crispr / Cas9 method to obtain a knockout mutant plant.

[0015] Further, the target site sequences for the targeted knockout are as shown in SEQ ID NO.3 and SEQ ID NO.4 in the sequence listing.

[0016] Beneficial effects: The present invention for the first time reveals a gene that regulates the potato shape. StTRM5 Targeted knockout of the gene in potato C65 StTRM5 can significantly cause changes in the potato shape. Therefore, StTRM5 the gene has potential application value in controlling the potato shape and can be utilized in production by using molecular improvement techniques, providing more options for potato variety improvement. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 For StTRM5 the gene sequences of two independent deletion mutants obtained by targeted knockout; Figure 2 For Sttrm5 the difference diagram of the potato shape phenotypes of the deletion mutants; Figure 3 For StTRM5 the detection of the expression levels of the transgenic lines. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0018] To enable those skilled in the art to better understand the technical solutions of the present invention, the following provides a detailed description of the present invention in conjunction with specific embodiments. The experimental methods without specific conditions noted in the following examples are generally in accordance with conventional conditions or the conditions recommended by the manufacturers. The test materials used in the following examples are, unless otherwise specified, purchased from regular biochemical reagent stores. Unless otherwise stated, percentages and parts are calculated by weight. Unless otherwise defined, all professional and scientific terms used herein have the same meaning as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein can be applied to the present invention. The preferred methods and materials described herein are for illustrative purposes only.

[0019] The wild potato material C65 used in the present invention is from the potato germplasm resource library of the Potato Science Research Institute of Yunnan Normal University.

[0020] Example 1 StTRM5 Construction of gene-targeted knockout mutants Using the CRISPR-Cas9 system to create Sttrm5 mutants in the background of potato material C65.

[0021] According to the target gene StTRM5Design the target sites for knockout using the cDNA (sequence: SEQ ID NO. 2). The website used is: http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR; the target site sequences are as follows: StTRM5 -F (SEQ ID NO. 3): 5'-GGGAAACCACAGCCAAGTC-3' StTRM5 -R (SEQ ID NO. 4): 5'-GCTGTTCCTGTCTCGGTAG-3' Add adapters, synthesize by a primer synthesis company, and then perform fragment amplification. Use PCBC-DT1T2 as the template to amplify a terminator and a promoter; The amplification primers are: 65-TRM-F: TCGAAGTAGTGATTGGGGAAACCACAGCCAAGTCGTTTTAGAGCTAGAAATAGC 65-TRM-R: TTCTAGCTCTAAAACCTACCGAGACAGGAACAGCCAATCTCTTAGTCGACTCTAC The reaction system is as follows:

[0022] The reaction program is as follows:

[0023] Take Bsa Digest the PKSE402 vector plasmid containing the Cas9 expression cassette with I enzyme. The reaction system is as follows:

[0024] The reaction program is:

[0025] Purify the PCR product a and the digested vector plasmid b Use In-Fusion ligase to perform ligation according to the operation instructions. The specific operations are as follows: Prepare the following ligation system on ice:

[0026] The reaction program is:

[0027] Use the product manual of Vidy Biotechnology DH5α Chemically Competent Cell to transform Escherichia coli. The specific operations are as follows: a. Take out the DH5α competent cells from −80 °C, quickly insert them into ice. After 5 minutes, wait for the bacterial mass to melt. Add 2.5 μL of the above ligation product and gently mix by flicking the bottom of the EP tube with your finger. Let it stand in ice for 25 minutes; b. Heat shock in a 42 °C water bath for 45 seconds, quickly put it back on ice and let it stand for 5 minutes (shaking will reduce the transformation efficiency); c. Add 700 μL of LB without antibiotics, mix well, and incubate at 37 °C and 200 rpm for 60 minutes; d. Centrifuge at 5000 rpm for 1 min to collect the bacterial cells. Leave about 100 μL of the supernatant, gently resuspend the bacterial cells by pipetting, and spread them on an LB plate containing Kan; e. Invert the plate and place it in a 37 °C incubator for overnight culture.

[0028] Preliminary identification of positive clones: Use the specific primers Cas9-909F / Cas9-2450R on the vector for amplification, sequence the positive clones, and extract the plasmids of the positive clones with correct sequencing for backup; Cas9-909F: 5'- GCAGCTCTCCAAGGACACAT-3' Cas9-2450R: 5'- CGTGAGTTCTTCTGGCCCTT-3' Example 2 Agrobacterium-mediated potato genetic transformation 1. Agrobacterium transformation Use the product manual of Vidy Biotechnology GV3101 (Vidy Biotechnology, AC1001) to transform Agrobacterium with the positive plasmid. The specific operations are as follows: (1) Take out the GV3101 Agrobacterium competent cells stored at −80 °C and melt them on ice; (2) Add 1 μL of the plasmid DNA to be transformed to every 50 μL of competent cells, gently mix, and let it stand on ice for 5 min, in liquid nitrogen for 5 min, in a 37 °C water bath for 5 min, and in an ice bath for 5 min; (3) Add 700 μL of LB liquid medium without antibiotics and incubate with shaking at 28 °C for 2 hours; (4) Pipette about 100 μL of the bacterial liquid and spread it on an LB plate containing Kan. Invert the plate and culture it at 28 °C for 2 - 3 days.

[0029] (5) Colony PCR identification.

[0030] 2. Agrobacterium-mediated potato genetic transformation The receptor material for genetic transformation is potato C65, and the following processes are included: (1) Pre-culture: The explants of C65 with axillary buds are sheared and grown on MS30 (4.3 g of MS powder + 30 g of sucrose + 3 g of G3251) medium for 4 weeks. The stems of the C65 plants grown for 4 weeks are cut into pieces about 1 cm in size (without axillary buds), and the stem segments are placed on Z1N2 (4.3 g of MS powder + 20 g of sucrose + 3 g of G3251 + 1 mg / mL of ZT + 2 mg / mL of NAA, pH = 5.8) solid medium and pre-cultured for 48 h under light conditions; (2) Co-culture: The transformed Agrobacterium is activated on LB solid medium, shaken until OD 600 = 0.5, centrifuged at 4000 rpm for 10 min to collect the bacteria, then resuspended with MS20 liquid, and AS (40 mg / mL) is added at a ratio of 1:1000; The pre-cultured stem segments are placed in this liquid for infection for 10 min. After draining the bacterial liquid, the stem segments are placed on Z1N2AS (4.3 g of MS powder + 20 g of sucrose + 3 g of G3251 + 1 mg / mL of ZT + 2 mg / mL of NAA + 40 mg / mL of AS) medium and co-cultured for 48 h under dark conditions; (3) Regeneration culture: The stem segments are transplanted onto the differentiation medium Z2N0.01 (4.3 g of MS powder + 20 g of sucrose + 3 g of G3251 + 2 mg / mL of ZT + 0.01 mg / mL of NAA + 200 mg / mL of TMT + 100 mg / mL of Kana) for differentiation culture. The medium is changed every two weeks during this period until differentiated regenerated seedlings are obtained.

[0031] 3. Sttrm5 Identification of mutants Take the leaves of the rooted plants and put them into a 2 mL centrifuge tube. After adding steel beads, quickly freeze them in liquid nitrogen for 2 min and then take them out, and shake them vigorously in a foam box until the leaves are crushed. Add 500 μL of 2x CTAB, place it in a water bath at 65 °C for 1 h, and shake it 2 - 3 times during this period; Then cool it in a 4 °C refrigerator for about 5 min, add 500 ul of chloroform, invert and mix well, then centrifuge at 12000 for 10 min, pipette the supernatant into a new 1.5 ml centrifuge tube, add 500 ul of pre-cooled absolute ethanol, invert and mix well, then let it stand in a -20 °C refrigerator for 1 - 2 h, centrifuge at 12000 rpm for 10 min, pour off the supernatant, and wash it 2 - 3 times with 75% ethanol. The obtained white precipitate is left to dry with the lid open for about 1 h, and an appropriate amount of water is added to redissolve the DNA for standby.

[0032] Using the extracted DNA as a template, amplification was performed using the following primer pairs: TRM-test-F: TCGTAATCACATTTTAGCCGGG TRM-test-R: GGTGACTTTGGCGGTGTC The PCR reaction system was as follows:

[0033] The PCR amplification conditions were as follows:

[0034] The PCR products were subjected to gene detection, and the sequencing results were compared with the reference sequence to analyze the mutation situation of the target sites ( Figure 1 ). In Sttrm5-cr #1 mutants, 5 base deletions and 1 base insertion occurred at target site 1, and 5 base deletions occurred at target site 2. In Sttrm5-cr #2 mutants, 1 base insertion and 2 base deletions occurred at target site 1, and no change occurred at target site 2. Protein sequence analysis showed that the insertion or deletion of bases led to the premature occurrence of stop codons, and small peptides of 79 - 81 amino acids were obtained.

[0035] Example 3 Identification of the Shape of Transgenic Plants The control group WT 、Sttrm5-cr #1 and Sttrm5-cr #2 were respectively planted in a greenhouse, and the young potato tubers were harvested after about 2 months. As can be seen from Figure 2 , the length of the potatoes of mutants Sttrm5-cr #1 and Sttrm5-cr #2 was significantly shorter. The length and width of the young tubers were measured, and the results showed that the length - to - width ratio of the wild - type potato C65 was about 2.3, Sttrm5 and the length - to - width ratio of the mutants was about 1.6, showing a significant difference; Total RNA was extracted from the leaves of the wild - type WT (non - transgenic) and transgenic lines respectively using the method of Example 2, reverse - transcribed into cDNA, and the expression level of StTRM5 in the transgenic lines was identified by qPCR.

[0036] Figure 3 As can be seen from Sttrm5-cr #1 and Sttrm5-cr #2 , the expression of StTRM5 in mutants

[0037] Finally, it should be noted that the above description is only a preferred embodiment of the present invention. Those skilled in the art can make various similar representations under the inspiration of the present invention without violating the purpose and claims of the present invention. Such transformations all fall within the protection scope of the present invention.

Claims

1. A protein related to potato tuber quality, characterized in that, The amino acid sequence of the said protein is (a) or (b); (a) A protein composed of the amino acids shown in SEQ ID NO. 1; (b) A derivative protein which has the same function and is formed by substitution and / or deletion and / or addition of one or more amino acid residues in the amino acid sequence shown in SEQ ID NO.

1.

2. A gene encoding the protein according to claim 1, StTRM5 wherein the nucleotide sequence of the gene is (a), (b), or (c); (a) The nucleotide sequence shown in SEQ ID NO. 2; (b) A nucleotide sequence which hybridizes with the nucleotide sequence shown in SEQ ID NO. 2 under stringent conditions and encodes a polypeptide; (c) A nucleotide sequence which has a homology of more than 80% with the nucleotide sequence shown in SEQ ID NO. 2 and encodes a polypeptide.

3. A recombinant vector, expression cassette, transgenic line or recombinant bacterium comprising the gene recited in claim 2 StTRM5 ​ 4. StTRM5 Application of a gene in improving the quality of potato tubers, characterized in that, The nucleotide sequence of the said gene is (a), (b) or (c): (a) The nucleotide sequence shown in SEQ ID NO. 2; (b) A nucleotide sequence which hybridizes with the nucleotide sequence shown in SEQ ID NO. 2 under stringent conditions and encodes a polypeptide; (c) A nucleotide sequence which has a homology of more than 80% with the nucleotide sequence shown in SEQ ID NO. 2 and encodes a polypeptide.

5. Use of the protein according to claim 1 in improving the quality of potato tubers.

6. Use of the recombinant vector, expression cassette, transgenic line or recombinant bacterium according to claim 3 in improving the quality of potato tubers.

7. The application according to claim 4 or 6, characterized in that: Knocking out this gene can significantly change the shape of potato tubers.

8. The application according to claim 7, wherein The said knocking out is to target and knock out the said gene by the Crispr / Cas9 method to obtain a knocked-out mutant plant.

9. The application according to claim 8, wherein The target site sequences of the said targeted knocking out are shown in SEQ ID NO. 3 and SEQ ID NO. 4 in the sequence listing.

Images