Rhodotorula difformis and application thereof

Abstract

The invention provides a rhodotorula diovalvata strain and application of the rhodotorula diovalvata strain. The preservation number of the rhodotorula diobovata is CGMCC (China General Microbiological Culture Collection Center) NO.32322. The rhodotorula diobovata disclosed by the invention has the advantages that the preservation number is CGMCC NO.32322 The rhodotorula difformis is applied to the enhanced fermentation of the tobacco leaves, and compared with a control group fermented by sterile water, the rhodotorula difformis fermentation group can obviously improve the content of chlorophyll degradation products, carotenoid degradation products, cembrane degradation products and other aroma components. The results show that the application of the rhodotorula difformis not only enhances the aroma characteristic of the tobacco leaves, but also contributes to improving the overall quality of the tobacco leaves, and provides an effective biotechnological means for a tobacco fermentation process.

Description

Technical Field

[0001] The present application relates to the technical field of microorganisms, and particularly to a Rhodotorula diobovata and its application. Background Art

[0002] With the development of the tobacco industry and the improvement of consumers' living standards, consumers' requirements for tobacco products are increasing day by day. The pursuit of tobacco products with better flue gas, flavor quality, lower toxicity of harmful substances, and more comfortable sensory evaluation experiences has become the development direction of future tobacco products. As a special tobacco product, cigar is favored by some consumers for its mellow aroma, full taste style characteristics, and relatively low nicotine content.

[0003] Research shows that microorganisms play a crucial role in the fermentation process of cigar tobacco. Microbial fermentation can effectively degrade macromolecular substances in cigar tobacco leaves that release pungent odors during incomplete combustion, such as proteins, starches, celluloses, etc., and simultaneously produce various volatile aromatic organic compounds, such as alcohols, aldehydes, ketones, etc. This process is a key means to improve the industrial usability of cigar tobacco leaf raw materials.

[0004] Therefore, by means of biotechnology, exploring new microbial resources and applying them to enhance the fermentation process of cigar tobacco leaves is of great significance for improving the quality of cigar tobacco leaves. Summary of the Invention

[0005] The present application mainly provides a strain of Rhodotorula diobovata, which can stably produce flavor substances and can significantly reduce irritation and off-odors when used for fermenting tobacco leaves, improve the aroma amount and permeability, thereby improving the usability of tobacco leaves.

[0006] The present application realizes the above object through the following technical solutions:

[0007] In the first aspect of the present application, there is provided a Rhodotorula diobovata with a preservation number of CGMCC NO. 32322.

[0008] In the second aspect of the present application, there is provided a biological preparation, which includes one or more of the above-mentioned Rhodotorula diobovata, the culture of the above-mentioned Rhodotorula diobovata, the lysate of the above-mentioned Rhodotorula diobovata, and the extract of the above-mentioned Rhodotorula diobovata.

[0009] In the third aspect of the present application, there is provided the application of the above-mentioned Rhodotorula diobovata or the above-mentioned biological preparation in the preparation of tobacco products.

[0010] In some of these embodiments, the varieties of the tobacco products include one or more of cigar tobacco leaves, flue-cured tobacco, and sun-cured tobacco.

[0011] In some of these embodiments, the method for preparing the tobacco product includes:

[0012] Fermenting tobacco leaves with the above-mentioned Bacillus subtilis or the above-mentioned biological agent to prepare a tobacco product.

[0013] In some of these embodiments, the fermentation treatment includes the following steps:

[0014] Culturing the Rhodotorula dacryoidea, collecting the culture solution to obtain a bacterial solution; and

[0015] Mixing the bacterial solution and the tobacco leaves for fermentation treatment.

[0016] In some of these embodiments, the conditions for culturing include: placing the Rhodotorula dacryoidea in a sterilized liquid medium and culturing it at 28°C to 30°C and 180 rpm to 220 rpm for 24 h to 48 h;

[0017] Optionally, the nutrients in the liquid medium include: 0.1% (w / v) to 10% (w / v) peptone, 0.01% (w / v) to 5% (w / v) yeast powder, 0.1% (w / v) to 10% (w / v) glucose, and the pH of the liquid medium is 5.5 to 7.0.

[0018] In some of these embodiments, the cell concentration in the bacterial solution is 10 6 cells / mL to 10 8 cells / mL;

[0019] And / or, the volume-mass ratio of the bacterial solution to the tobacco leaves is (10 to 30) mL: 100 g.

[0020] In some of these embodiments, the temperature of the fermentation treatment is 30°C to 35°C, the relative humidity of the fermentation treatment is 70% to 75%, and the time of the fermentation treatment is 20 days to 30 days.

[0021] The fourth aspect of the present application provides a tobacco product containing the product of mixed fermentation of the above-mentioned Rhodotorula dacryoidea and / or the above-mentioned biological agent and tobacco leaves.

[0022] The present application provides a Rhodotorula obovoidea double-inverted-ovate strain, which can stably produce flavor substances. By applying Rhodotorula obovoidea double-inverted-ovate to the enhanced fermentation of tobacco leaves, compared with the control group fermented with sterile water, the Rhodotorula obovoidea double-inverted-ovate fermentation group can significantly increase the contents of chlorophyll degradation products (such as neophytadiene), carotenoid degradation products (such as dihydroactinidiolide, 5,6,7,7a-tetrahydro-4,7,7a-trimethyl-2(4H)-benzofuranone, etc.), cembranoid degradation products (such as cembrene, etc.), and other aroma components (such as 2,4-di-tert-butylphenol). At the same time, the irritation of miscellaneous odors in the yeast-enhanced fermentation group is significantly reduced, while the caramel-like, roasted, and woody aromas increase, the smoke becomes more mellow, and the aroma quantity increases. These results indicate that the application of Rhodotorula obovoidea double-inverted-ovate not only enhances the aroma characteristics of tobacco leaves but also helps to improve the overall quality of tobacco leaves, providing an effective biotechnological means for the tobacco fermentation process. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the specific embodiments of the present application or the technical solutions in the prior art, the following will briefly introduce the drawings required for use in the description of the specific embodiments or the prior art. Obviously, the drawings in the following description are some embodiments of the present application. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0024] Figure 1 It is the electrophoresis detection diagram of the amplification product in Example 1 of the present application;

[0025] Figure 2 It is the comparison diagram of the quality characteristics of tobacco products in Example 1 of the present application and Comparative Example 1;

[0026] Figure 3 It is the comparison diagram of the aroma characteristics of tobacco products in Example 1 of the present application and Comparative Example 1;

[0027] Figure 4 It is the comparison diagram of the biochemical index results of tobacco products in Example 1 of the present application and Comparative Example 1.

[0028] The Rhodotorula obovoidea double-inverted-ovate provided by the present application was deposited on October 24, 2024, at the General Microbiology Center of the China Committee for Culture Collection of Microorganisms, with the deposit address being No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, and the deposit number being CGMCC NO. 32322. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0029] To make the above objects, features, and advantages of the present application more apparent and understandable, a detailed description of the specific embodiments of the present application is provided. Many specific details are set forth in the following description in order to fully understand the present application. However, the present application can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without departing from the spirit of the present application. Therefore, the present application is not limited by the specific embodiments disclosed below.

[0030] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which this application belongs. The terms used in the specification of this application are only for the purpose of describing specific embodiments and are not intended to limit this application. Unless otherwise specifically stated, various raw materials, reagents, instruments, and equipment used in this application can be obtained through the market or prepared by existing methods.

[0031] Unless otherwise stated or there is a contradiction, the terms or phrases used herein have the following meanings:

[0032] The terms "and / or", "or / and", and "and / or" used herein include any one of two or more related listed items, as well as any and all combinations of the related listed items. The said any and all combinations include any two related listed items, any more related listed items, or the combination of all related listed items. It should be noted that when at least two conjunctions selected from "and / or", "or / and", and "and / or" are used to connect at least three items, it should be understood that in this application, this technical solution undoubtedly includes the technical solution connected by "logical AND", and also undoubtedly includes the technical solution connected by "logical OR". For example, "A and / or B" includes three parallel solutions: A, B, and A + B. Another example is the technical solution of "A, and / or, B, and / or, C, and / or, D", which includes any one of A, B, C, and D (that is, the technical solution connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, it includes the combination of any two or any three of A, B, C, and D, and also includes the combination of the four items A, B, C, and D (that is, the technical solution connected by "logical AND").

[0033] In this application, the terms "multiple", "diverse", "multiple times", "multiple elements", etc., unless otherwise specifically defined, refer to a quantity greater than 2 or equal to 2. For example, "one or more" means one or greater than or equal to two.

[0034] In this application, terms such as "further", "even further", "especially", etc. are used for descriptive purposes and indicate differences in content, but should not be construed as limiting the scope of protection of this application.

[0035] In this application, "optionally", "optional", and "option" mean that it can be either present or absent, that is, it refers to any one of the two alternative options of "present" or "absent". If "optional" appears multiple times in a technical solution, without special instructions, and without contradictions or mutual restrictions, each "optional" is independent of each other.

[0036] In this application, among the technical features described in an open-ended manner, it includes a closed technical solution composed of the listed features, and also includes an open technical solution containing the listed features.

[0037] In this application, regarding numerical intervals (i.e., numerical ranges), without special instructions, the optional numerical values are considered continuous within the above numerical intervals, and include the two numerical endpoints of this numerical range (i.e., the minimum value and the maximum value), as well as each numerical value between these two numerical endpoints. Without special instructions, when the numerical interval only refers to the integers within the numerical interval, it includes the two endpoint integers of this numerical range, as well as each integer between the two endpoints. In this article, it is equivalent to directly listing each integer. For example, t is an integer selected from 1 - 10, which means t is any integer selected from the integer group composed of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. In addition, when providing multiple range descriptions for features or characteristics, these ranges can be combined. In other words, unless otherwise specified, the ranges disclosed in this article should be understood to include any and all sub-ranges subsumed therein.

[0038] The temperature parameter in this application, without special limitations, allows both constant temperature treatment and fluctuations within a certain temperature range. It should be understood that the so-called constant temperature treatment allows the temperature to fluctuate within the accuracy range controlled by the instrument. Fluctuations within ranges such as ±5°C, ±4°C, ±3°C, ±2°C, ±1°C are allowed.

[0039] In this application, %(w / w) and wt% both represent weight percentages, %(v / v) refers to volume percentages, and %(w / v) refers to mass-volume percentages.

[0040] Rhodotorula is a general term for a group of red pigment-producing yeasts, which are widely distributed in various ecological environments such as soil, ocean, rivers, and lakes. Many Rhodotorula strains have the ability to produce active substances such as polysaccharides, oils and fats, and carotenoids, showing great application potential in the fields of aquaculture, food, medicine, and cosmetics.

[0041] During long-term research, the technical personnel of this application isolated Rhodotorula biguttulata from the surface of cigar tobacco leaves. This strain can produce volatile aromatic organic compounds and substances such as carotenoids. However, up to now, there has been no relevant report on its application in cigar tobacco leaf fermentation.

[0042] Based on this, an embodiment of the present application provides a strain of Rhodotorula diobovata, which was deposited at the General Microbiology Center of the China Committee for Culture Collection of Microorganisms on October 24, 2024. The deposit address is No. 3, Building 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, and the deposit number is CGMCC NO. 32322.

[0043] The present application provides a strain of Rhodotorula diobovata, which can stably produce flavor substances. By applying Rhodotorula diobovata to the enhanced fermentation of tobacco leaves, compared with the control group fermented with sterile water, the fermentation group of Rhodotorula diobovata can significantly increase the contents of chlorophyll degradation products (e.g., neophytadiene), carotenoid degradation products (e.g., dihydroactinidiolide; 5,6,7,7a-tetrahydro-4,7,7a-trimethyl-2-(4H)-benzofuranone, etc.), cembranoid degradation products (e.g., cembrene, etc.) and other aroma components (2,4-di-tert-butylphenol). At the same time, the irritation of miscellaneous odors in the yeast-enhanced fermentation group is significantly reduced, and the caramel-like fragrance, baking fragrance, and woody fragrance are increased, the smoke is more mellow, and the aroma amount is increased. These results indicate that the application of Rhodotorula diobovata not only enhances the aroma characteristics of tobacco leaves, but also helps to improve the overall quality of tobacco leaves, providing an effective biotechnological means for the tobacco fermentation process.

[0044] In some of these embodiments, the above-mentioned Rhodotorula diobovata is screened from cigar tobacco leaves.

[0045] An embodiment of the present application also provides a biological preparation, which includes one or more of the above-mentioned Rhodotorula diobovata, the culture of the above-mentioned Rhodotorula diobovata, the lysate of the above-mentioned Rhodotorula diobovata, and the extract of the above-mentioned Rhodotorula diobovata.

[0046] Another embodiment of the present application also provides the application of the above-mentioned Rhodotorula diobovata or the above-mentioned biological preparation in the preparation of tobacco products.

[0047] In some of these embodiments, the varieties of the above-mentioned tobacco products include one or more of cigar tobacco leaves, flue-cured tobacco, and sun-cured tobacco.

[0048] In some of these embodiments, the preparation method of the above-mentioned tobacco products includes: fermenting tobacco leaves with the above-mentioned Rhodotorula diobovata and / or the above-mentioned biological preparation to prepare tobacco products.

[0049] The preparation method of the tobacco products of the present application has a simple process, is safe and non-toxic, and is suitable for industrial promotion and application.

[0050] In some of these embodiments, the above-mentioned fermentation treatment includes steps S10 to S20.

[0051] Step S10: Cultivate the above-mentioned Rhodotorula biobovatum, collect the culture medium, and obtain a bacterial liquid.

[0052] Step S20: Mix the above-mentioned bacterial liquid and tobacco leaves for fermentation treatment.

[0053] In some embodiments, the above-mentioned cultivation conditions include: placing the above-mentioned Rhodotorula biobovatum in a sterilized liquid medium and cultivating it at 28°C to 30°C and 180 rpm to 220 rpm for 24 h to 48 h.

[0054] In a specific example, the above-mentioned cultivation conditions include: placing the above-mentioned Rhodotorula biobovatum in a sterilized liquid medium and cultivating it at 28°C and 200 rpm for 24 h.

[0055] In some embodiments, the nutrients in the above-mentioned liquid medium include: 0.1% (w / v) to 10% (w / v) peptone, 0.01% (w / v) to 5% (w / v) yeast powder, 0.1% (w / v) to 10% (w / v) glucose, and the pH of the above-mentioned liquid medium is 5.5 to 7.0.

[0056] It can be understood that peptone contains rich amino acids, vitamins and other growth factors required for the growth of microorganisms; yeast powder can provide high-quality protein, complete amino acids and essential precursor substances for the growth of strains; microorganisms can utilize glucose for cell respiration, decompose it through a series of complex biochemical reactions, and release energy for maintaining cell life activities such as cell division and substance synthesis. At the same time, the intermediate products produced during the decomposition of glucose can also be used as raw materials for synthesizing other organic substances in the cell, such as amino acids, nucleotides, fatty acids, etc. These substances are important bases for constructing the structural and functional components of microbial cells.

[0057] In a specific example, the nutrients in the above-mentioned liquid medium include 2% (w / v) peptone, 1% (w / v) yeast powder, 2% (w / v) glucose, and the pH of the above-mentioned liquid medium is 7.0.

[0058] In some embodiments, the cell concentration in the above-mentioned bacterial liquid is 10 6 cells / mL to 10 8 cells / mL. As an example, the concentration of the bacterial liquid can be 10 6 cells / mL, 2×10 6 cells / mL, 3×10 6 cells / mL, 4×10 6 cells / mL, 5×10 6 cells / mL, 6×10 6 cells / mL, 7×10 6 cells / mL, 8×106 CFU / mL, 9×10 6 CFU / mL, 10 7 CFU / mL, 2×10 7 CFU / mL, 3×10 7 CFU / mL, 4×10 7 CFU / mL, 5×10 7 CFU / mL, 6×10 7 CFU / mL, 7×10 7 CFU / mL, 8×10 7 CFU / mL, 9×10 7 CFU / mL, 10 8 CFU / mL, or any value within the range formed by any two of the above point values.

[0059] In some embodiments, after the step of collecting the culture medium in step S10, the method further includes: diluting the culture medium so that the cell concentration after dilution is 10 6 CFU / mL to 10 8 CFU / mL.

[0060] Optionally, the dilution factor is 5 to 50 times.

[0061] In some embodiments, the volume-to-mass ratio of the above-mentioned bacterial liquid to the above-mentioned tobacco leaves is 10 mL to 30 mL: 100 g.

[0062] In some embodiments, the temperature of the above-mentioned fermentation treatment is 30°C to 35°C. As an example, the temperature of the fermentation treatment can be 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, or any value within the range formed by any two of the above point values.

[0063] In some embodiments, the relative humidity of the above-mentioned fermentation treatment is 70% to 75%. As an example, the relative humidity of the fermentation treatment can be 70%, 71%, 72%, 73%, 74%, 75%, or any value within the range formed by any two of the above point values.

[0064] In some embodiments, the time of the above-mentioned fermentation treatment is 20 days to 30 days. As an example, the time of the fermentation treatment can be 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, or any value within the range formed by any two of the above point values.

[0065] Another embodiment of the present application further provides a tobacco product, including the product of the mixed fermentation of the above-mentioned Rhodotorula glutinis bi-ovoidalis and / or the above-mentioned biological agent and tobacco leaves.

[0066] For the above-mentioned tobacco products, the miscellaneous gas irritation is significantly reduced, the caramel sweetness, baking aroma, and woody aroma are increased, the smoke is more mellow, and the aroma quantity is increased.

[0067] The present application will be further described below in conjunction with specific examples and comparative examples, but it should not be construed as a limitation on the protection scope of the present application. For the raw materials involved in the following specific examples, unless otherwise specified, they can all be obtained commercially. For the instruments used, unless otherwise specified, they can all be obtained commercially. For the processes involved, unless otherwise specified, they are all conventional selections of those skilled in the art.

[0068] The present application will be further described below in conjunction with specific examples and comparative examples, but it should not be construed as a limitation on the protection scope of the present application. For the raw materials involved in the following specific examples, unless otherwise specified, they can all be obtained commercially. For the instruments used, unless otherwise specified, they can all be obtained commercially. For the processes involved, unless otherwise specified, they are all conventional selections of those skilled in the art.

[0069] Example 1

[0070] I. Strain isolation, screening and identification

[0071] (1) Sample pretreatment

[0072] Take cigar tobacco leaves as the source for strain screening. Before the experiment, store the samples at -4°C temporarily. Use sterile scissors to take 5 g of the sample in a laminar flow hood, cut it into pieces and place it in a triangular flask pre-filled with sterilized phosphate buffer. The phosphate buffer specifically contains 8 g of sodium chloride (NaCl), 0.2 g of potassium chloride (KCl), 1.44 g of disodium hydrogen phosphate (Na2HPO4), and 0.24 g of potassium dihydrogen phosphate (KH2PO4) per 1 L. Place the triangular flask on a shaker and culture it at 30°C and 200 rpm for 30 min.

[0073] (2) Dilution coating on plates

[0074] Dilute the supernatant of the sample in step (1) to 10 -1 、10 -2 and 10 -3 , and then coat them on SCD plates respectively. Invert the coated plates and culture them in a constant temperature and humidity incubator at 28°C for 24 h - 28 h until monoclonal colonies appear on the plates.

[0075] (3) Three-zone streak isolation

[0076] According to the morphological characteristics differences, pick different monoclonal colonies in step 2 and streak them in three zones on a new SCD plate. Invert the streaked plate and culture it in a constant temperature and humidity incubator at 28 °C for 24 h to 28 h until monoclonal colonies appear on the plate. The colonies of the strain SC-5 are red, shiny, relatively flat, and have neat edges. Conduct physiological and biochemical tests on the strain:

[0077] 1) Conduct protease activity detection on the strain, using skim milk powder as the substrate. The specific medium components are shown in Table 1. Observe whether there is a clear zone after the strain is cultured on the plate for 24 h.

[0078] Table 1

[0079]

[0080] 2) Conduct amylase activity detection on the strain, using starch as the substrate. The specific medium components are shown in Table 2. After the strain is cultured on the plate for 24 h, add 5 ml of iodine solution to the screening plate and stain for 2 min, then observe whether there is a clear zone.

[0081] Table 2

[0082]

[0083] 3) Conduct cellulase activity detection on the strain, using sodium carboxymethyl cellulose as the substrate. The specific medium components are shown in Table 3. After the strain grows for 24 h, stain it with 1% Congo red solution prepared with 95% anhydrous ethanol for 10 - 15 min, and then observe the size of the clear zone after decolorization with 1 M NaCl solution.

[0084] Table 3

[0085]

[0086] The specific results of the physiological and biochemical indexes are shown in Table 4.

[0087] Table 4

[0088]

[0089] Among them, "-" represents negative.

[0090] (4) Purification and preservation

[0091] Repeat step 3 for 2 to 3 times of purification until there are only monoclonal colonies with a single morphological characteristic on the plate. Then pick the monoclonal colonies and inoculate them into a liquid medium, place them on a shaker at 28 °C and 200 rpm for 24 h to 48 h. Then, proportionally absorb the bacterial liquid and the sterilized 30% glycerol, mix them evenly, and place them in a cryopreservation tube for preservation at -80 °C.

[0092] (5) Strain identification

[0093] Take the purified monoclonal colonies from step (4) in sterile water, extract DNA, send the sample for sequencing after amplification, and use the primers shown by NS1: 5′-GTAGTCATATGCTTGTCTC-3′; NS6: 5′-GCATCACAGACCTGTTATTGCCTC-3′ for sequencing detection. The electrophoresis detection pattern of the PCR amplification product is as follows Figure 1 as shown; the ITS sequence is as shown in SEQ ID NO.1. Further sequence comparison in the NCBI database found that: the homology of the analyzed strain with Rhodotorula diplobovata is 99.17%, and it can be identified as Rhodotorula diplobovata. This Rhodotorula diplobovata was deposited in the General Microbiology Center of the China Committee for Culture Collection of Microorganisms on October 24, 2024. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, and the deposit number is CGMCC NO. 32322.

[0094] The specific ITS sequence as shown in SEQ ID NO.1 is:

[0095] 5′-TGTTACGTGACTGCGGAGGATCATTAGTGAATCTAGGACGTCCAAC TTAACTTGGAGTCCGAACTCTCACTTTCTAACCCTGTGCATCTGTTTTAAAATTGGCCAGTAGCTCTTCGGAGCGAACCACCATTTTTCACTTATACAAACACAAAGTCTATGAATGTAAACAAATTTATAACAAAACAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGC TCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCCACCTCTTTCTTAGTGAATCTGGTGGTGCTTGGTTTCTGAGCGCTGCTCTGCTTCGGCTTAGCTCGTTCGTAATGCATTAGCATCCGCAACCGAAACTTCGGATTGACTTGGCGTAATAGACTATTCGCTGAGGATTCCAGACTTGTTCTGGAGCCGAGTTGGGTTAAAGGAAGCTTCTAATCCTAAAGTCTATTTTTTGATTAGATCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAAAGAGGGGGGAGGGAAAA-3′。

[0096] II. Fermentation method of cigar tobacco leaves

[0097] (1) Inoculate the glycerol-preserved Rhodotorula glutinis of double obovate shape into a liquid medium for fermentation culture. The liquid volume in the shaking flask is 20%, the inoculation amount is 2%, and it is cultured in a constant temperature and humidity incubator at 28 °C and 200 rpm for 24 h. Among them, the components of the liquid medium include: 2% (w / v) peptone, 1% (w / v) yeast powder, 2% (w / v) glucose, and 95% (v / v) distilled water, and the pH is 7.0.

[0098] (2) Dilute the above culture solution with water so that the concentration of the bacteria after dilution is 10 6 ~10 8 CFU / mL to obtain a fermentation broth.

[0099] (3) Inoculate the fermentation broth onto the rehumidified cigar tobacco leaves at a ratio of 20%.

[0100] (4) Put the inoculated tobacco leaves into gunny bags and place them in a constant temperature and humidity fermentation chamber for fermentation. The fermentation temperature is 35 °C, the relative humidity is 75%, and the fermentation time is 21 days.

[0101] Test:

[0102] (1) Place the fermented cigar tobacco leaf samples in an oven at 45 °C for drying. After passing through a 0.25 mm sieve, use gas chromatography-mass spectrometry (GC-MS) to determine the contents of total sugar, alkaloids, and aroma components.

[0103] (2) Roll the fermented tobacco leaf samples into single-flavor cigarettes with a length of 110 mm and a diameter of 14 mm, and cure them in a Binder constant temperature and humidity box at a temperature of 18 °C and a relative humidity of 65% for 1 month for sensory evaluation. Organize a sensory quality evaluation expert group to conduct sensory quality evaluation.

[0104] The sensory quality evaluation standard refers to the product technical standard of Great Wall Cigar Factory, "Style Characteristics and Sensory Evaluation Method of 'Mellow and Sweet Aroma' Chinese Cigars" QJ / 08.J.6005-2020A for the sensory quality evaluation standard.

[0105] Comparative Example 1

[0106] The fermentation method of the cigar tobacco leaves in Comparative Example 1 is basically the same as that in Example 1, except that pure water is inoculated onto the surface of the rehydrated cigar tobacco leaves according to a volume ratio of 20%.

[0107] Other steps and parameter conditions are the same as those in Example 1.

[0108] The results of the aroma component contents after the fermentation of the cigar tobacco leaves in the above examples and comparative examples are shown in Table 5.

[0109] Table 5

[0110]

[0111] The sensory quality score results of the above examples and comparative examples are shown in Tables 6 and 7. Figure 2 It is a comparison chart of the quality characteristics of the tobacco products in Example 1 and Comparative Example 1; Figure 3 It is a comparison chart of the aroma characteristics in Example 1 and Comparative Example 1.

[0112] Table 6

[0113] Characteristic Example 1 Comparative Example 1 Amount of aroma 6 5 Richness 6 5 Maturity 6 5 Irritation 5.5 5 Softness 6 5 Fineness 6 5 Sweetness 6 5 Cleanliness 5.5 5 Aftertaste 6 5 Combustibility 7 6 Grey color 7 6 Degree of coagulation grey 6.5 6

[0114] Table 7

[0115] Fragrance type Example 1 Comparative Example 1 Caramelized sweet aroma 3 2 Nutty aroma 2 2 Woody aroma 2 1 Baked aroma 2 1 Bean aroma 1 1

[0116] The detection results of the biochemical indexes of the above-mentioned examples and comparative examples are shown in Table 8. Figure 4 It is a comparison chart of biochemical indexes in Example 1 and Comparative Example 1.

[0117] Table 8

[0118] Type Example 1 Comparative Example 1 Total sugar (%) 33.8 100 Alkaloid (%) 78 100

[0119] Experiments show that compared with fermenting cigar tobacco leaves with sterile water in Comparative Example 1, the total sugar in cigar tobacco leaves intensively fermented by Rhodotorula bijugata decreased by 66.2%, and the total alkaloids decreased by 22%. In terms of aroma components, compared with Comparative Example 1, the degradation products of chlorophyll (e.g., neophytadiene), the degradation products of carotenoids (e.g., dihydroactinidiolide; 5,6,7,7a-tetrahydro-4,7,7a-trimethyl-2-(4H)-benzofuranone, etc.), the degradation products of cembranes (e.g., cembrene, etc.) and other aroma components (2,4-di-tert-butylphenol) increased by 3.8%. The smoking evaluation results also show that the miscellaneous gas irritation in the group of intensive fermentation by Rhodotorula bijugata decreased significantly, the caramel-like fragrance, baking fragrance, and woody fragrance increased, the smoke became more mellow, and the aroma quantity increased.

[0120] The technical features of the above-mentioned examples can be combined arbitrarily. For the sake of concise description, not all possible combinations of the technical features in the above-mentioned examples are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered as the scope recorded in this specification.

[0121] The above-mentioned examples only represent several implementation manners of the present application, and their descriptions are relatively specific and detailed, but they should not be construed as a limitation on the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present application, several modifications and improvements can still be made, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the appended claims.

Claims

1. A Rhodotorula diobovata, characterized in that, The preservation number is CGMCC No. 32322.

2. A biological preparation, characterized in that, The biological agent includes one or more of the Rhodotorula rubra in the shape of double inverted ovals described in claim 1, the culture of the Rhodotorula rubra in the shape of double inverted ovals described in claim 1, the lysate of the Rhodotorula rubra in the shape of double inverted ovals described in claim 1, and the extract of the Rhodotorula rubra in the shape of double inverted ovals described in claim 1.

3. Use of the Rhodotorula rubra in the shape of double inverted ovals described in claim 1 or the biological agent described in claim 2 in the preparation of tobacco products.

4. The application according to claim 3, wherein The varieties of the tobacco products include one or more of cigar tobacco leaves, flue-cured tobacco, and sun-cured tobacco.

5. The application according to any one of claims 3 to 4, characterized in that The preparation method of the tobacco products includes: Fermenting tobacco leaves with the Bacillus paralicheniformis described in claim 1 or the biological agent described in claim 2 to prepare tobacco products.

6. The application according to claim 5, wherein The fermentation treatment includes the following steps: Culturing the Rhodotorula rubra in the shape of double inverted ovals, collecting the culture solution to obtain a bacterial solution; and Mixing the bacterial solution and the tobacco leaves for fermentation treatment.

7. The application according to claim 6, characterized in that The conditions for the culturing include: placing the Rhodotorula rubra in the shape of double inverted ovals in a sterilized liquid medium, and culturing at 28°C to 30°C and 180 rpm to 220 rpm for 24 h to 48 h; Optionally, the nutrients in the liquid medium include: 0.1% (w / v) to 10% (w / v) peptone, 0.01% (w / v) to 5% (w / v) yeast powder, 0.1% (w / v) to 10% (w / v) glucose, and the pH of the liquid medium is 5.5 to 7.

0.

8. The application according to any one of claims 6 to 7, characterized in that, The cell concentration in the bacterial liquid is 10 6 cells / mL to 10 8 cells / mL; And / or, the volume-mass ratio of the bacterial solution to the tobacco leaves is (10 to 30) mL: 100 g.

9. The application according to any one of claims 6 to 7, characterized in that The temperature of the fermentation treatment is 30°C to 35°C, the relative humidity of the fermentation treatment is 70% to 75%, and the time of the fermentation treatment is 20 days to 30 days.

10. A tobacco product, characterized in that, It contains the product of the mixed fermentation of the Rhodotorula rubra in the shape of double inverted ovals described in claim 1 and / or the biological agent described in claim 2 and tobacco leaves.

Images