Candida auricula B9J08001173 gene overexpression strain, preparation method thereof and application of candida auricula B9J08001173 gene overexpression strain in drug resistance research

Abstract

The invention relates to a candida auricula B9J08001173 gene overexpression strain, a preparation method thereof and application of the candida auricula B9J08001173 gene overexpression strain in drug resistance research. The Candida auris B9J08001173 gene overexpression strain is preserved in the China General Microbiological Culture Collection Center on February 19, 2025, and the preservation number of the Candida auris B9J08001173 gene overexpression strain is CGMCC (China General Microbiological Culture Collection Center) NO. 33592. The Candida auricula B9J08001173 gene overexpression strain CF1 (OE1173) is constructed for the first time at home and abroad, is an effective model for researching the function of the B9J08001173 gene and the action mechanism of the B9J08001173 gene in the drug resistance of the Candida auricula, can be used for researching the mechanism related to the drug resistance of fluconazole, and has great significance in research and development of related drugs and clinical research and medication guidance.

Description

Technical Field

[0001] The present invention relates to an overexpression strain of Candida auris B9J08_001173 gene, a preparation method thereof, and an application thereof in drug resistance research. Background Art

[0002] Candida auris was first reported in Japan in 2009 (Satoh, K.; Makimura, K.; Hasumi, Y.; Nishiyama, Y.; Uchida, K.; Yamaguchi, H. Candida auris sp. nov., a novel ascomycetous yeast isolated from the external ear canal of an inpatient in a Japanese hospital. Microbiol. Immunol. 2009, 53, 41 - 44, strain number DSM21092 = CBS10913 = JCM15448, clade Ⅱ, East Asian branch). It has strong viability and can survive for a long time, and is extremely likely to cause nosocomial outbreak infections. Compared with antibiotics, the varieties of antifungal drugs are very limited, and there are even fewer safe and effective drugs available for systemic candidiasis infections. There have been reports from multiple countries that clinical isolates of Candida auris are resistant to a variety of antifungal drugs, and the resistant varieties are not limited to triazoles. Candida auris can be resistant to azole antifungal drugs such as fluconazole and voriconazole, polyenes (such as amphotericin B), echinocandins (such as caspofungin), and other antifungal drugs, showing a phenomenon of multidrug resistance, which has never occurred in other Candida species. It is similar to superbugs such as methicillin-resistant Staphylococcus aureus (MRSA) that are resistant to multiple antibiotics, so some people call it a "super pathogen" (Sarma, S.; Upadhyay, S. Current perspective on emergence, diagnosis and drug resistance in Candida auris. Infect Drug Resist 2017, 10, 155 - 165).

[0003] Previously, the applicant used the Candida auris Japanese isolate CBS10913 (marked as CF1 in this patent) as the starting strain to induce a series of Candida auris fluconazole-resistant models (such as Chinese patents CN 115044478 B and CN 114933972 B). The aforementioned resistant models can well simulate the in vitro drug-resistant evolution process of Candida auris. When conducting research, the applicant found that to deeply study the drug-resistant mechanism of Candida auris, it is also necessary to study the specific target genes that regulate Candida auris drug resistance. However, the above models cannot locate the specific target genes involved. Therefore, further research needs to be carried out in constructing Candida auris gene knockout and overexpression strain models to provide data support and experimental evidence for clinical drug use.

[0004] During the research process, the applicant constructed a Candida auris fluconazole-resistant model through genomics, proteomics and other detections, and screened a significantly differentially expressed gene. By blasting this gene on the NCBI website, it was found that it had 100% match with the B9J08_001173 gene of Candida auris strain B8441 (Pakistani isolate) in the database. After translating the nucleotide sequence, the amino acid sequence was obtained. By comparing this amino acid sequence with the Uniport protein database, it was found that it had 100% match with the A0A2H1A153 protein of Candida auris strain B8441 (Pakistani isolate) in the database. The A0A2H1A153 protein in the Uniport protein database is recommended to be named NAD-dependent protein deacetylase. By comparing this protein with the domain database, it may be the SIR2 family, but there have been no reports on the expression of this gene, nor any literature reports on the study of the function of this gene. Through NCBI-Blast comparison, the applicant found that the Candida auris B9J08_001173 gene had 69% similarity with the HST2 deacetylase of Clavispora lusitaniae, 68% similarity with the HST2 deacetylase of Scheffersomyces stipitis, 69% similarity with the HST2 deacetylase of Lodderomyces elongisporus, and 67% similarity with the HST2 deacetylase of Candida albicans. Currently, there have been no reports on the expression of the target gene B9J08_001173 of Candida auris, and even less reports on studying the drug resistance of Candida auris with the overexpression of the B9J08_001173 gene as the entry point.

[0005] In September 2023, the paper "Functional Expression of Recombinant Candida auris Proteins in Saccharomyces cerevisiae Enables Azole Susceptibility Evaluation and Drug Discovery" by Stephanie Toepfer et al. (University of Otago, New Zealand) was published in the Journal of Fungi (Basel), 2023, 9(2). This paper disclosed a method for constructing overexpression transformation units of Candida auris ERG11, MDR1, or CDR1 using the Saccharomyces cerevisiae PDR5 gene transposon and introducing them into the host strain Saccharomyces cerevisiae Y1857 to overexpress the Candida auris ERG11, MDR1, or CDR1 genes. This method requires a specific host strain, and both the host strain and the overexpression transposon are from Saccharomyces cerevisiae, which may result in the inability to truly express the higher-order structure and post-translational modification of Candida auris proteins. Summary of the Invention

[0006] The technical problem to be solved by the present invention is that the existing fluconazole-resistant model of Candida auris cannot locate the specific target gene. The present invention provides an overexpression strain of Candida auris with the B9J08_001173 gene, a preparation method thereof, and its application in drug resistance research.

[0007] The overexpression strain CF1 (OE1173) of Candida auris with the B9J08_001173 gene has been deposited with the China General Microbiological Culture Collection Center on February 19, 2025, and the deposit number is CGMCC NO. 33592.

[0008] After sequencing, the DNA nucleotide sequence of the expression strain CF1 (OE1173) of the Candida auris B9J08_001173 gene of the present invention is as follows:

[0009]

[0010] Its ITS1 / ITS4 fragment sequence is as follows:

[0011] AGCATTTGAATTTTGCTACACACTGATTTGGATTTTAAACTAACCCAACGTTAAGTTCAACTAAACTATAAAGAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTATGACTTGCAGACGTGAATCATCGAATCTTTGAACGCACATTGCGCCTTGGGGTATTCCCCAAGGCATGCCTGTTTGAGCGTGATGTCTTCTCACCAATCTTCGCGGTGGCGTTGCATTCACAAAATTACAGCTTGCACGAAAAAAATCTACGCTTTTTTTTCGTTTTGTTGTCGCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCATAAAGGCGGAGGAA

[0012] Its NL1 / NL4 fragment sequence is as follows:

[0013] GGGATTGCCATGCCTCAGTACGGCGAGTGAGCGGCAAGAGCTCAACTTTGGAATCGCTCCGGCGAGTTGTAGTCTGGAGGTGGCCACCACGAGGTGTTCTAGCAGCAGGCAAGTCCTTTGGAACAAGGCGCCAGCGAGGGTGACAGCCCCGTACCTGCTTTTGCTAGTGCTTCCTGTGGCCCACCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGCACCCAGACACGGTTTCGGCCGGGCCAGCATCAAGTAGAACGGGGTTAAAAGACCTGGGGAATGTAGCTACCTCTTGGTAGTGTTATAGCCCTTGGGTGATGACCCCTGTTTTGCTTGAGGACAGCGGTCTCTAGGATGCTGGCGCAATGGTTGCAAGCCACCCGCAAAACCTTGCCCACACAACG

[0014] The Candida auris overexpression strain CF1 (OE1173) of the B9J08_001173 gene described in the present invention was obtained by the following method:

[0015] 1) Extract the genomic DNA of Candida auris;

[0016] 2) Construct a recombinant plasmid containing the Candida auris B9J08_001173 gene;

[0017] Design primers containing restriction enzyme sites to amplify the B9J08_001173 gene. After double digestion of the target fragment and plasmid pTDH3, they were ligated into a recombinant plasmid. After confirming the correctness of the target fragment - recombinant plasmid by PCR, restriction enzyme digestion, and sequencing, it was introduced into Escherichia coli for standby and screened with ampicillin. Perform integrity analysis of the "pTDH3 - B9J08_001173" recombinant plasmid to prepare for subsequent overexpression experiments;

[0018] 3) Extract the "pTDH3 - B9J08_001173" recombinant plasmid and then perform electroporation;

[0019] Using Candida auris East Asian clade (CBS10913, CF1) as the parental strain, prepare electrocompetent cells of Candida auris. After linearizing the recombinant plasmid by single enzyme digestion, mix the enzyme digestion product of the recombinant plasmid with Candida auris electrocompetent cells, add them to an electroporation cuvette for electroporation. After resuspending with sorbitol and centrifuging, add YPD and culture at 30°C and 150 rpm for 4 h. Take the bacterial solution and spread it on a YPD solid plate, and culture at 30°C for about 5 - 7 days to harvest the transformants.

[0020] In step 3), the voltage for electroporation in the electroporation cuvette is 1500 V, and the YPD medium contains 2% peptone, 1% yeast extract, 2% glucose, 2% agar, and 200 μg / mL nourseothricin.

[0021] 4) Verification

[0022] Verify the transformants by PCR, enzyme digestion, and sequencing to confirm whether the target sequence is integrated into the genome of the Candida auris parental strain, and then verify by qPCR to confirm the high expression of the target sequence in the transformants, thus completing the preparation of the overexpression strain.

[0023] The overexpression plasmid pTDH3 used in the present invention was kindly provided by the team of Professor Huang Guanghua and Associate Researcher Bing Jian of Fudan University. The method for obtaining it was introduced in detail by the team of Professor Huang Guanghua and Associate Researcher Bing Jian in the article "Amplification of the ALS4 gene enhances the adhesion and biofilm formation of clinical isolates of Candida auris" published in "Plos Pathogens" [PLoS Pathog, 2023.19(3): p.e1011239]. In this application, the East Asian clade of Candida auris (CBS10913, CF1) was selected as the recipient strain for constructing the overexpression strain CF1 (OE1173) of the B9J08_001173 gene.

[0024] The parental strain of Candida auris East Asian clade (CBS10913, CF1) and the drug-resistant Candida auris CF6 involved in this application are preserved in the Medical Mycology Sub-center of the China Center for Disease Control and Prevention of Pathogenic Microorganisms (CAMS-CCPM-D).

[0025] After a series of tests by the applicant, it was verified that the overexpression strain of the B9J08_001173 gene of Candida auris can be used for research related to fluconazole resistance in Candida auris:

[0026] 1. qPCR was used to detect the overexpression of the B9J08_001173 gene in recombinant Candida auris:

[0027] The parent strain CF1 of Candida auris was selected as a control, and the pTDH3-B9J08_001173 transformant [named CF1(OE1173) strain] was verified by qPCR, with three replicates for each specimen. Primers for the reference gene (ACT1) and the target gene (B9J08_001173) were designed, RNA was extracted, and the expression level of the gene was detected after reverse transcription. The qPCR amplification curve and melting curve were observed, and the CT value was calculated. The expression of B9J08_001173 gene in parent strain CF1 and overexpression strain CF1 (OE1173) was calculated. The overexpression of the B9J08_001173 gene in the constructed recombinant overexpression strain CF1 (OE1173) was observed by the difference fold, thereby indicating whether the B9J08_001173 gene overexpression strain was successfully constructed.

[0028] 2. Growth curve before and after drug treatment:

[0029] The Danish BioSense microbial growth dynamic monitoring system (oCelloScope TM ) Determine the growth curve of each strain before and after fluconazole treatment, analyze the data using the BCANormalized, SESANormalized or TANormalized algorithm provided by the software, and compare the effects of drug treatment on growth.

[0030] 3. Mass spectrometry identification of strains:

[0031] The strains involved in the present invention were cultured at a rate of 1 to 5 × 10 6 CFU·mL -1 The concentration was inoculated onto the YPD solid medium slant, and the bacterial colony was grown in a 28℃-35℃ incubator for 24-72h. The bacterial colony was picked and coated on the target plate, and 1μL 70% formic acid was added and dried in a biosafety cabinet or in a 50℃ metal bath for 3-5min. 1μL matrix solution (HCCA, acetonitrile, trifluoroacetic acid mixture) was added and dried, and then tested on the machine (AUTOF MS1000 mass spectrometer).

[0032] 4. Take photos and observe the strain under a microscope.

[0033] This application has the following technical effects:

[0034] 1. The present invention targets the target gene B9J08_001173 of Candida auris [CBS10913 (CF1), Japanese isolate], constructs a pTDH3-B9J08_001173 overexpression recombinant plasmid, electrophoretically transfers it to Candida auris (CF1) and detects the overexpression. The specific host strain is not limited. The overexpression of the gene in Candida auris can better reflect the function of the high-level structure and post-translational modification of the Candida auris protein.

[0035] 2. The existing fluconazole-resistant model of Candida auris still cannot locate the specific target gene. There is no relevant research on the Candida auris B9J08_001173 gene and the overexpression of the B9J08_001173 gene at home and abroad. This application provides an overexpression strain of Candida auris with the B9J08_001173 gene, its preparation method, and its application in drug resistance research. During the construction of the overexpression of the B9J08_001173 gene, electroporation is used instead of chemical transfection to improve the transformation efficiency and reduce operations; the integrity analysis of the "pTDH3-B9J08_001173" recombinant plasmid is increased to prepare for subsequent overexpression; sequencing is applied to each verification process to improve efficiency and reduce errors; the Danish BioSense microbial growth dynamic monitoring system (oCelloScope TM ) can be used to observe the growth of each strain, improve efficiency, reduce operation steps, and save labor.

[0036] 3. By comparing the recipient strain CF1 (sensitive strain) and the drug-resistant strain CF6, it was found that under the action of 2 μg / mL fluconazole, the overexpression strain of Candida auris with the B9J08_001173 gene CF1 (OE1173) can reduce the fluconazole resistance of the sensitive strain and increase its drug sensitivity. The overexpression strain of Candida auris with the B9J08_001173 gene can be used to study the mechanism related to fluconazole resistance.

[0037] 4. This application is the first to construct an overexpression strain CF1 (OE1173) of the Candida auris B9J08_001173 gene at home and abroad. It is an effective model for studying the function of the B9J08_001173 gene and the mechanism of action of the B9J08_001173 gene in Candida auris drug resistance. It can be used to study the mechanism related to fluconazole resistance, which is of great significance for related drug research and development and has important significance for clinical research and medication guidance. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 The double digestion analysis was used to analyze the structural integrity of the "pTDH3-B9J08_001173" recombinant plasmid. The double digestion products can be seen in the second lane, indicating that the recombinant plasmid has a complete structure, laying the foundation for subsequent overexpression.

[0039] Figure 2 shows the qPCR verification of the overexpression of the B9J08_001173 gene in recombinant Candida auris, where:

[0040] Figure 2(1) is the amplification curve of the ACT1 gene;

[0041] Figure 2(2) is the amplification curve of the B9J08_001173 gene;

[0042] Figure 2(3) is the melting curve of the ACT1 gene;

[0043] Figure 2(4) is the melting curve of the B9J08_001173 gene;

[0044] Figure 3 To analyze the RNA expression level of the B9J08_001173 gene

[0045] Figure 4 shows the morphological photos of each strain under the microscope, where:

[0046] Figure 4(1) is the morphological photo of the recipient strain CF1 under the microscope;

[0047] Figure 4(2) is the morphological photo of the drug-resistant strain CF6 under the microscope;

[0048] Figure 4(3) is the morphological photo of the Candida auris B9J08_001173 gene overexpression strain CF1 (OE1173) under the microscope.

[0049] Figure 5 shows the mass spectra of each strain, where:

[0050] Figure 5(1) is the mass spectrum of the recipient strain CF1;

[0051] Figure 5(2) is the mass spectrum of the drug-resistant strain CF6;

[0052] Figure 5(3) is the mass spectrum of the Candida auris B9J08_001173 gene overexpression strain CF1 (OE1173).

[0053] Figure 6 shows the growth curves of each strain before and after fluconazole treatment observed by the BioSense microbial growth dynamic monitoring system (BCANormalized algorithm), where:

[0054] As shown in Figure 6(1), in the 1640 medium without adding drugs, A2 is the growth curve of the fluconazole-sensitive strain CF1; the fluconazole-resistant strain CF6 is represented by B2 and B3 in the figure; the Candida auris B9J08_001173 gene overexpression strain CF1 (OE1173) is represented by D1, D2, and D3 in the figure.

[0055] As shown in Figure 6(2), after treatment with 2 μg / mL fluconazole + 1640 medium, the fluconazole-sensitive strain CF1 is represented by A5 and A6 in the figure; the fluconazole-resistant strain CF6 is represented by B4 and B6 in the figure; the Candida auris B9J08_001173 gene overexpression strain CF1 (OE1173) is represented by D5 and D6 in the figure. Detailed implementation method

[0056] 1. Prepare the Candida auris B9J08_001173 gene overexpression strain.

[0057] Since the function of the Candida auris B9J08_001173 gene is unknown, in order to detect whether the B9J08_001173 gene has deacetylase function and its key role in the drug-resistant evolution process of Candida auris, this application first constructed a plasmid overexpressing the Candida auris B9J08_001173 gene according to the following steps.

[0058] 1) Extract the genomic DNA of Candida auris:

[0059] Take MP tubes, add 600 μl of FG1 to each tube for lysis, and pick 1×10 8Transfer bacteria at a concentration of cells / mL into an MP tube, and place the MP tube in a "cell disruptor" (select the "fungus" program). Take out the disrupted MP tube and incubate it in a water bath: 65 °C, 10 min. During this period, invert the tube gently up and down 2 times, then add 140 μl of FG2. After vortexing, centrifuge the mixture together in a centrifuge: 10,000 rpm, 10 min. After centrifugation, take out the MP tube, and sequentially aspirate the supernatant (600 μl) into the EP tubes of Group No. 1, and centrifuge again: 10,000 rpm, 2 min. At this time, prepare the HiBind DNA columns and label them on the cap and the tube wall. Transfer the centrifuged supernatant (400 μl) to the EP tubes of Group No. 2, and then add isopropanol with a volume 0.7 times that of the supernatant volume (280 μl). After adding all the components, tighten the cap, shake the tube gently up and down twice to mix evenly, and then centrifuge again: 10,000 rpm, 2 min. Gently pour the supernatant in the centrifuged EP tube directly into the waste liquid tank, invert the EP tube on a paper towel, and let it stand for 1 - 5 min. Sequentially add 300 μl of deionized water (preheated in a 65 °C water bath) to each EP tube and pipette about 10 times. Then sequentially add 300 μl of absolute ethanol (no preheating) to the EP tubes. Then sequentially add 150 μl of FG3. Add 5 μl of "RNase-free" solution, and change the pipette tip for each tube and pipette to mix evenly twice. Then use a 1000 μl pipette to transfer the liquid in the EP tubes into the filter membrane one by one. Tighten the cap and centrifuge: 10,000 rpm, 1 min. Pour the liquid in the collection tube into the "waste liquid tank", and then sequentially add 600 μl of DNA elution buffer to the filter membrane. Then centrifuge: 10,000 rpm, 1 min. Again, sequentially pour the liquid in the collection tube into the "waste tank". Then tighten the "filter membrane cap" one by one. Open the "filter membrane cap", add 600 μl of DNA elution buffer again, and centrifuge again: 10,000 rpm, 1 min. Again, sequentially pour the liquid in the collection tube into the "waste tank". Blot the moisture at the tube mouth on a paper towel. Then tighten the cap and centrifuge again: 10,000 rpm, 1 min. Then take out the filter membrane and place it in the corresponding numbered EP tubes of Group No. 3. Then add 50 - 100 μl of deionized water (preheated at 65 °C, with equal volume for each tube) from the filter membrane tube mouth. Then tighten the cap and let it stand at room temperature for 2 - 3 min. Centrifuge again: 10,000 rpm, 1 min. Discard the filter membrane, and store the extracted DNA in the EP tube and freeze it at -20 °C in the refrigerator.

[0060] 2) Preparation process of the recombinant vector:

[0061] Construct the overexpression recombinant plasmid "pTDH3 - B9J08_001173"

[0062] Design the primer sequences for amplifying the B9J08_001173 gene:

[0063] CF1173F: 5'-ggtaccATGTTTTTTTCGACTCCAACCC-3’

[0064] CF1173R: 5'-gatatcTCAAAGCGACAATTTGCCGAG-3'

[0065] Amplify the DNA sequence of the B9J08_001173 gene, namely "EcoRⅤ-B9J08_001173-KpnI", from the genomic DNA of Candida auris. Connect the DNA sequence of the B9J08_001173 gene "EcoRⅤ-B9J08_001173-KpnI" to the pTDH3 plasmid after double digestion, and ligate the digestion products into the "pTDH3-B9J08_001173" recombinant plasmid. Verify by sequencing primer: AAGTCATCCAACGCCCGAAT, and obtain the following 801bp recombinant sequence. Among them, 593bp is the target sequence of B9J08_001173 (bold + underlined), and the rest is part of the vector sequence.

[0066]

[0067]

[0068] The above sequencing results indicate that the "pTDH3-B9J08_001173" recombinant plasmid has been constructed and is transformed into competent Escherichia coli TOP10 cells for standby.

[0069] Analysis of the integrity of the "pTDH3-B9J08_001173" recombinant plasmid: Digest the extracted recombinant plasmid with HindIII-XbaI double digestion, and observe the digestion bands. As Figure 1 shown, the structure of the "pTDH3-B9J08_001173" recombinant plasmid is intact and can be used for subsequent overexpression experiments.

[0070] 3) Introduce the recombinant vector into the host:

[0071] ① Preparation of competent Candida auris cells:

[0072] Inoculate Candida auris CF1 into 50 mL of YPD liquid medium (2% peptone, 1% yeast extract, 2% glucose), and culture overnight at 30 °C with 150 rpm until the OD value is about 0.8. Wash twice with 40 mL of ddw and discard the supernatant. Add 8 mL of ddw, 1 mL of 10×TE (pH 8.0), and 1 mL of 1 M LioAC, mix well for 1 hour, add 250 μl of 1 M DTT, and after centrifugation, add 500 μl of 1 M sorbitol and keep it on ice for standby.

[0073] ② Electroporation:

[0074] The recombinant plasmid "pTDH3 - B9J08_001173" was linearized by single - enzyme digestion. Take 10 μl of the recombinant plasmid digestion product and mix it with 60 μl of Candida auris competent cells, add it to the electroporation cuvette, perform electroporation at 1500 V, resuspend with 1 mL of 1 M sorbitol, centrifuge at 300 rpm for 2 min, add 1 mL of YPD, culture at 30 °C and 150 rpm for 4 h. Take 200 μl of the bacterial solution and spread it on a YPD solid plate (2% peptone, 1% yeast extract, 2% glucose, 2% agar, containing 200 μg / mL nourseothricin), and collect the transformants after culturing at 30 °C for about 5 - 7 days.

[0075] 4) Sequencing verified the DNA nucleotide sequence of the B9J08_001173 gene overexpression strain CF1 (OE1173):

[0076]

[0077] The above - bolded and underlined part is the target sequence of B9J08_001173, and the rest is the vector sequence, indicating that the recombinant plasmid was integrated into the Candida auris genome.

[0078] 5) Detection of the overexpression of the B9J08_001173 gene in recombinant Candida auris

[0079] Select the parental strain CF1 of Candida auris as a control, and use qPCR to verify the pTDH3 - B9J08_001173 transformants [named CF1 (OE1173) strain], with three replicates for each specimen. The primer sequences are shown in Table 1, where ACT1 is the reference gene.

[0080] Primer Name Primer Sequence B9J08_001173-F CTGATGATGTGGAAGTAG B9J08_001173-R TGAACGATTATGTCTGATT ACT1-F CGTCGGTAGACCAAGACACC ACT1-R CCCAGTTGGAGACAATACCGT

[0081] Table 1 qPCR primer sequences

[0082] The amplification curve and melting curve are shown in Figure - 1. Among them, Figure 2(1) is the amplification curve of the ACT1 gene, Figure 2(2) is the amplification curve of the B9J08_001173 gene, Figure 2(3) is the melting curve of the ACT1 gene, and Figure 2(4) is the melting curve of the B9J08_001173 gene. The overexpression result of the B9J08_001173 gene is as Figure 3 shown. The RNA expression level of the B9J08_001173 gene in the B9J08_001173 / CF1 strain (2 -△△CT ) is 66.0025 times that of the parental strain CF1, indicating that the overexpression strain CF1 (OE1173) of B9J08_001173 was successfully constructed.

[0083] 2. Observation of strain morphology:

[0084] Using the Candida auris parental strain CF1 and the drug-resistant strain CF6 as controls, the morphology of the B9J08_001173 gene overexpression strain was observed under a 40× microscope, as shown in Figure 4.

[0085] Figure 4(1) is CF1, Figure 4(2) is CF6, and Figure 4(3) is the Candida auris strain CF1 (OE1173) with overexpression of the B9J08_001173 gene.

[0086] 3. Mass spectrometry identification:

[0087] Using the Candida auris parental strain CF1 and the drug-resistant strain CF6 as controls, the B9J08_001173 gene overexpression strain CF1 (OE1173) was identified by mass spectrometry.

[0088] Each strain was inoculated onto the slope of YPD solid medium at a concentration of 1×10 6 CFU·mL -1 The colonies grew out in a 28°C incubator for 48 h. The colonies were picked and smeared on the target plate, and 1 μL of 70% formic acid was added and dried in a biosafety cabinet or dried in a 50°C metal bath for 5 min. Then 1 μL of matrix solution (a mixture of HCCA, acetonitrile, and trifluoroacetic acid) was added and dried, and then detected on a machine (AUTOF MS1000 mass spectrometer). The identification results showed that Candida auris CF1, CF6, and the B9J08_001173 gene overexpression strain CF1 (OE1173) were all Candida auris. At the same time, it was found that there were differences in the characteristic peaks of each strain, as shown in Figure 5 for details.

[0089] Figure 5(1) is CF1, Figure 5(2) is CF6, and Figure 5(3) is the Candida auris strain CF1 (OE1173) with overexpression of the B9J08_001173 gene.

[0090] 4. Biosence dynamic growth:

[0091] The growth curves of each strain before and after fluconazole treatment were measured using the Danish BioSense microbial growth dynamic monitoring system (oCelloScope TM ), and the effects of drug treatment on the growth were compared. Differences in the growth of induced strains were observed from the BCANormalized analysis chart, as shown in Figure 6 for details.

[0092] As shown in Figure 6(1), in the 1640 medium without drug, each Candida auris strain could grow normally. Among them, the Candida auris fluconazole-sensitive strain CF1 is represented by A2 in the figure; the Candida auris fluconazole-resistant strain CF6 is represented by B2 and B3 in the figure; the Candida auris strain CF1 (OE1173) with overexpression of the B9J08_001173 gene is represented by D1, D2, and D3 in the figure.

[0093] As shown in Figure 6(2), after treatment with 2 μg / mL fluconazole + 1640 medium, compared with the fluconazole-resistant strain CF6, the growth of the Candida auris strain CF1 (OE1173) with overexpression of the B9J08_001173 gene was not as good as that of the fluconazole-sensitive strain CF1. This indicates that under the action of 2 μg / mL fluconazole, the Candida auris strain CF1 (OE1173) with overexpression of the B9J08_001173 gene can reduce the fluconazole resistance of the sensitive strain and increase its drug sensitivity. Among them, the fluconazole-sensitive strain CF1 is represented by A5 and A6 in the figure; the fluconazole-resistant strain CF6 is represented by B4 and B6 in the figure; the Candida auris strain CF1 (OE1173) with overexpression of the B9J08_001173 gene is represented by D5 and D6 in the figure.

Images