A method for detecting double allele edited cells based on CRISPR / Cas12a technology

By designing specific crRNA binding target nucleotide sequences and Cas12a protein, a CRISPR/Cas12a fluorescence detection or colloidal gold test strip detection system was constructed, solving the problem of difficulty in rapidly and accurately identifying CRISPR/Cas9-induced bicelestem-edited cells in existing technologies, and achieving efficient and economical detection results.

CN120290555BActive Publication Date: 2026-02-27AGSINO GENSOURCES CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411769301.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-04
Publication Date
2026-02-27
Estimated Expiration
2044-12-04

AI Technical Summary

Technical Problem

Existing detection methods are difficult to quickly and accurately identify CRISPR/Cas9-induced biallelic gene editing cells, and are characterized by complex operation, time consumption, and low sensitivity.

Method used

The nucleotide sequence for the specific crRNA binding target was designed as SEQ ID NO.6, and combined with the Cas12a protein. Using single-stranded DNA probes with specific amplification primer pairs and labeled groups, a CRISPR/Cas12a fluorescence detection or colloidal gold test strip detection system was constructed to achieve rapid screening of CD71 gene bis-allelic edited cells.

Benefits of technology

This method enables a simple, rapid, cost-effective screening of CD71 gene biallelic edited cells, improving the accuracy and sensitivity of detection and enabling the identification of biallelic edited cells in a short time.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application discloses a method for detecting double allelic gene edited cells based on CRISPR / Cas12a technology. The application provides crRNA, wherein the nucleotide sequence of a target point is SEQ ID NO. 6. The crRNA is obtained by in vitro transcription of a transcription template; the transcription template is a product obtained by annealing of a single-stranded DNA molecule shown in SEQ ID NO. 10 and a single-stranded DNA molecule shown in SEQ ID NO. 13. The application provides crRNA of a CD71 gene, and a CRISPR / Cas12a system is constructed by using the crRNA, CRISPR / Cas12a detection is carried out, double allelic gene edited cells of the CD71 gene induced by CRISPR / Cas9 are screened, and the method is simple, easy, fast, and convenient for economically and effectively screening a large number of mutant cells.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological detection, and particularly relates to a method for detecting double allele editing cells based on CRISPR / Cas12a technology. BACKGROUND

[0002] The CD71 gene is also known as transferrin receptor 1, which is a type II transmembrane glycoprotein composed of 760 amino acids, located on chromosome 13 of pigs, and has a size of about 51 kb. CD71 has an important function in the field of cancer. The expression level of CD71 in cancer tissues is significantly higher than that in normal tissues. By using specific antibodies to bind with CD71, the abnormal proliferation process of cells can be effectively inhibited, and cell apoptosis can be induced. At the same time, CD71 activates T cells and triggers non-antibody-dependent immune response reactions by participating in the signal transduction process of inducing T cells. Therefore, screening CD71 gene double allele editing cells has important significance for in-depth study of its function.

[0003] However, it has always been a challenge to efficiently and accurately detect double allele editing cells. The existing detection methods have problems such as complex operation, time-consuming, low sensitivity, etc. The CRISPR / Cas12a system is a kind of RNA-guided DNA endonuclease technology, the core of which is that the Cas12a protein forms a complex with a specifically designed CRISPR RNA (crRNA), which can accurately recognize and target the DNA region containing a specific PAM sequence, and cut downstream of the PAM sequence to produce a DNA double-strand break. After the Cas12a protein cuts the target DNA, it enters an activated state and exhibits non-specific collateral cleavage activity, which can cut nearby non-target DNA molecules. This feature is applied to the CRISPR / Cas12a-based nucleic acid detection system, which has great potential in the field of mutation detection. SUMMARY

[0004] The technical problem solved by the present application is how to quickly and accurately identify double allele editing cells induced by CRISPR / Cas9.

[0005] In order to solve the above technical problem, the first aspect of the present application provides a crRNA, the nucleotide sequence of the target point of which is SEQ ID NO. 6.

[0006] In the above, the target point of the CD71 gene is located in the third exon of the pig CD71 gene.

[0007] In the crRNA described above, the crRNA is obtained by in vitro transcription of a transcription template.

[0008] The transcription template is a product obtained by annealing a single-stranded DNA molecule shown in SEQ ID NO. 10 and a single-stranded DNA molecule shown in SEQ ID NO. 13.

[0009] In the crRNA described above, the nucleotide sequence of the crRNA is SEQ ID NO. 16.

[0010] In a second aspect, the present application provides a product comprising the crRNA of the first aspect.

[0011] The product described above further comprises a Cas12a protein.

[0012] In an embodiment of the present application, the Cas12a protein is LbCas12a.

[0013] The product described above further comprises a primer pair for specifically amplifying the target point; the primer pair consists of a single-stranded DNA molecule shown in SEQ ID NO. 2 and a single-stranded DNA molecule shown in SEQ ID NO. 3.

[0014] The product described above further comprises a single-stranded DNA probe, which is labeled with different groups at both ends.

[0015] And / or the groups are fluorescent groups, quencher groups and / or biotin.

[0016] The single-stranded DNA probe described above is a single-stranded DNA rich in AT bases with a length of 5-50 nt.

[0017] In an embodiment of the present application, the single-stranded DNA probe in the CRISPR / Cas12a fluorescent detection system is 6-FAM-TTATT-BHQ1; and the single-stranded DNA probe in the CRISPR / Cas12a colloidal gold test paper detection system is 6-FAM-TTTTTTTATTTTTTT-C6Biotin.

[0018] The product described above is a kit, a test strip or a fluorescent detection system.

[0019] In a third aspect, the present application provides any of the following:

[0020] A1) the Cas12a protein and the crRNA described in the second aspect, or a complex formed by the two;

[0021] A2) the primer pair described in the second aspect.

[0022] In a fourth aspect, the present application provides the use of the crRNA of the first aspect or the product of the second aspect in any of the following:

[0023] B1) detecting or assisting in detecting double allelic editing of a CD71 gene;

[0024] B2) preparing a product for detecting or assisting in detecting double allelic editing of a CD71 gene;

[0025] B3) detecting or assisting in detecting a sample of double allelic editing of a CD71 gene;

[0026] B4) preparing a product for detecting or assisting in detecting a sample of double allelic editing of a CD71 gene.

[0027] Alternatively, the present application provides a method for detecting or assisting in detecting a sample of double allelic editing of a CD71 gene, comprising the following steps:

[0028] C1) performing PCR amplification using a primer pair consisting of a single-stranded DNA molecule as shown in SEQ ID NO. 2 and a single-stranded DNA molecule as shown in SEQ ID NO. 3, with the nucleic acid of the sample to be tested as a template, to obtain a PCR product;

[0029] C2) preparing a CRISPR-Cas12a detection system containing the following components: the PCR product, the Cas12a protein described in the second aspect, the crRNA described in the second aspect, and the single-stranded DNA probe described in the second aspect;

[0030] C3) reacting the CRISPR-Cas12a detection system, detecting the reaction product, and thereby identifying whether the sample to be tested is a sample of double allelic editing of a CD71 gene.

[0031] In the above, the sample of double allelic editing of a CD71 gene is a sample in which the target region as shown in SEQ ID NO. 7 in the third exon of a CD71 gene in the sample is genetically edited, and the target region in both homologous chromosomes of the sample is genetically edited.

[0032] The above method is for non-disease diagnosis purposes.

[0033] In the above, the sample to be tested is a cell or an organism.

[0034] In embodiments of the present application, the edited CD71 gene cell may, for example, be a CD71 gene wild-type cell, a CD71 gene single allelic editing cell, and / or a CD71 gene double allelic editing cell.

[0035] The above-mentioned CD71 gene wild-type cell is a cell in which the CD71 gene on both homologous chromosomes of the cell is not genetically edited;

[0036] The CD71 gene single allele editing cell is that the target region (SEQ ID NO. 7) in the third exon of the CD71 gene on one homologous chromosome in the cell is genetically edited, and the CD71 gene on the other homologous chromosome is unchanged;

[0037] The CD71 gene double allele editing cell is that the target region (SEQ ID NO. 7) in the third exon of the CD71 gene on both homologous chromosomes in the cell is genetically edited.

[0038] The application provides a crRNA of a CD71 gene, and constructs a CRISPR / Cas12a system by using the crRNA, performs CRISPR / Cas12a detection, realizes screening of CD71 gene double allele editing cells induced by CRISPR / Cas9, and the method is simple, easy, fast, and convenient for economically and effectively screening a large number of mutant cells. BRIEF DESCRIPTION OF DRAWINGS

[0039] Figure 1 It is a PCR amplification electrophoresis result of a wild type pig ileum epithelial cell in the embodiment 1 of the application.

[0040] Figure 2 It is a sequencing result of a wild type standard plasmid of a pig CD71 gene in the embodiment 1 of the application.

[0041] Figure 3 It is a crRNA activity fluorescence intensity detection result of the crRNA targeting the wild type sequence of the pig CD71 gene in the embodiment 1 of the application. P <0.05).

[0042] Figure 4 It is a crRNA activity colloidal gold test paper detection result of the crRNA targeting the wild type sequence of the pig CD71 gene in the embodiment 1 of the application.

[0043] Figure 5 It is a result of detecting CD71 gene editing cells in part of monoclonal cells by using a fluorescence report system of crRNA-F1, crRNA-F2 and crRNA-F3 in the embodiment 2 of the application. P <0.05).

[0044] Figure 6 It is a result of detecting CD71 gene editing cells in monoclonal cells by using a fluorescence report system of crRNA-F3 in the embodiment 3 of the application. P <0.05).

[0045] Figure 7Results of screening CD71 gene edited cells in monoclonal cells by crRNA-F3 colloidal gold test paper system in embodiment 3 of the present application.

[0046] Figure 8 TA cloning results of CRISPR / Cas9 induced sgRNA edited double allele edited cells in embodiment 3 of the present application.

[0047] Figure 9 Sensitivity test results of crRNA-F3 system in embodiment 4 of the present application. ** indicates that there is a very significant difference compared with the negative control group ( P <0.01), * indicates that there is a significant difference compared with the negative control group ( P <0.05), ns indicates that there is no significant difference compared with the negative control group ( P >0.05). DETAILED DESCRIPTION

[0048] The present application will be further described in conjunction with the specific embodiments. The embodiments given herein are only to illustrate the present application, and are not intended to limit the scope of the present application. The embodiments provided below can serve as a guide for further improvement by those skilled in the art, and do not constitute a limitation on the present application in any way.

[0049] In the following examples, the experimental methods are conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified.

[0050] The present application will be further described in conjunction with the specific embodiments. The embodiments given herein are only to illustrate the present application, and are not intended to limit the scope of the present application. The embodiments provided below can serve as a guide for further improvement by those skilled in the art, and do not constitute a limitation on the present application in any way.

[0051] The main reagents used in the following examples are as follows:

[0052] LbCas12a protein (EDE0005) was purchased from Guangzhou Aidigen Biotechnology Co., Ltd.;

[0053] 10×LbCas12a Cleavage Buffer (EDE0005-B) was purchased from Guangzhou Aidigen Biotechnology Co., Ltd.;

[0054] KOD enzyme (KFX-101) was purchased from BOLINBIO (Beijing) Co., Ltd.

[0055] E. coli DH5a competent cells (B528413-0100) were purchased from Shengong Bioengineering (Shanghai) Co., Ltd.

[0056] CloneSmarter TOPO cloning kit (C5865-50) was purchased from Zymo Research (Beijing) Co., Ltd.

[0057] Plasmid endotoxin-free extraction kit (CW2105S) was purchased from Kangwei Century Co., Ltd.

[0058] PCR primers were synthesized by Beijing Qikang Biological Technology Co., Ltd.

[0059] T7 in vitro transcription kit (AM1354) was produced by Invitrogen Company.

[0060] RNA purification and recovery kit (12183018A) was produced by Invitrogen Company.

[0061] Single-stranded DNA fluorescent probe was synthesized by Shengong Bioengineering (Shanghai) Co., Ltd.

[0062] Single-stranded DNA colloidal gold probe (EDN-THD02) was purchased from Guangzhou Aidigen Biotechnology Co., Ltd.

[0063] Cas12 special nucleic acid colloidal gold detection test strip (JY0301) was purchased from Guangzhou Aidigen Biotechnology Co., Ltd.

[0064] Rnase-Free Water (9012) was purchased from Beijing Liuhetong Trading Co., Ltd.

[0065] The main instruments are as follows:

[0066] PCR instrument (BIO-RAD, C1000 Touch TM );

[0067] Tabletop high-speed refrigerated centrifuge (Thermo Scientific, Heraeus Multifuge X1R);

[0068] Bacterial incubator (SANYO, MIR-254);

[0069] Constant temperature water bath (Changzhou Nuoke Instrument Co., Ltd., HHS-21-4);

[0070] Vortex shaker (Stuart-equipment, SA8);

[0071] Electronic balance (Sartorius, Sartorius SQP);

[0072] Gel imaging system (BIO-RID, Universal Hood II);

[0073] Fluorescent quantitative PCR instrument (Thermo Scientific, QuantStudio™5).

[0074] Porcine IPI-2I cells are described in the following literature: Xu, C. J., Wang, X. P., Xu, K., Zhang, X. L., Xiang, G. M., Zhao, H. Q., Mou, Y. L., Lin, X., and Li, Q. Utilization of CRISPR / Cas9 editing system to construct pAPN gene knockout IPI-2I cell line. China Animal Husbandry and Veterinary Medicine, 2021, 48(7): 2282-2290.

[0075] Example 1. Design of PCR-CRISPR / Cas12a nucleic acid detection system

[0076] 1. Construction of standard plasmid

[0077] The DNA of wild type (WT) porcine IPI-2I cells was extracted, and primers were designed for amplification according to the sequence of the third exon of the CD71 gene (GenBank: NC_010455.5) containing sgRNA (see Table 1 for primer sequences), wherein the sequence of the sgRNA target site was GTAGCCAATCATAAATCCTA (SEQ ID NO. 1). The size of the amplified fragment was 591 bp, and the PCR amplification system is shown in Table 2.

[0078] Table 1 Primer sequences

[0079]

[0080] Table 2 PCR amplification system

[0081]

[0082] PCR reaction program: 94°C pre-denaturation for 2 min; 94°C denaturation for 10 s, 60°C annealing for 30 s, 68°C extension for 36 s, 36 cycles; 72°C extension for 5 min.

[0083] After the PCR amplification, agarose gel electrophoresis was performed, and the electrophoresis results are as follows Figure 1As shown, M is GsDL1002 DNA Marker with a size of 1000 bp; NC is negative control; WT-1 to WT-9 are each DNA samples of wild-type pig ileum epithelial cells after PCR amplification, and it can be seen that the PCR products are successfully amplified, and a single band with a size of about 591 bp appears at the expected position.

[0084] The PCR product was purified by gel recovery, and the purified product was ligated into a pClone-EZ-TOPO vector (C5865-50, TransGen Biotech (Beijing) Co., Ltd.) by TA cloning, and sequencing verification was performed on the ligation product to obtain a wild-type standard plasmid pClone-EZ-TOPO-WT of the pig CD71 gene. The plasmid sequencing result is as shown in SEQ ID NO. 2. Figure 2 As shown, the blue selected area is the reverse complement sequence of the sgRNA target point shown in SEQ ID NO. 1, and the red selected area is the PAM sequence.

[0085] 2. crRNA target point design

[0086] According to the DNA sequence within the range of 40 bp upstream and downstream of the sgRNA of the third exon of the pig CD71 gene, the PAM sequence marked by TTN or TTTN was searched, and 20 bp to 25 bp downstream of the PAM sequence was extended as a candidate target site recognized by the CRISPR / Cas12a system. According to the sequence GC content, sequence complementarity and other rules, three candidate target sites were designed, which were named crRNA-T1 (SEQ ID NO. 4), crRNA-T2 (SEQ ID NO. 5) and crRNA-T3 (SEQ ID NO. 6) (see Table 3 for candidate target site sequences).

[0087] The sequence TTTTTTATCCTTAGGATTTATGATTGGCTAC covered by the above three candidate target sites and the sgRNA target site is the sequence targeted for cutting by the crRNA (SEQ ID NO. 7).

[0088] Table 3. Candidate target site sequences

[0089]

[0090] 3. Preparation of specific crRNA in vitro transcription template

[0091] According to the candidate target site sequence, add T7 promoter sequence (TAATACGACTCACTATAGGG) and crRNA repeat region template sequence (TAATTTCTACTAAGTGTAGAT) respectively to form specific crRNA in vitro transcription template positive strand DNA sequence crRNA-T7-F1 (SEQ ID NO. 8), crRNA-T7-F2 (SEQ ID NO. 9), crRNA-T7-F3 (SEQ ID NO. 10).

[0092] According to the complementary pairing of the positive strand DNA sequence, form negative strand DNA sequence crRNA-T7-R1 (SEQ ID NO. 11), crRNA-T7-R2 (SEQ ID NO. 12), crRNA-T7-R3 (SEQ ID NO. 13) respectively.

[0093] Table 4 Specific crRNA in vitro transcription template positive and negative strand DNA sequence

[0094]

[0095] Synthesize positive and negative strand DNA single strands respectively, prepare specific crRNA in vitro transcription template in an annealing manner, and prepare the annealing reaction system as shown in Table 5.

[0096] Table 5 Annealing reaction system

[0097]

[0098] Place the prepared system in a PCR instrument (BIO-RAD, C1000 Touch TM ) and incubate at 95°C for 10 min, then immediately turn off the PCR instrument, and naturally cool the double strands at room temperature, and incubate on ice for 5 min after 90 min. The annealed product can be used for crRNA in vitro transcription.

[0099] 4. Specific crRNA in vitro transcription

[0100] Use T7 in vitro transcription kit (Invitrogen, AM1354) to prepare specific crRNA in vitro transcription system as shown in Table 6.

[0101] Table 6 Specific crRNA in vitro transcription

[0102]

[0103] The transcription system was incubated overnight in a 37°C incubator. The crRNA was recovered using an RNA purification recovery kit (Invitrogen, 12183018A). The recovered crRNA sequences are shown in Table 7.

[0104] Table 7 crRNA sequences

[0105] Name Sequence (5'-3') Length Corresponding sequence name crRNA-F1 UAAUUUCUACUAAGUGUAGAUUCCUUAGGAUUUAUGAUUGG 41 bp SEQ ID NO. 14 crRNA-F2 UAAUUUCUACUAAGUGUAGAUUUUAUCCUUAGGAUUUAUGA 41 bp SEQ ID NO. 15 crRNA-F3 UAAUUUCUACUAAGUGUAGAUUUAUCCUUAGGAUUUAUGAUUGG 44 bp SEQ ID NO. 16

[0106] 5. Establishment of PCR-CRISPR / Cas12a nucleic acid detection system

[0107] (1) The CRISPR / Cas12a fluorescence detection system is shown in Table 8 below:

[0108] Table 8 CRISPR / Cas12a fluorescence detection system

[0109]

[0110] The above DNA probe is a single-stranded DNA probe labeled with 6-FAM and BHQ groups, which is 6-FAM-TTATT-BHQ1.

[0111] The above PCR product is obtained by PCR amplification using the standard plasmid pClone-EZ-TOPO-WT as the DNA template and the CD71-F / CD71-R primer.

[0112] The above crRNA is crRNA-F1, crRNA-F2, and crRNA-F3, respectively.

[0113] According to the above system, crRNA-F1, crRNA-F2, and crRNA-F3 detection systems were prepared, and four technical repeats were set up for each detection system, and a system without crRNA was set up as a negative control (NC).

[0114] The prepared detection system was reacted in a fluorescence quantitative PCR instrument (Thermo Scientific, QuantStudio™5) at 37°C, and the fluorescence intensity was detected every 30 s, a total of 120 times.

[0115] The results are shown in Table 9. Figure 3 Compared with the negative control group, the fluorescence intensity of the crRNA-F1, crRNA-F2, and crRNA-F3 groups was significantly improved (P<0.05), which proved that crRNA-F1, crRNA-F2, and crRNA-F3 all had a targeting cutting effect on the CD71 gene wild sequence (SEQ ID NO. 7). P

[0116] ​(2) The CRISPR / Cas12a colloidal gold test paper detection system is shown in Table 9:

[0117] Table 9 CRISPR / Cas12a colloidal gold test paper detection system

[0118]

[0119] The colloidal gold probe is a single-stranded colloidal gold probe labeled with a Biotin group and a 6-FAM group, and is 6-FAM-TTTTTTTATTTTTTT (SEQ ID NO. 17)-C6Biotin.

[0120] The PCR product is obtained by PCR amplification of the standard plasmid pClone-EZ-TOPO-WT as a DNA template with CD71-F / CD71-R primers.

[0121] The crRNA is crRNA-F1, crRNA-F2 and crRNA-F3, respectively.

[0122] The crRNA-F1, crRNA-F2 and crRNA-F3 detection systems (marked as WT in the figure) are prepared according to the above system, four technical repeats are set for each detection system, and a system without crRNA is set as a negative control (NC).

[0123] The prepared detection system is respectively reacted in a PCR instrument (BIO-RAD, C1000 Touch TM ) at 37℃ for 30 min to obtain a reaction product. After the reaction is completed, the test paper strip bonding pad end is inserted into the reaction product in the reaction tube, and the detection result is read after the interpretation area is completely infiltrated.

[0124] The results are shown in Table 9. Figure 4 Compared with NC (negative result), crRNA-F1, crRNA-F2 and crRNA-F3 can specifically recognize the wild type sequence of CD71 gene (SEQ ID NO. 7), that is, the test paper strip T line develops color and shows a positive result; the negative control group only has C line color development and shows a negative result.

[0125] Example 2. Detection and analysis of monoclonal cell samples in the CRISPR / Cas12a nucleic acid detection system

[0126] The PCR-Cas12a detection system provided by the application is used to screen CD71 gene double allelic editing cells in monoclonal cells.

[0127] The monoclonal cells in the embodiment of the application are gene edited cells obtained after CRISPR / Cas9 gene editing on porcine ileum epithelial cells (IPI-2I), wherein the target point of sgRNA is GTAGCCAATCATAAATCCTA (SEQ ID NO. 1).

[0128] 1. Screening of crRNA

[0129] (1) Amplification of the target sequence of the Cas9 / sgRNA target site

[0130] The monoclonal cells are 2-1#, 2-10#, 2-12# and 2-30#; it is known that 2-10# and 2-12# are CD71 gene double allelic edited cells; 2-1# is a wild type cell; and 2-30# is a CD71 gene single allelic edited cell.

[0131] The lysate of each monoclonal cell is used as a DNA template, and CD71-F and CD71-R are used for PCR amplification, and the PCR system and reaction program are shown in 1 of Example 1, to obtain a PCR amplification product.

[0132] (2) PCR-CRISPR / Cas12a nucleic acid detection

[0133] According to the system shown in Table 8 in Example 1, the above-mentioned PCR amplification product and crRNA are prepared into crRNA-F1, crRNA-F2 and crRNA-F3 detection systems, four technical repeats are set up for each detection system, and a system without crRNA is set up as a negative control (NC).

[0134] The prepared detection system is reacted at 37°C in a fluorescence quantitative PCR instrument (Thermo Scientific, QuantStudio™5), and the fluorescence intensity is detected once every 30 s, a total of 120 times.

[0135] The results are shown in Figure 5 A: crRNA-F1 system detection results; B: crRNA-F2 system detection results; C: crRNA-F3 system detection results; crRNA-F1 can recognize CD71 gene double allelic edited cell samples (2-10# and 2-12#), but the results of the 2-10# monoclonal cell sample show that the fluorescence intensity still has a significant difference compared with the negative control (P<0.05). P<0.05), which may be due to the non-specificity of its recognition of the mutant sequence. crRNA-F2 can recognize CD71 gene double allele editing cell samples (2-10# and 2-12#), but its reaction is slower, which may limit its detection efficiency in practical application. In contrast, crRNA-F3 has good detection effect, and the fluorescence intensity of the detected double allele editing cells has no significant difference with the negative control group (P > 0.05), and can recognize CD71 gene double allele editing cell samples (2-10# and 2-12#); and its reaction speed is fast and stable, which helps to ensure the detection efficiency and accuracy in practical application. Therefore, crRNA-F3 is selected for subsequent detection. P >0.05), and can recognize CD71 gene double allele editing cell samples (2-10# and 2-12#); and its reaction speed is fast and stable, which helps to ensure the detection efficiency and accuracy in practical application. Therefore, crRNA-F3 is selected for subsequent detection.

[0136] 2. Establishment of PCR-CRISPR / Cas12a nucleic acid detection system method

[0137] (1) PCR amplification

[0138] The DNA of the sample to be tested was extracted as a template, and PCR amplification was performed with CD71-F and CD71-R primers to obtain PCR amplification products.

[0139] (2) CRISPR / Cas12a detection

[0140] 1) CRISPR / Cas12a fluorescence detection

[0141] The above PCR amplification product and crRNA-F3 were prepared into a CRISPR / Cas12a fluorescence detection system according to the system shown in Table 8 to obtain a CRISPR / Cas12a detection system;

[0142] The above detection system was set up with four technical repeats, and a negative control (NC) without crRNA was set up.

[0143] The prepared detection system was reacted at 37℃ for 60 min in a fluorescence quantitative PCR instrument (Thermo Scientific, QuantStudio™5).

[0144] The reaction product of the above fluorescence detection system was detected by a fluorescence quantitative PCR instrument (Thermo Scientific, QuantStudio™5) in real time.

[0145] If the fluorescence intensity of the reaction product of the CRISPR / Cas12a detection system is not significantly higher than that of the reaction product of the negative control system (P > 0.05), it indicates that the sample to be tested is not edited by CRISPR / Cas12a. Pthe sample to be tested is or is a candidate for a CD71 gene double allele editing sample; if the fluorescence intensity of the reaction product of the CRISPR / Cas12a detection system is significantly higher than that of the reaction product of the negative control system (P<0.05), the sample to be tested is not or is not a candidate for a CD71 gene double allele editing sample. P <0.05), the sample to be tested is not or is not a candidate for a CD71 gene double allele editing sample.

[0146] The only difference between the above-mentioned negative control system and the CRISPR / Cas12a detection system is that no crRNA is added.

[0147] 2) CRISPR / Cas12a test strip detection

[0148] The above-mentioned PCR amplification product and crRNA-F3 are prepared according to the system shown in Table 9 to prepare a CRISPR / Cas12a colloidal gold test paper detection system, and the CRISPR / Cas12a detection system is obtained.

[0149] The above-mentioned detection system is set up for four technical repeats, and a negative control (NC) without crRNA is set up.

[0150] The prepared detection system is reacted in a PCR instrument (BIO-RAD, C1000 Touch TM ) at 37°C for 30 min to obtain a reaction product.

[0151] The reaction product of the CRISPR / Cas12a colloidal gold test paper detection is detected, if the T line of the reaction product does not develop color (negative), the sample to be tested is or is a candidate for a CD71 gene double allele editing sample; if the T line of the reaction product develops color or both the T line and the C line develop color (positive), the sample to be tested is not or is not a candidate for a CD71 gene double allele editing sample.

[0152] The above-mentioned sample is a cell.

[0153] In the above, the CD71 gene double allele editing cell, the CD71 gene in the third exon of the target region (SEQ ID NO. 7) in the cell is edited compared with the CD71 gene in the cell without gene editing.

[0154] The CD71 gene double allele editing cell is a CD71 gene single allele editing cell or a CD71 gene wild type cell;

[0155] The above-mentioned CD71 gene wild type cell is a cell in which the CD71 gene on both homologous chromosomes is a cell without gene editing;

[0156] The CD71 gene single allele edited cell is that the target region (SEQ ID NO. 7) in the third exon of the CD71 gene on one homologous chromosome in the cell is edited compared with the CD71 gene in the cell without gene editing, and the CD71 gene on the other homologous chromosome is unchanged compared with the CD71 gene in the cell without gene editing.

[0157] Example 3. Application of the crRNA-F3 nucleic acid detection system in the detection and analysis of monoclonal cell samples

[0158] The monoclonal cell in the embodiment of the application is a gene edited cell obtained by performing CRISPR / Cas9 gene editing on porcine ileal epithelial cells (IPI-2I), wherein the target point of the sgRNA is GTAGCCAATCATAAATCCTA (SEQ ID NO. 1).

[0159] 1. CRISPR / Cas12a fluorescence detection

[0160] The PCR product of the monoclonal cell sample is used as a detection template by the method of 2 of Example 2 to perform CRISPR / Cas12a fluorescence detection by the crRNA-F3 nucleic acid detection method.

[0161] The monoclonal cell samples are 2-7#, 2-25#, 2-26#, 2-28#, 2-29#, 2-31#, 1-28#, 2-13# and 2-17#.

[0162] The results are shown in Table 1. Figure 6 As shown in Table 1, the fluorescence intensity of 2-7#, 2-25#, 2-26#, 2-28#, 2-29# and 2-31# is significantly increased compared with NC (P<0.05), which is not a CD71 gene double allele edited cell; the fluorescence intensity of 1-28#, 2-13# and 2-17# has no significant difference compared with NC (P>0.05), which is a CD71 gene double allele edited cell. P P

[0163] 2. CRISPR / Cas12a test strip detection

[0164] The PCR product of the monoclonal cell sample is used as a detection template by the method of 2 of Example 2 to perform CRISPR / Cas12a test strip detection by the crRNA-F3 nucleic acid detection method.

[0165] The results are shown in Table 2. Figure 7 ​​As shown, 2-28#, 2-7#, 2-25#, 2-26#, 2-29#, 2-31# T line color development (positive), which is not CD71 gene double allele editing cell; 1-28#, 2-17#, 2-13# T line does not develop color (negative), which is CD71 gene double allele editing cell.

[0166] The above results show that the crRNA-F3 fluorescence detection system and the colloidal gold test paper detection system can detect nucleic acid samples containing the wild type sequence of CD71 gene (SEQ ID NO. 7), and can be used for screening CRISPR / Cas9 induced CD71 gene double allele editing monoclonal cells.

[0167] In order to determine the accuracy and specificity of the method for rapid detection of CRISPR / Cas9 induced double allele editing cells provided by the application, the PCR products of each monoclonal cell were confirmed by TA cloning to determine the genotype of the double allele editing cells screened above.

[0168] Part of the sequencing results are as shown in Figure 8 As shown, 1-28# is a CD71 gene double allele editing cell, and the sequences of the target points of the two homologous chromosomes are as shown in Figure 8 As can be seen, compared with the target point (SEQ ID NO. 7) in the wild type CD71, the target point (SEQ ID NO. 7) in the two homologous chromosomes of 1-28# has been mutated, one of which has a 2 bp insertion, and the other has a 3 bp deletion, so 1-28# is a CD71 gene double allele editing cell, which is consistent with the screening results of the crRNA-F3 nucleic acid detection system.

[0169] The sequencing results of other CD71 gene double allele editing cells also show that the target point (SEQ ID NO. 7) in the two homologous chromosomes of CD71 has been mutated, which is consistent with the screening results of the crRNA-F3 nucleic acid detection system.

[0170] The sequencing results of the CD71 gene double allele editing cells also show that the target point (SEQ ID NO. 7) in the two homologous chromosomes of CD71 has not been mutated, which is consistent with the screening results of the crRNA-F3 nucleic acid detection system.

[0171] The results prove that crRNA-F3 can be used for specific screening of CD71 gene double allele editing samples and has very high accuracy.

[0172] Example 4. Sensitivity test of crRNA-F3 nucleic acid detection system

[0173] The porcine CD71 gene wild-type standard plasmid pClone-EZ-TOPO-WT was serially diluted with nuclease-free ddH2O to 3.71 × 10⁻⁶. 10 3.71×10 9 3.71×10 8 3.71×10 7 3.71×10 6 3.71×10 5 3.71×10 4 3.71×10 3 3.71×10 2 3.71×10 1 3.71×10 0 Concentration of copies / μL.

[0174] Using pClone-EZ-TOPO-WT plasmids at gradient concentrations as DNA templates, the detection was performed according to the CRISPR / Cas12a fluorescence detection method in Example 2.

[0175] Test results are shown Figure 9 This indicates that in the Cas12a system involving crRNA-F3, when the standard plasmid concentration is 3.71 × 10⁻⁶, 1 When the fluorescence signal intensity is at or above copies / μL, it is significantly higher or extremely significantly higher than that of the negative control group. P <0.05, P <0.01), indicating 3.71×10 1 The standard plasmid with a concentration of copies / μL represents the lowest detection sensitivity of the crRNA-F3 detection system.

[0176] This result indicates that the system still has good detection capability and high sensitivity even at extremely low concentrations.

[0177] Therefore, the crRNA-F3 nucleic acid detection system provided by this invention can rapidly screen CD71 gene biallelic edited cells that meet the expected criteria in a short period of time, which plays an important role in accelerating the development of CD71 gene function analysis.

[0178] The application has been described in detail. For those skilled in the art, the application can be implemented in a wider range under the same parameters, concentrations and conditions without departing from the spirit and scope of the application and without unnecessary experiments. Although the application gives a special example, it should be understood that the application can be further improved. In summary, according to the principle of the application, the application intends to include any change, use or improvement of the application, including changes made by conventional techniques known in the art, which deviates from the range disclosed in the application. Some basic features can be applied within the scope of the following attached claims.

Claims

1. A product comprising crRNA, Cas12a protein, primer pairs for specific amplification of a target, and a single-stranded DNA probe; The nucleotide sequence of the crRNA is SEQ ID NO.16; The primer pair consists of a single-stranded DNA molecule as shown in SEQ ID NO.2 and a single-stranded DNA molecule as shown in SEQ ID NO.3; The single-stranded DNA probe is labeled with different groups at both ends; The group is a fluorescent group, a quenching group, and / or biotin.

2. The product according to claim 1, characterized in that: The product is a reagent kit, test strip, or fluorescence detection system.

3. The use of the product of claim 1 in any of the following: B1) Prepare products for detecting or assisting in the biallelic editing of the CD71 gene; B2) Products for preparing biallelic edited samples for detecting or assisting in the detection of the CD71 gene.

Citation Information

Patent Citations

  • Methods and compositions involving crispr class 2, type vi guides

    US20230022311A1

  • Chemically modified crispr-cas13 guide rnas

    US20240043840A1