Regulating elements or combinations thereof

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to a regulatory element or a combination thereof. The regulatory element comprises a DNA regulatory element and / or an RNA regulatory element; the DNA regulation element is specifically combined with a protein coded by a target gene so as to inhibit transcription of the target gene; a transcription product of the RNA regulation element is specifically combined with a protein coded by a target gene so as to inhibit translation of the target gene, and when the content of the protein coded by the target gene is high, the expression quantity of the protein can be reduced; when the content of the protein coded by the target gene is low, the expression quantity of the protein can be up-regulated, and the decline level of the protein can be reduced, so that the expression level of the target gene is regulated along with the content of the protein, feedback type self-regulation is formed, and the occurrence of overexpression can be reduced under the condition that a carrier containing the target gene and a regulation element is excessively transfected; therefore, the gene is used for preventing and treating diseases caused by insufficient expression of the target gene, and side effects of overexpression of the target gene are reduced while disease symptoms are improved.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to regulatory elements or combinations thereof. Background Art

[0002] MeCP2 (methyl-CpG-binding protein 2) is a key protein for the development and function maintenance of the nervous system, and maintains the normal function of the nervous system by regulating gene transcription, mRNA splicing, and miRNA generation of nervous system cells. When the MeCP2 gene mutates, it will cause defects in the development and function of the nervous system, manifested as Rett Syndrome (RTT, RS). The MeCP2 gene is located on the X chromosome, and most of its mutations originate from mutations during spermatogenesis of the father, so most of the affected patients are girls. Patients are genotypically heterozygous, but because one of the two X chromosomes in female cells will be randomly inactivated in different cells, about half of the cells in heterozygous patients can express normal MeCP2 protein because the X chromosome carrying the wild-type (WT) MeCP2 gene is activated, while the other half of the cells cannot express normal MeCP2 protein because the X chromosome carrying the wild-type (WT) MeCP2 gene is inactivated, resulting in phenotypic mosaicism. Because the functions of half of the cells are abnormal, patients show RTT. MeCP2 protein is a multifunctional protein, and its expression is precisely regulated. When there are two copies of the MECP2 gene on one chromosome due to chromosomal replication and recombination disorders, this will lead to a doubling of MeCP2 expression, and at this time, patients will show MeCP2 duplication syndrome, which is characterized by severe intellectual disability, motor dysfunction, and epilepsy.

[0003] RTT patients have normal early intellectual and motor development after birth. Cognitive and motor function regression occurs at 6 - 18 months, with a decline in language and social interaction abilities, slow head circumference growth, loss of previously acquired fine hand functions, and the emergence of stereotyped hand movements. Another early indicator of nervous system involvement is decelerated head growth, leading to microcephaly in the second year of life. With the onset of developmental stagnation, acquired microcephaly is accompanied by general growth retardation, weight loss, and a weak posture caused by reduced muscle tone. As the RTT syndrome progresses, patients lose the purposeful use of their hands, replaced by stereotyped hand wringing or hand washing movements, and in some cases, clapping, slapping, and teeth chattering. In addition to irritability and self - harm behavior, social withdrawal and loss of language also become evident. Other autistic characteristics in patients are also obvious, including a blank expression, hypersensitivity to sounds, lack of eye contact, indifference to the surrounding environment, and no response to social cues. As they age, there is a gradual loss of motor coordination, as well as the emergence of ataxia and gait apraxia. Most girls with RTT also exhibit additional respiratory abnormalities, including breath - holding, dysphagia, and apnea. Another major feature of RTT is seizures, ranging from easily controlled to difficult - to - control epilepsy, and the most common types are partial complex and tonic - clonic epilepsy. Many patients develop osteopenia, scoliosis, and stiffness as they age. Patients suffer from devastating motor regression, generalized rigidity, dystonia, and worsening scoliosis, so most girls with RTT have difficulty moving and often use wheelchairs in adolescence, and most RTT patients require lifelong care.

[0004] Currently, the treatment for RTT mainly targets single symptoms, including anti - epileptic drugs, physical therapy, and drugs to promote nervous system development. However, due to the lack of strong specificity, these treatments cannot solve the fundamental problems. Given the huge impact and economic pressure on patients and their families caused by the care and physiotherapy of RTT patients, new treatment methods are urgently needed. Gene replacement therapy is one of the most promising ways to treat RTT.

[0005] AAV - based gene therapy has made progress in multiple disease treatment areas. Zolgenesma has fully demonstrated the safety and long - term effectiveness of AAV as a drug in the treatment of the central nervous system disease SMA. Since the MeCP2 protein is involved in the regulation of multiple gene expressions in the body, its expression level in the nervous system needs to be precisely regulated. Too little expression has no therapeutic effect, while over - expression in a few cells can also cause corresponding symptoms. The expression of MeCP2 in nerve cells of RTT patients is mosaic. Therefore, developing a vector that can precisely regulate the expression level of the target protein in wild - type and mutant cells is the key to promoting gene therapy for RTT patients.

[0006] Given the diversity of hMeCP2 protein functions and the high requirements for the range of supplementary doses, there are currently only two drugs in clinical phases I-II, which use different expression regulation systems:

[0007] 1. The TSHA-102 drug of Taysha Gene Therapies is a recombinant adeno-associated virus serotype 9 (AAV9) containing a short version of MeCP2 that is only activated and expressed in nerve cells. The vector contains a self-feedback regulatory element - miRARE that contains multiple miRNA binding sites. The principle is to use the miRNA expressed downstream of hMeCP2 to feedback inhibit the translation of MeCP2 protein in the vector and prevent overexpression of hMeCP2. In a mouse model with MeCP2 gene deficiency, the pharmacological activity of TSHA-102 was evaluated at three dose levels and three age groups. A single intrathecal injection significantly increased the survival rate at all dose levels, and the medium and high dose levels increased the survival rate in all age groups compared with the control group. Since multiple miRNA binding sites are applied in this design, which is equivalent to a miRNA sponge, it will have an adverse effect on the miRNA regulation of the system, and its expression product is a shortened MeCP2 protein, which will affect the function of the protein.

[0008] 2. NGN-401 of Neurogene uses Neurogene's proprietary gene regulation technology to express the full-length wild-type MeCP2 protein. The drug is AAV9 carrying the full-length hMeCP2, and a sequence encoding a specific miRNA is added to the intron in the promoter of the vector, and a complementary miRNA binding site is added behind the expression cassette to achieve the purpose of weakening the vector expression level. The expression data of NGN-401 in mice prove that the hMeCP2 protein level is well controlled in the key brain regions affected by RTT. Conventional gene therapies without EXACT technology regulation will produce too high hMeCP2 protein levels, leading to accelerated death of mice. NGN-401 is well tolerated in female RTT model mice and non-human primates. The disadvantage of this design is that it is equivalent to using a weakened promoter and cannot distinguish the mosaic expression of neurons in RTT patients and thus make different responses. Summary of the Invention

[0009] The purpose of the first aspect of the present invention is to provide a regulatory element or a combination thereof.

[0010] The purpose of the second aspect of the present invention is to provide an expression cassette.

[0011] The purpose of the third aspect of the present invention is to provide a vector.

[0012] The object of the fourth aspect of the present invention is to provide a recombinant adeno-associated virus.

[0013] The object of the fifth aspect of the present invention is to provide a method for preparing the recombinant adeno-associated virus of the fourth aspect of the present invention.

[0014] The object of the sixth aspect of the present invention is to provide a host cell.

[0015] The object of the seventh aspect of the present invention is to provide a pharmaceutical composition.

[0016] The object of the eighth aspect of the present invention is to provide the use of the regulatory element or its combination of the first aspect of the present invention, the expression cassette of the second aspect of the present invention, the vector of the third aspect of the present invention, the recombinant adeno-associated virus of the fourth aspect of the present invention, the host cell of the sixth aspect of the present invention, or the pharmaceutical composition of the seventh aspect of the present invention.

[0017] The object of the ninth aspect of the present invention is to provide a method for treating a disease.

[0018] In order to achieve the above object, the technical solution adopted by the present invention is as follows:

[0019] The first aspect of the present invention provides a regulatory element or its combination, and the regulatory element includes: a DNA regulatory element (D-REG) and / or an RNA regulatory element (R-REG);

[0020] The DNA regulatory element specifically binds to the protein encoded by the target gene to inhibit the transcription of the target gene;

[0021] The transcription product of the RNA regulatory element specifically binds to the protein encoded by the target gene to inhibit the translation of the target gene.

[0022] In some embodiments, the DNA regulatory element can be recognized and bound by the protein encoded by the target gene to inhibit the transcription of the target gene, thereby realizing the autoregulation of the expression of the target gene.

[0023] In some embodiments, the RNA regulatory element forms a special loop structure (RNA-Loop) after transcription, and this RNA-Loop can be recognized and bound by the protein encoded by the target gene to inhibit the translation of the target gene, thereby realizing the autoregulation of the expression of the target gene.

[0024] In the present invention, the self-regulation of target gene expression means that when the content of the protein encoded by the target gene is high, the transcription and / or translation level of the target gene decreases, thereby reducing the expression level of the protein; when the content of the protein encoded by the target gene is low, the transcription and / or translation level of the target gene increases; thereby increasing the expression level of the protein (compared with the high protein content), reducing the decrease level of the protein (negative regulation effect), so that the expression level of the target gene is adjusted with the content of the protein encoded by the target gene, forming a feedback self-regulation.

[0025] In the present invention, when the content of the protein encoded by the target gene is high, the binding of the protein to the DNA regulatory element increases, and after the DNA regulatory element binds to the protein, it can down-regulate the transcription level of the target gene, thereby reducing the expression level of the protein; when the content of the protein encoded by the target gene is low, the binding of the protein to the DNA regulatory element decreases, and the transcription level of the target gene increases, thereby increasing the expression level of the protein (compared with the high protein content), reducing the decrease level of the protein (negative regulation effect), so that the expression level of the target gene is adjusted with the content of the protein encoded by the target gene, forming a feedback self-regulation, which can reduce the occurrence of overexpression in the case of over-transfection of the vector containing the target gene and the regulatory element or its combination; similarly, when the regulatory element or its combination is used for preventing and / or treating diseases caused by insufficient expression of the target gene, when the content of the protein encoded by the target gene is high, the expression level of the protein is reduced; when the content of the protein encoded by the target gene is low, the expression level of the protein is increased (compared with the high protein content), reducing the decrease level of the protein (negative regulation effect), so that the expression level of the target gene is adjusted with the content of the protein encoded by the target gene, forming a feedback self-regulation, which can reduce the side effects of overexpression of the target gene.

[0026] In the present invention, the RNA regulatory element forms a special circular structure (RNA-Loop) after transcription. When the protein encoded by the target gene is at a high level, the binding of the protein to the RNA-Loop increases, forming a special conjugate, thereby preventing the splicing and translation of the mRNA of the protein, and further reducing the expression level of the protein; while when the protein encoded by the target gene is at a low level, the binding of the protein to the RNA-Loop decreases, the translation level of the target gene is up-regulated, thereby up-regulating the expression level of the protein (compared with the high protein level), reducing the decrease level of the protein (negative regulatory effect), so that the expression level of the target gene is adjusted with the content of the protein encoded by the target gene, forming a feedback self-regulation, which can reduce the occurrence of overexpression in the case of over-transfection of a vector containing the target gene and the regulatory element or a combination thereof; similarly, when the regulatory element or a combination thereof is used for preventing and / or treating diseases caused by insufficient expression of the target gene, when the protein encoded by the target gene is at a high level, the expression level of the protein is reduced; while when the protein encoded by the target gene is at a low level, the expression level of the protein is up-regulated (compared with the high protein level), reducing the decrease level of the protein (negative regulatory effect), so that the expression level of the target gene is adjusted with the content of the protein encoded by the target gene, forming a feedback self-regulation, which can reduce the side effects of overexpression of the target gene.

[0027] In the present invention, the RNA regulatory element forms a special circular structure (RNA-Loop) after transcription. When the protein encoded by the target gene is highly expressed, the protein binds more to the DNA regulatory element and the transcription product of the RNA regulatory element, i.e., RNA-Loop. After binding to the protein, the DNA regulatory element can down-regulate the transcription level of the target gene. The increased binding of the protein to the RNA-Loop forms a special complex, thereby preventing the splicing and translation of the mRNA of the protein, and further reducing the expression level of the protein. When the protein encoded by the target gene is lowly expressed, the binding of the protein to the DNA regulatory element and the transcription product of the RNA regulatory element, i.e., RNA-Loop, decreases. The transcription level and translation level of the target gene are up-regulated, thereby up-regulating the expression level of the protein (compared with the high protein content), reducing the decrease level of the protein (negative regulatory effect), and enabling the expression level of the target gene to be adjusted according to the content of the protein encoded by the target gene, forming a feedback self-regulation, which can reduce the occurrence of overexpression in the case of over-transfection of a vector containing the target gene and the regulatory element or its combination. Similarly, when the regulatory element or its combination is used for preventing and / or treating diseases caused by insufficient expression of the target gene, when the protein encoded by the target gene is highly expressed, the expression level of the protein is reduced; when the protein encoded by the target gene is lowly expressed, the expression level of the protein is up-regulated (compared with the high protein content), reducing the decrease level of the protein (negative regulatory effect), and enabling the expression level of the target gene to be adjusted according to the content of the protein encoded by the target gene, forming a feedback self-regulation, which can reduce the side effects of overexpression of the target gene.

[0028] In some embodiments, the regulatory element combination includes a plurality of the regulatory elements (for example: it can be 2, 3, 4, 5, 6, 7, 8 regulatory elements); further includes 2 or 3 of the regulatory elements.

[0029] In the present invention, different degrees of regulatory intensity (intensity of inhibiting the expression of the target gene) can be achieved by selecting different regulatory elements and / or the number of regulatory elements in the regulatory element combination.

[0030] In some embodiments, the regulatory elements in the regulatory element combination can be the same or different.

[0031] In some embodiments, the target gene includes MeCP2, PRKCZ, TTC34, PRDM16, ARHGEF16, PARK7, PRDM2, IGSF21, PTCH2, NFIA, ST6GALNAC3, DPYD, COL11A1, PDZK1, GPR89A, NBPF11, GPR89B, KCNT2, CFHR2, ASPM, PTPRC, GPATCH2, DUSP10, GPR137B, RYR2, CHRM3, RGS7, AKT3, KIF26B, SMYD3, LPIN1, EPCAM, MSH2, NRXN1, XPO1, LRP1B, ZEB2, ACVR2A, MBD5, KIF5C, SCN1A, COL3A1, PMS1, PLCL1, SATB2, PARD3B, EPHA4, SPHKAP, CHL1, GRM7, TRANK1, DOCK3, FAM19A1, FOXP1, ROBO1, CADM2, FOXL2, SOX2, LPP, RASGEF1B, GRID2, FAT4, NR3C2, LRBA, FGA, GALNTL6, WWC2, TLR3, IRX2, IRX1, CDH12, CDH9, NIPBL, HEXB, MEF2C, GRAMD3, FBN2, PRELID2, TCOF1, GABRG2, MSX2, NSD1, FOX C1, CDYL, TBC1D7, RUNX2, MUT, RIMS1, NKAIN2, LAMA2, ARID1B, PARK2, PACRG, QKI, TNRC18, FBXL18, SUGCT, GLI3, AUTS2, MLXIPL, COL1A2, PPP1R9A, CFTR, TSPAN12, GRM8, CNTNAP2, MNX1, CSMD1, MCPH1, LPL, ANK1, IMPAD1, CHD7, VCPIP1, TRPS1, PARP10, DOCK8, KANK1, GLIS3, PTPRD, MLLT3, ROR2, PTCH1, AL162389.1. At least one of ARRDC1, EHM T1, PCDH15, CTNNA3, ADK, BMPR1A, PAX2, BTRC, INPP5A, MRPL23, ELP4, PAX6, CPT1A, DYNC2H1, KIRREL3, WNK1, CACNA1C, PPFIBP1, TBX5, MED13L, NALCN, CHD8, MYH 7, TTC6, DAAM1, NRXN3, MTA1, SNRPN, UBE3A, OCA2, HERC2, CHRFAM7A, ARHGAP11B, OTUD7A, FBN1, HEXA, SNUPN, NRG4, AC112693.2, IGF1R, LRRC28, HBA2, HBQ1, CRE BBP, RBFOX1, CDR2, CDH13, CYBA, NXN, YWHAE, SMG6, METTL16, PAFAH1B1, ADORA 2B, NT5M, RAI1, NF1, C17orf67, PITPNC1, ACOX1, TCF4, DOCK6, CACNA1A, LPHN1, ZSC AN5A, BMP2, MYT1, PEX26, USP18, DGCR6L, USP41, UBE2L3, NF2, LARGE, BRD1, SHAN K3CDKL5, FXN, SMN1, F8, and INS; further being MeCP2.

[0032] In some embodiments, the diseases caused by insufficient expression of the target gene include at least one of Rett syndrome, Fragile X syndrome, Angelman syndrome, Syngap-related intellectual disability, CDKl5 deficiency, Friedreich ataxia, spinal muscular atrophy, hemophilia, and diabetes; further being Rett syndrome (including but not limited to Rett syndrome caused by heterozygosity of MeCP2 gene mutation).

[0033] In some embodiments, the target gene is derived from an animal.

[0034] In some embodiments, the animal is a mammal, such as a human, a non-human primate (such as an orangutan, an ape), a rodent (such as a rat, a mouse, a guinea pig), a pet (such as a cat, a dog), a livestock (such as a horse, a cow, a sheep, a pig, a rabbit); further being a human.

[0035] In some embodiments, the DNA regulatory element is ATHS.

[0036] In some embodiments, the DNA regulatory element is ATHS, and the target gene is MeCP2 (further being MeCP2 derived from a human).

[0037] In some embodiments, the DNA regulatory element is ATHS, and the sequence of the target gene is SEQ ID NO: 7.

[0038] In some embodiments, the RNA regulatory element is eAT1-loop, eAT2-loop, eAT3-loop, or miniMBD-loop.

[0039] In some embodiments, the RNA regulatory element is eAT1-loop, eAT2-loop, eAT3-loop, or miniMBD-loop, and the target gene is MeCP2 (more specifically, MeCP2 derived from human).

[0040] In some embodiments, the RNA regulatory element is eAT1-loop, eAT2-loop, eAT3-loop, or miniMBD-loop, and the sequence of the target gene is SEQ ID NO: 7.

[0041] In some embodiments, the target gene is MeCP2 (more specifically, MeCP2 derived from human) or its sequence is SEQ ID NO: 7, and the disease is Rett syndrome.

[0042] In some embodiments, the sequence of the ATHS comprises:

[0043] c1) SEQ ID NO: 10; or

[0044] c2) a nucleotide sequence obtained by substituting, deleting, and / or adding one or several nucleotides to SEQ ID NO: 10 and having the same function as the nucleic acid molecule shown in SEQ ID NO: 10; or

[0045] c3) a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95% homology with SEQ ID NO: 10 and having the same function as the nucleic acid molecule shown in SEQ ID NO: 10.

[0046] In some embodiments, the sequence of the eAT-loop1 comprises:

[0047] d1) SEQ ID NO: 13; or

[0048] d2) a nucleotide sequence obtained by substituting, deleting, and / or adding one or several nucleotides to SEQ ID NO: 13 and having the same function as the nucleic acid molecule shown in SEQ ID NO: 13; or

[0049] d3) a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95% homology with SEQ ID NO: 13 and having the same function as the nucleic acid molecule shown in SEQ ID NO: 13.

[0050] In some embodiments, the sequence of the eAT-loop2 comprises:

[0051] e1) SEQ ID NO: 14; or

[0052] e2) a nucleotide sequence obtained by substituting, deleting, and / or adding one or several nucleotides to SEQ ID NO: 14 and having the same function as the nucleic acid molecule shown in SEQ ID NO: 14; or

[0053] e3) a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95% homology with SEQ ID NO: 14 and having the same function as the nucleic acid molecule shown in SEQ ID NO: 14.

[0054] In some embodiments, the sequence of the eAT-loop3 comprises:

[0055] f1) SEQ ID NO: 15; or

[0056] f2) a nucleotide sequence obtained by substituting, deleting, and / or adding one or several nucleotides to SEQ ID NO: 15 and having the same function as the nucleic acid molecule shown in SEQ ID NO: 15; or

[0057] f3) a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95% homology with SEQ ID NO: 15 and having the same function as the nucleic acid molecule shown in SEQ ID NO: 15.

[0058] In some embodiments, the sequence of the miniMBD-loop comprises:

[0059] g1) SEQ ID NO: 16; or

[0060] g2) a nucleotide sequence obtained by substituting, deleting, and / or adding one or several nucleotides to SEQ ID NO: 16 and having the same function as the nucleic acid molecule shown in SEQ ID NO: 16; or

[0061] g3) a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95% homology with SEQ ID NO: 16 and having the same function as the nucleic acid molecule shown in SEQ ID NO: 16.

[0062] In some embodiments, the regulatory element or its combination is ATHS, 2*ATHS, 3*ATHS, eAT1-loop, eAT2-loop, eAT3-loop, or miniMBD-loop; the 2*ATHS contains 2 ATHS; the 3*ATHS contains 3 ATHS.

[0063] In some embodiments, the regulatory element or its combination is ATHS, 2*ATHS, 3*ATHS, eAT1-loop, eAT2-loop, eAT3-loop, or miniMBD-loop; the 2*ATHS contains 2 ATHS; the 3*ATHS contains 3 ATHS, and the target gene is MeCP2 (further being MeCP2 derived from human).

[0064] In some embodiments, the regulatory element or its combination is ATHS, 2*ATHS, 3*ATHS, eAT1-loop, eAT2-loop, eAT3-loop, or miniMBD-loop; the 2*ATHS contains 2 ATHS; the 3*ATHS contains 3 ATHS, and the sequence of the target gene is SEQ ID NO: 7.

[0065] In some embodiments, the regulatory element or its combination is 2*ATHS, 3*ATHS, eAT2-loop, or miniMBD-loop; further being 2*ATHS, or miniMBD-loop, and the target gene is MeCP2 (further being MeCP2 derived from human).

[0066] In some embodiments, the regulatory element or its combination is 2*ATHS, 3*ATHS, eAT2-loop, or miniMBD-loop; further being 2*ATHS, or miniMBD-loop, and the sequence of the target gene is SEQ ID NO: 7.

[0067] In some embodiments, the sequence of the 2*ATHS contains:

[0068] h1) SEQ ID NO: 11; or

[0069] h2) a nucleotide sequence obtained by substituting, deleting, and / or adding one or several nucleotides to SEQ ID NO: 11 and having the same function as the nucleic acid molecule shown in SEQ ID NO: 11; or

[0070] h3) a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95% homology with SEQ ID NO: 11 and having the same function as the nucleic acid molecule shown in SEQ ID NO: 11.

[0071] In some embodiments, the 3*ATHS comprises 2*ATHS and ATHS.

[0072] In some embodiments, the 2*ATHS and ATHS in the 3*ATHS are separated by the target gene.

[0073] In a second aspect of the present invention, there is provided an expression cassette comprising:

[0074] j1) the regulatory element or a combination thereof according to the first aspect of the present invention.

[0075] In some embodiments, the expression cassette further comprises: j2) the target gene as described in the first aspect of the present invention.

[0076] In some embodiments, the DNA regulatory element is ATHS and the target gene is MeCP2 (further MeCP2 derived from human).

[0077] In some embodiments, the DNA regulatory element is ATHS and the sequence of the target gene is SEQ ID NO: 7.

[0078] In some embodiments, the RNA regulatory element is eAT1-loop, eAT2-loop, eAT3-loop, or miniMBD-loop, and the target gene is MeCP2 (further MeCP2 derived from human).

[0079] In some embodiments, the RNA regulatory element is eAT1-loop, eAT2-loop, eAT3-loop, or miniMBD-loop, and the sequence of the target gene is SEQ ID NO: 7.

[0080] In some embodiments, the regulatory element or a combination thereof is ATHS, 2*ATHS, 3*ATHS, eAT1-loop, eAT2-loop, eAT3-loop, or miniMBD-loop, and the target gene is MeCP2 (further MeCP2 derived from human).

[0081] In some embodiments, the regulatory element or combination thereof is ATHS, 2*ATHS, 3*ATHS, eAT1-loop, eAT2-loop, eAT3-loop, or miniMBD-loop, and the sequence of the target gene is SEQ ID NO: 7.

[0082] In some embodiments, the regulatory element or combination thereof is 2*ATHS, 3*ATHS, eAT2-loop, or miniMBD-loop; further 2*ATHS, or miniMBD-loop, and the target gene is MeCP2 (further MeCP2 derived from human).

[0083] In some embodiments, the regulatory element or combination thereof is 2*ATHS, 3*ATHS, eAT2-loop, or miniMBD-loop; further 2*ATHS, or miniMBD-loop, and the sequence of the target gene is SEQ ID NO: 7.

[0084] In some embodiments, the expression cassette further comprises: a promoter.

[0085] In some embodiments, the promoter comprises at least one of an inducible promoter, a constitutive promoter, and a tissue-specific promoter; further comprises CBh promoter, Cba promoter, pol I promoter, pol II promoter, polIII promoter, T7 promoter, U6 promoter, H1 promoter, Rous sarcoma virus (RSV) promoter, cytomegalovirus (CMV) promoter, SV40 promoter, dihydrofolate reductase promoter, β-actin promoter, EF-1α promoter, EF-1α short promoter, EF-1α core promoter, β-glucuronidase (GUSB) promoter, chicken β-actin (CBA) promoter, CAG promoter, CB promoter, ubiquitin C (UBC) promoter, prion promoter, light neurofilament (NFL) promoter, heavy neurofilament (NFH) promoter, platelet-derived growth factor (PDGF) promoter, platelet-derived growth factor B chain (PDGF-β) promoter, synapsin (Syn) promoter, synapsin 1 (Syn1) promoter, α-synuclein (α-Syn) promoter, methyl CpG-binding protein 2 (Mecp2) promoter, Ca 2+At least one of the calmodulin-dependent protein kinase II (CaMKII) promoter, metabotropic glutamate receptor 2 (mGluR2) promoter, β-globin minor gene nβ2 promoter, preproenkephalin (PPE) promoter, enkephalin (Enk) promoter, excitatory amino acid transporter 2 (EAAT2) promoter, glial fibrillary acidic protein (GFAP) promoter, and myelin basic protein (MBP) promoter; further comprising the CBh promoter, methyl-CpG binding protein 2 (Mecp2) promoter, α-synuclein (α-Syn) promoter, Ca 2+ At least one of the calmodulin-dependent protein kinase II (CaMKII) promoter; further being the CBh promoter or the methyl-CpG binding protein 2 (Mecp2) promoter.

[0086] In some embodiments, the sequence of the CBh promoter comprises:

[0087] k1) SEQ ID NO: 5; or

[0088] k2) A nucleotide sequence obtained by substituting, deleting, and / or adding one or several nucleotides to SEQ ID NO: 5 and having the same function as the nucleic acid molecule shown in SEQ ID NO: 5; or

[0089] k3) A nucleotide sequence having at least 99%, 98%, 97%, 96%, 95% homology with SEQ ID NO: 5 and having the same function as the nucleic acid molecule shown in SEQ ID NO: 5.

[0090] In some embodiments, the sequence of the Mecp2 promoter comprises:

[0091] k1) SEQ ID NO: 6; or

[0092] k2) A nucleotide sequence obtained by substituting, deleting, and / or adding one or several nucleotides to SEQ ID NO: 6 and having the same function as the nucleic acid molecule shown in SEQ ID NO: 6; or

[0093] k3) A nucleotide sequence having at least 99%, 98%, 97%, 96%, 95% homology with SEQ ID NO: 6 and having the same function as the nucleic acid molecule shown in SEQ ID NO: 6.

[0094] In some embodiments, the expression cassette further comprises: a polyadenylation signal (polyA).

[0095] In some embodiments, the polyadenylation signal (polyA) includes one or more of SV40 polyA, human growth hormone (HGH) polyA, bovine growth hormone (BGH) polyA, β-globin polyA, α-globin polyA, ovalbumin polyA, κ-light chain polyA, synthetic polyA; further, it is bovine growth hormone (BGH) polyA.

[0096] In some embodiments, the sequence of the bovine growth hormone (BGH) polyA includes:

[0097] l1) SEQ ID NO: 8; or

[0098] l2) a nucleotide sequence obtained by substituting, deleting, and / or adding one or several nucleotides to SEQ ID NO: 8 and having the same function as the nucleic acid molecule shown in SEQ ID NO: 8; or

[0099] l3) a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95% homology with SEQ ID NO: 8 and having the same function as the nucleic acid molecule shown in SEQ ID NO: 8.

[0100] In some embodiments, the expression cassette further includes: Kozak sequence (gccacc).

[0101] In some embodiments, the expression cassette further includes: 5' inverted terminal repeat (ITR) and 3' inverted terminal repeat.

[0102] In some embodiments, the 5' inverted terminal repeat is a 5' adeno-associated virus (AAV) inverted terminal repeat.

[0103] In some embodiments, the 3' inverted terminal repeat is a 3' adeno-associated virus (AAV) inverted terminal repeat.

[0104] In some embodiments, the 5' adeno-associated virus (AAV) inverted terminal repeat and the 3' adeno-associated virus (AAV) inverted terminal repeat are each independently selected from one or more of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, goat AAV, bovine AAV, mouse AAV serotype ITRs; further, it is AAV2 serotype ITR.

[0105] In some embodiments, the sequence of the 5' inverted terminal repeat includes:

[0106] m1) SEQ ID NO: 4; or

[0107] m2) a nucleotide sequence obtained by substituting, deleting, and / or adding one or more nucleotides to SEQ ID NO: 4 and having the same function as the nucleic acid molecule shown by SEQ ID NO: 4; or

[0108] m3) a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95% homology with SEQ ID NO: 4 and having the same function as the nucleic acid molecule shown by SEQ ID NO: 4.

[0109] In some embodiments, the sequence of the 3' inverted terminal repeat contains:

[0110] n1) SEQ ID NO: 9; or

[0111] n2) a nucleotide sequence obtained by substituting, deleting, and / or adding one or more nucleotides to SEQ ID NO: 9 and having the same function as the nucleic acid molecule shown by SEQ ID NO: 9; or

[0112] n3) a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95% homology with SEQ ID NO: 9 and having the same function as the nucleic acid molecule shown by SEQ ID NO: 9.

[0113] In some embodiments, the expression cassette (preferably in the order of 5'-3') contains: 5' inverted terminal repeat (ITR), promoter, regulatory element or a combination thereof, Kozak sequence, gene of interest, polyadenylation signal (polyA), and 3' inverted terminal repeat.

[0114] In some embodiments, the expression cassette contains, in the order of 5'-3':

[0115] o1) 5' inverted terminal repeat (ITR), promoter, regulatory element or a combination thereof, Kozak sequence, gene of interest MeCP2, polyadenylation signal (polyA), and 3' inverted terminal repeat; the regulatory element or a combination thereof is ATHS, 2*ATHS, eAT1-loop, eAT2-loop, eAT3-loop, or miniMBD-loop; or

[0116] o2) A 5' inverted terminal repeat (ITR), a promoter, a part of a regulatory element combination, a Kozak sequence, a target gene MeCP2, another part of the regulatory element combination, a polyadenylation signal (polyA), and a 3' inverted terminal repeat; the regulatory element combination is 3*ATH S, a part of the regulatory element combination is 2*ATH S, and another part of the regulatory element combination is ATH S.

[0117] In some embodiments, the expression cassette further comprises: a post-transcriptional regulatory element.

[0118] The third aspect of the present invention provides a vector comprising: the regulatory element or its combination of the first aspect of the present invention, or the expression cassette of the second aspect of the present invention.

[0119] In some embodiments, the vector is a viral vector; further an adeno-associated viral vector.

[0120] The fourth aspect of the present invention provides a recombinant adeno-associated virus (rAAV) comprising: (p1) the regulatory element or its combination of the first aspect of the present invention, the expression cassette of the second aspect of the present invention, or the vector of the third aspect of the present invention.

[0121] In some embodiments, the recombinant adeno-associated virus further comprises: (p2) a capsid protein.

[0122] In some embodiments, the capsid protein is selected from one or more of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAVtt, AAV11, AAV12, AAV2R471A, AAV2 / 2-7m8, AAV DJ, AAV2 N587A, AAV2 E548A, AAV2 N708A, AAV V708K, AAV2-HBKO, AAVDJ8, AAVPHP.B, AAVPHP.eB, AAVBR1, AAVHSC15, AAVHSC17, goat AAV, AAV1 / AAV2 chimeric, bovine AAV or murine AAV capsids, and rAAV2 / HBoV1 serotype capsid proteins; further selected from one or more of AAV2, AAV5, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAVtt, AAV2 / 2-7m8, AAV2-HBKO serotype capsid proteins; still further AAV9 serotype capsid protein.

[0123] In some embodiments, the recombinant adeno-associated virus (rAAV) is single-stranded AAV (ssAAV) or self-complementary AAV (scAAV).

[0124] The fifth aspect of the present invention provides a method for preparing the recombinant adeno-associated virus of the fourth aspect of the present invention, which is packaged by the recombinant adeno-associated virus vector in the third aspect of the present invention.

[0125] In some embodiments, the method for preparing the recombinant adeno-associated virus comprises the following steps: transfecting a production cell with the recombinant adeno-associated virus vector, packaging plasmid pAAV-RC, and helper plasmid pHelper in the third aspect of the present invention.

[0126] In some embodiments, the method for preparing the recombinant adeno-associated virus further comprises a purification step.

[0127] The sixth aspect of the present invention provides a host cell, which comprises: the regulatory element or its combination in the first aspect of the present invention, the expression cassette in the second aspect of the present invention, the vector in the third aspect of the present invention, or the recombinant adeno-associated virus in the fourth aspect of the present invention.

[0128] In some embodiments, the host cell does not contain propagation materials.

[0129] In some embodiments, the host cell comprises eukaryotic cells.

[0130] In some embodiments, the eukaryotic cells comprise mammalian cells.

[0131] In some embodiments, the mammals are selected from the group consisting of human, monkey, mouse, rat, hamster, goat, sheep, cow, pig, dog, and cat.

[0132] In some embodiments, the mammalian cells are selected from the group consisting of baby hamster kidney fibroblast (BHK) cells, human embryonic kidney 293 (HEK293) cells, human embryonic kidney 293T (HEK293T) cells, NS0 cells, SP2 / 0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER cells, PER.C6 cells, hybridoma cells, NIH3T3 cells, CV-1 (simian) cells derived from SV40 genetic material (COS), HeLa, Chinese hamster ovary (CHO) cells, or yeast cells; further preferably human embryonic kidney 293 (HEK293) cells.

[0133] The seventh aspect of the present invention provides a pharmaceutical composition, which comprises: the regulatory element or its combination in the first aspect of the present invention, the expression cassette in the second aspect of the present invention, the vector in the third aspect of the present invention, the recombinant adeno-associated virus in the fourth aspect of the present invention, or the host cell in the sixth aspect of the present invention.

[0134] In some embodiments, the pharmaceutical composition comprises: a recombinant adeno-associated virus of the fourth aspect of the present invention.

[0135] In some embodiments, the pharmaceutical composition further comprises: a pharmaceutically acceptable carrier.

[0136] In some embodiments, the pharmaceutical composition further comprises: other active ingredients for preventing and / or treating diseases caused by insufficient expression of target genes.

[0137] In some embodiments, the disease caused by insufficient expression of the target gene is the disease in the first aspect of the present invention.

[0138] In some embodiments, the dosage form of the pharmaceutical composition is a dosage form suitable for children or a dosage form suitable for adults.

[0139] In some embodiments, the dosage form is a gastrointestinal administration dosage form or a parenteral administration dosage form.

[0140] In some embodiments, the gastrointestinal administration dosage form comprises at least one of powder, tablet, granule, capsule, sustained-release agent, solution, dry suspension, effervescent tablet, emulsion, suspension, syrup, drop, chewable tablet.

[0141] In some embodiments, the parenteral administration dosage form comprises an injection dosage form (such as an injection, including various injections such as intravenous injection, intramuscular injection, subcutaneous injection, intradermal injection, intracavitary injection, intracerebral injection, cerebrospinal fluid (CSF) injection, etc.); further, it is an intracerebral injection or a cerebrospinal fluid injection.

[0142] In some embodiments, the intracerebral injection is used for intracerebral injection, parenchymal injection, intranuclear injection and combinations thereof.

[0143] In some embodiments, the cerebrospinal fluid injection is used for cisterna magna injection, intrathecal injection, intracerebroventricular injection (ICV) and combinations thereof.

[0144] The eighth aspect of the present invention provides the application of the regulatory element or its combination of the first aspect of the present invention, the expression cassette of the second aspect of the present invention, the vector of the third aspect of the present invention, the recombinant adeno-associated virus of the fourth aspect of the present invention, the host cell of the sixth aspect of the present invention, or the pharmaceutical composition of the seventh aspect of the present invention in any one of a1)-a3):

[0145] a1) Autoregulation of target gene expression;

[0146] a2) Preparing a product for autoregulation of target gene expression;

[0147] a3) To prepare a drug for preventing and / or treating a disease caused by insufficient expression of a target gene.

[0148] In some embodiments, the target gene is the target gene in the first aspect of the present invention.

[0149] In some embodiments, the disease caused by insufficient expression of the target gene is the disease in the first aspect of the present invention.

[0150] In some embodiments, in a1), the application is for non-therapeutic purposes.

[0151] In the ninth aspect of the present invention, there is provided a method for treating a disease caused by insufficient expression of a target gene, which comprises administering to a subject a therapeutically effective amount of the pharmaceutical composition in the seventh aspect of the present invention.

[0152] In some embodiments, the subject is an animal.

[0153] In some embodiments, the animal is a mammal, such as a human, a non-human primate (such as an orangutan, an ape), a rodent (such as a rat, a mouse, a guinea pig), a pet (such as a cat, a dog), a livestock (such as a horse, a cow, a sheep, a pig, a rabbit); further preferably a human.

[0154] In some embodiments, the disease caused by insufficient expression of the target gene is the disease in the first aspect of the present invention.

[0155] The beneficial effects of the present invention are:

[0156] The present invention discloses for the first time a regulatory element or a combination thereof, wherein the regulatory element comprises a DNA regulatory element (D-REG) and / or an RNA regulatory element (R-REG); the DNA regulatory element specifically binds to the protein encoded by the target gene to inhibit the transcription of the target gene; the transcription product of the RNA regulatory element specifically binds to the protein encoded by the target gene to inhibit the translation of the target gene. When the content of the protein encoded by the target gene is high, the protein binds more to the transcription product of the DNA regulatory element and / or the RNA regulatory element - RNA-Loop. After the DNA regulatory element binds to the protein, it can down-regulate the transcription level of the target gene. The increased binding of the protein to RNA-Loop can form a special binding complex, thereby preventing the splicing and translation of the mRNA of the protein, and further reducing the expression level of the protein. When the content of the protein encoded by the target gene is low, the binding of the protein to the DNA regulatory element and the RNA regulatory element - RNA-Loop decreases, and the transcription level and translation level of the target gene are up-regulated, thereby up-regulating the expression level of the protein (compared with the high protein content), reducing the decline level of the protein (negative regulatory effect), enabling the expression level of the target gene to be adjusted according to the content of the protein encoded by the target gene, forming a feedback self-regulation, and reducing the occurrence of overexpression in the case of over-transfection of the vector containing the target gene and the regulatory element or its combination; thus, when it is used for preventing and / or treating diseases caused by insufficient expression of the target gene (such as RTT), it can improve the disease symptoms while reducing the side effects of overexpression of the target gene, providing guarantee for the effectiveness and safety of disease treatment, and improving the clinical transformation value and possibility of drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0157] Figure 1 The structure of the hMeCP2 expression cassette is shown: wherein, A shows the structure of the hMeCP2 expression cassette without a regulatory element; B shows the structure of the hMeCP2 expression cassette containing regulatory elements such as ATHS, 2*ATHS, AT-loop1, eAT-loop2, eAT-loop3, and miniMBD-loop; C shows the structure of the hMeCP2 expression cassette containing the 3*ATHS regulatory element. Among them: ITR sequence, inverted terminal repeat sequence; CBh promoter, a promoter composed of the enhancer of CMV, β-actin promoter, and hybrid intron; ATHS, AT-hook binding sequence; 2*ATHS, 2 copies of AT-hook binding sequence; 3*ATHS, 3 copies of AT-hook binding sequence; BGH PloyA, the nucleic acid sequence of bovine growth hormone polyadenylation signal (PloyA), which has the function of terminating transcription.

[0158] Figure 2 Shown are the results of downregulating the expression level of the hMeCP2-EGFP fusion protein in 293-WT by regulatory elements (ATHS, 2*ATHS, 3*ATHS, AT-loop1, eAT-loop2, eAT-loop3, miniMBD-loop): Among them, A shows the comparison results of downregulating the expression level of the hMeCP2-EGFP fusion protein in 293-WT by different AT-hook sequences (ATHS) (ATHS, 2*ATHS, 3*ATHS); B shows the quantification results of downregulating the expression level of the hMeCP2-EGFP fusion protein in 293-WT by different AT-hook sequences (ATHS) (ATHS, 2*ATHS, 3*ATHS); C shows the comparison results of downregulating the expression level of the hMeCP2-EGFP fusion protein in 293-WT by different MBD-region binding regulatory elements (AT-loop1, eAT-loop2, eAT-loop3, miniMBD-loop); D shows the quantification results of downregulating the expression level of the hMeCP2-EGFP fusion protein in 293-WT by different MBD-region binding regulatory elements (AT-loop1, eAT-loop2, eAT-loop3, miniMBD-loop); 293-WT, human HEK293 cells containing the wild-type MECP2 gene; GAPDH, glyceraldehyde-3-phosphate dehydrogenase, used as an internal reference protein.

[0159] Figure 3Shows the results of downregulating the expression level of hMeCP2-EGFP fusion protein in 293-270X by regulatory elements (ATHS, 2*ATHS, 3*ATHS, AT-loop1, eAT-loop2, eAT-loop3, miniMBD-loop): Among them, A shows the comparison results of downregulating the expression level of hMeCP2-EGFP fusion protein in 293-270X by different AT-hook sequences (ATHS) (ATHS, 2*ATHS, 3*ATHS); B shows the quantification results of downregulating the expression level of hMeCP2-EGFP fusion protein in 293-270X by different AT-hook sequences (ATHS) (ATHS, 2*ATHS, 3*ATHS); C shows the comparison results of downregulating the expression level of hMeCP2-EGFP fusion protein in 293-270X by different MBD region-binding regulatory elements (AT-loop1, eAT-loop2, eAT-loop3, miniMBD-loop); D shows the quantification results of downregulating the expression level of hMeCP2-EGFP fusion protein in 293-270X by different MBD region-binding regulatory elements (AT-loop1, eAT-loop2, eAT-loop3, miniMBD-loop); 293-270X, human HEK293 cells with a nonsense mutation at site 270 of the MECP2 gene.

[0160] Figure 4 Shows the results of downregulating the expression level of hMeCP2-EGFP fusion protein after transfection of 293-KO with shuttle plasmids (pAAV-CBh-Non-REG-hMeCP2-EGFP, pAAV-CBh-2*ATHS-hMeCP2-EGFP) at different concentrations: Among them, A shows the green fluorescence imaging results after transfection of 293-KO with pAAV-CBh-Non-REG-hMeCP2-EGFP (the transfection plasmid concentration is 0.80 μg / 4.5E+5 cells) (the fluorescence intensity and area are shown in black and white photos); B shows the green fluorescence imaging results after transfection of 293-KO with pAAV-CBh-2*ATHS-hMeCP2-EGFP (the transfection plasmid concentration is 0.80 μg / 4.5E+5 cells) (the fluorescence intensity and area are shown in black and white photos); C shows the expression level curve of hMeCP2-EGFP fusion protein after transfection of 293-KO with shuttle plasmids (pAAV-CBh-Non-REG-hMeCP2-EGFP, pAAV-CBh-2*ATHS-hMeCP2-EGFP) at different concentrations.

[0161] Figure 5The results of downregulating the expression level of hMECP2 in 293-WT by different REGs (2*ATHS, miniMBD-loop) under the Mecp2 promoter are shown: among them, A shows the comparison results of the downregulation of the expression level of hMECP2 in 293-WT by the regulatory elements (2*ATHS, miniMBD-loop); B shows the quantitative results of the downregulation of the expression level of hMECP2 in 293-WT by the regulatory elements (2*ATHS, miniMBD-loop).

[0162] Figure 6 The therapeutic effects of AAV9 viruses carrying vectors (the shuttle plasmids are pAAV-CBh-2*ATHS-hMeCP2-EGFP and pAAV-CBh-miniMBD-loop-hMeCP2-EGFP) are shown: among them, A shows that the AAV9 viruses carrying vectors (the shuttle plasmids are pAAV-CBh-2*ATHS-hMeCP2-EGFP and pAAV-CBh-miniMBD-loop-hMeCP2-EGFP) can increase the survival rate; B shows that the AAV9 viruses carrying vectors (the shuttle plasmids are pAAV-CBh-2*ATHS-hMeCP2-EGFP and pAAV-CBh-miniMBD-loop-hMeCP2-EGFP) can reduce the weight loss; C shows that the AAV9 viruses carrying vectors (the shuttle plasmids are pAAV-CBh-2*ATHS-hMeCP2-EGFP and pAAV-CBh-miniMBD-loop-hMeCP2-EGFP) can reduce the degree of hindlimb clasping; D, E show that the AAV9 viruses carrying vectors (the shuttle plasmid is pAAV-CBh-2*ATHS-hMeCP2-EGFP) can reduce the expression level of the hMeCP2-EGFP fusion protein.

[0163] Figure 7 The therapeutic effects of AAV9 viruses carrying vectors (the shuttle plasmids are pAAV-CBh-2*ATHS-hMeCP2 and pAAV-CBh-miniMBD-loop-hMeCP2) are shown: among them, A shows that the AAV9 viruses carrying vectors (the shuttle plasmids are pAAV-CBh-2*ATHS-hMeCP2 and pAAV-CBh-miniMBD-loop-hMeCP2) can increase the survival rate; B shows the weight change curve after treatment with the AAV9 viruses carrying vectors (the shuttle plasmids are pAAV-CBh-2*ATHS-hMeCP2 and pAAV-CBh-miniMBD-loop-hMeCP2).

[0164] Figure 8Shows the therapeutic effects of AAV9 viruses carrying different vectors (the shuttle plasmids are pAAV-Mecp2-Non-REG-hMeCP2, pAAV-Mecp2-2*ATH S-hMeCP2, pAAV-Mecp2-miniMBD-loop-hMeCP2) respectively: Among them, A shows the survival rate curves after treatment with AAV9 viruses carrying different vectors (the shuttle plasmids are pAAV-Mecp2-Non-REG-hMeCP2, pAAV-Mecp2-2*ATHS-hMeCP2, pAAV-Mecp2-miniMBD-loop-hMeCP2) respectively; B shows the body weight change curves after treatment with AAV9 viruses carrying different vectors (the shuttle plasmids are pAAV-Mecp2-Non-REG-hMeCP2, pAAV-Mecp2-2*ATHS-hMeCP2, pAAV-Mecp2-miniMBD-loop-hMeCP 2) respectively.

[0165] Figure 9 Shows the therapeutic effects (intracerebroventricular injection) of AAV9 viruses carrying a vector (the shuttle plasmid is pAAV-Mecp2-2*ATHS-hMeCP2): Among them, A shows the survival rate curves after treatment with AAV9 viruses carrying a vector (the shuttle plasmid is pAAV-Mecp2-2*ATHS-hMeCP2); B shows the body weight change curves after treatment with AAV9 viruses carrying a vector (the shuttle plasmid is pAAV-Mecp2-2*ATHS-hMeCP2).

[0166] Figure 10 Shows the therapeutic effects (intracisternal injection) of AAV9 viruses carrying a vector (the shuttle plasmid is pAAV-Mecp2-2*ATHS-hMeCP2): Among them, A shows the survival rate curves after treatment with AAV9 viruses carrying a vector (the shuttle plasmid is pAAV-Mecp2-2*ATHS-hMeCP2); B shows the body weight change curves after treatment with AAV9 viruses carrying a vector (the shuttle plasmid is pAAV-Mecp2-2*ATHS-hMeCP2). Detailed implementation manners

[0167] The following further elaborates on the content of the present invention through specific examples in detail.

[0168] It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention.

[0169] For the experimental methods without specific conditions noted in the following examples, they are generally carried out under conventional conditions or according to the conditions recommended by the manufacturer. The materials, reagents, etc. used in this example are, unless otherwise specified, reagents and materials obtained through commercial channels. For reagents with the manufacturer indicated, similar products from other manufacturers are substitutable.

[0170] 1. Construction and Preparation of Shuttle Plasmids for AAV Virus Packaging

[0171] 1.1 AAV Vector Production and Purification Method

[0172] The production of AAV vectors adopts a three - plasmid system, that is, using shuttle plasmids containing the hMeCP2 expression target gene (shuttle plasmids with the hMeCP2 expression cassette without regulatory elements and with the CBh promoter, shuttle plasmids with the hMeCP2 expression cassette without regulatory elements and with the Mecp2 promoter, shuttle plasmids with the hMeCP2 expression cassette containing regulatory elements and with the CBh promoter, shuttle plasmids with the hMeCP2 expression cassette containing regulatory elements and with the Mecp2 promoter), the pRepCap plasmid carrying the repcap gene of the AAV9 vector, and the helper plasmid Phelper. Using PEI as the transfection reagent, they are co - transfected into HEK293 cells to recombinantly package the AAV virus vector. Harvesting is carried out 48 - 72 hours after transfection, and a recombinant AAV virus vector with a certain purity is obtained after purification of the harvested solution. The purification method is as follows:

[0173] First, the harvested solution is pretreated: HEK293 cells are fully lysed to release the AAV9 virus vector inside the cells. Meanwhile, nuclease is added to digest the free nucleic acids. After the digestion ends, centrifugation is used to take the supernatant to remove cell debris, and the filtrate after filtration through a 0.22 - μm filter membrane is used for loading onto the affinity chromatography column.

[0174] Affinity chromatography uses the specific adsorption of the ligand to the protein to capture the AAV virus vector in the harvested solution and remove most of the process - related impurities, achieving the effects of concentration and impurity removal. The collected eluate is mixed and neutralized with the neutralization buffer, and then stored in a sterile storage bottle as the loading solution for anion chromatography.

[0175] Anion chromatography separates the solid - core and empty - shell AAV viruses using the isoelectric point differences of different components, and at the same time continues to remove residual impurities. The eluate is collected in a new sterile storage bottle, and then the buffer is replaced with a buffer stable for the preparation by ultrafiltration concentration method. At the same time, the virus titer is concentrated to about 1×10 14 vg / mL, and finally it is sterilized by filtration, aliquoted, and stored for later use.

[0176] 1.2 Titration Quantification of AAV Vectors

[0177] After the purification of AAV virus is completed, it is necessary to determine the virus content. Genome titer is the most classic detection item for characterizing the physical titer of AAV. Designing primers and probes based on the genomic sequence of rAAV and then performing Q-PCR detection is the most common method for genome titer detection.

[0178] Considering the screening of multiple vector structures involved in the present disclosure, in order to ensure the stability and accuracy of quantification between different vector structures, primers and probes are designed for the common sequence BGH polyA in the vector. Forward primer sequence: 5’-TGCCTTCCTTGACCCTGG-3’ (SEQ ID NO:1), Reverse primer sequence: 5’-ACTCAGACAATGCGATGCAA-3’ (SEQ ID NO:2), Probe sequence: 5’-CACTCCCACTGTCCTTTCCTAATA-3’ (SEQ ID NO:3). During the genome titer detection process, the establishment of a standard curve is required first. The positive standard plasmid is diluted with sample diluent to 2×10 7 、2×10 6 、2×10 5 、2×10 4 、2×10 3 、2×10 2 copies / μL as the standard curve template. The standard curve needs to control its linearity and amplification efficiency, generally requiring R 2 >0.99, and the amplification efficiency is between 90% - 110%. Then, the pretreated rAAV sample is diluted and subjected to Q-PCR detection to ensure that the Ct value of the sample detection is within the range of the standard curve. The genomic titer of the rAAV sample is calculated by substituting the Ct value of the sample into the standard curve, and the content of the product is labeled.

[0179] 2. Cell culture, passage, plating, transgenic operation and WB protein semi-quantitative detection

[0180] 2.1. Cell resuscitation

[0181] Turn on the water bath and adjust the temperature to 37°C. Open the laminar flow hood and sterilize it with ultraviolet light for 30 minutes. Quickly take out the cell cryopreservation tube from the liquid nitrogen tank and quickly put it into the 37°C water bath and shake it slowly to completely melt it. After thawing, dry the water droplets on the surface of the cryopreservation tube with absorbent paper, and spray an appropriate amount of 75% alcohol to disinfect the seal of the cryopreservation tube. Transfer the cryopreservation tube into the laminar flow hood, use a sterile pipette tip to aspirate 1 mL of cells into a 15 mL sterile EP tube, add 9 mL of basic medium for dilution, centrifuge at 1000 rpm for 5 minutes to precipitate the cells, and discard the supernatant. Add 10 mL of freshly prepared medium containing 10% serum, mix gently, and transfer the cells to a cell culture dish with a pipette. Incubate in a 37°C, 5% CO2 incubator.

[0182] 2.2. Cell Passage

[0183] Take out the culture medium, PBS, and trypsin from the 4°C refrigerator and place them in a 37°C water bath for preheating before use. Take out the cell culture dish from the CO₂ incubator and observe the cells under the microscope (when the cells are 80%-90% confluent). Aspirate the culture medium, rinse the cells with 4 mL of PBS, aspirate the PBS, add 2 mL of trypsin to digest the cells, place it in the CO₂ incubator for 2-3 minutes to completely detach the cells, take out the cell culture dish, add 5 mL of culture medium to it to terminate the digestion, transfer the cells to a sterile 15 mL centrifuge tube, place the 15 mL centrifuge tube in a centrifuge, centrifuge at 300 x g for 5-6 minutes to precipitate the cells, and discard the supernatant. Add 2 mL of culture medium to the 15 mL centrifuge tube to resuspend the cells, take 400 μL of the cells and add them to the cell culture dish, add 10 mL of complete culture medium, shake well back and forth, and then place it in the CO₂ incubator for culture.

[0184] 2.3. Cell Medium Change

[0185] Take out the culture medium from the 4°C refrigerator and place it in a 37°C water bath for preheating. Take out the cell culture dish from the CO₂ incubator, transfer it to the laminar flow hood, discard the culture medium, rinse the cells with 4 mL of PBS, aspirate the PBS, repeat once, add 10 mL of fresh culture medium, and then place it in a 37°C CO₂ incubator for continued culture.

[0186] 2.4. Cell Seeding

[0187] Take out the culture medium, PBS, and trypsin from the 4°C refrigerator and place them in a 37°C water bath for preheating. Take out the cell culture dish from the CO₂ incubator and observe the cells under the microscope (when the cells are 80%-90% confluent). Aspirate the culture medium, rinse the cells with 4 mL of PBS, aspirate the PBS, add 2 mL of trypsin to digest the cells, place it in the CO₂ incubator for 2-3 minutes to completely detach the cells, take out the cell culture dish, add 5 mL of culture medium to it to terminate the digestion, transfer the cells to a sterile 15 mL centrifuge tube, place the 15 mL centrifuge tube in a centrifuge, centrifuge at 300 x g for 5-6 minutes to precipitate the cells, and discard the supernatant. Add 2 mL of culture medium to the 15 mL centrifuge tube to resuspend the cells, take 100 μL and transfer it to a 1.5 mL EP tube, add 100 μL of trypan blue to the 1.5 mL EP tube, mix well, aspirate 20 μL and add it to the cell counting chamber, sample and count multiple times, and the average viable cells are 3.6×10 6 cell / mL (example). For a 24-well plate, each well contains 0.5 mL and 1×10 5 cells, and the required amount is 2×10 5cells / mL, need to be diluted 18 times, 10÷18×1000 μL of the original solution, (10 - 10÷18)×1000 μL of the culture medium. Pipette and mix the cell suspension evenly, 0.5 mL per well in a 24-well plate, and shake well at room temperature. Precipitate for about 5 minutes at room temperature, and then place it in the cell culture incubator.

[0188] 2.5. Transgenic operation

[0189] Take out the serum-free DMEM medium and Lipo3000 transfection reagent from the refrigerator and equilibrate to room temperature; premix the Lipofectamine 3000 and P3000 (Thermo, L3000015) transfection reagents with the plasmid, according to 500 ng - 700 ng / well of the shuttle plasmid expressing the target gene hMeCP2 (the shuttle plasmid of the hMeCP2 expression cassette without regulatory elements and with the CBh promoter, the shuttle plasmid of the hMeCP2 expression cassette without regulatory elements and with the Mecp2 promoter, the shuttle plasmid of the hMeCP2 expression cassette with regulatory elements and with the CBh promoter, the shuttle plasmid of the hMeCP2 expression cassette with regulatory elements and with the Mecp2 promoter), 360 nL / well of P3000 and 360 nL / well of Lipo 3000 (Thermo, L3000015), add to the 293 cells in the 24-well plate, and culture in a CO2 constant temperature incubator. Change the medium once after overnight culture. Take pictures under the green fluorescence channel of a fluorescence microscope after 48 h. Collect the protein after 72 hours.

[0190] 2.6 Total cell protein extraction and Western Blot semi-quantitative analysis

[0191] Remove the culture medium in the wells of the culture plate. Add 100 μL of RIPA lysis buffer (Beyotime, P0013B) containing 1×SDS loading buffer to each well of the 24-well plate inoculated with cultured cells, and lyse on ice for 5 min. Collect the cell protein lysate, incubate on ice for 30 min, and centrifuge to collect the protein supernatant. After adding the protein loading buffer to the protein sample, denature at 95°C for 5 min. Load 20 μL of the protein sample onto the SDS-PAGE for electrophoresis, and then transfer it to a PVDF membrane, and incubate with Anti-GFP or Anti-hMeCP2 and Anti-GAPDH (TransGen, HC301) antibodies. Use the ChemiDoc Touch Imaging System (Bio-Rad) 20 for imaging analysis. Use the Image J software for gray scale analysis.

[0192] 3 Animal experiments

[0193] 3.1 Animal source

[0194] 3 - 4 week old C57BL / 6J mice were purchased from Changzhou Cavens Laboratory Animal Co., Ltd., strain number: C0001114. C57BL / 6J-Mecp2 em1C / Cya was purchased from Cyagen Biosciences (Suzhou) Inc.

[0195] 3.2 Intracerebroventricular injection for mice

[0196] In this experiment, the method of intracerebroventricular injection for mice was as follows: Select a suitable height and stable position to place the small animal gas anesthesia machine (Nanjing Calvin, #KW-MZJ) and binocular stereomicroscope - national standard (RWD / China, #77001S), and brain stereotaxic apparatus (RWD / China, #68025). Place the mouse into the pre-anesthetic device supporting the small animal gas anesthesia machine, start the anesthesia switch, adjust the flow rate to scale "5", and continuously anesthetize for 5 minutes to make the mouse enter the anesthetic state. Take the mouse out of the pre-anesthetic device, transfer it to the anesthesia mask of the stereotaxic apparatus, apply eye ointment on the mouse's eyes to prevent dry eyes. Use the gas splitter and breathing mask supporting the small animal gas anesthesia machine to continuously anesthetize the mouse. At this time, adjust the flow rate of the gas anesthesia machine to scale "2". During the entire surgical process, the mouse was in an anesthetic state. Fix the skull of the mouse placed on the brain stereotaxic apparatus, insert the mouse's incisors into the holes of the tooth bar, and gently tighten the nose clip. Move one side ear rod to the appropriate position and tighten it. Gently hold the mouse's head with your hand, align the position of the foramen magnum on the same side of the head with the tip of the ear rod, and slowly push the other ear rod to the foramen magnum. Adjust the positions of the two ear rods until the scale readings on both left and right sides are the same. Level the skull of the mouse, the absolute value of the front-back value of the mouse skull is less than 0.05 mm; for the craniofacial coordinate values of the two points on the left and right, the absolute value of the difference is less than 0.05 mm. Use a micro-injection pump (KDS / USA, #LEGATO 130), use the supporting micro-syringe needle (Hamilton / USA, #7653-01) to extract the corresponding volume, fix the micro-injection pump on the operating arm, after re-zeroing the tip of the injection needle, move the operating arm above the target site (0.8 mm from the bregma point towards the lambda suture, 0.5 mm off to the side, depth 2.6 mm), and slowly lower it to the target brain area. Set the injection speed and injection volume parameters of the micro-injection pump to 10 μL / 25 min. After the injection, suture the wound and apply erythromycin ointment to the injection site. Place the mouse on a pet thermostatic pad and wait for it to wake up. After it can move freely, put it back into the breeding cage.

[0197] 3.3 Intracisternal injection for mice

[0198] In this experiment, the injection method of cisterna magna injection (ICM): The anesthesia of mice refers to 3.2. Place the anesthetized mice on the stereotaxic apparatus for skull fixation. Insert the incisors of the mice into the holes of the tooth bar and gently tighten the nose clip. Move one ear bar to the appropriate position and tighten it. Gently support the mouse's head with your hand, align the position of the foramen magnum on the same side of the head with the tip of the ear bar, and slowly push the other ear bar to the foramen magnum. The mouse is in a position with its head high and its tail low. Cut the skin on the posterior side of the mouse's skull, separate the neck muscles, and expose the atlanto-occipital membrane. Use a microsyringe needle (#7653-01, Hamilton / USA) compatible with a microsyringe pump (KDS / USA, #LEGATO 130) to draw the corresponding volume. Fix the microsyringe pump on the operating arm and slowly insert it about 2 mm into the atlanto-occipital membrane. Set the injection speed and injection volume parameters of the microsyringe pump to 10 μL / 5 min. After the injection is completed, suture the wound and apply erythromycin ointment to the injection site. Place the mouse on a pet thermostatic pad and wait for it to wake up. After it can move freely, put it back into the breeding cage.

[0199] 3.4 Intracerebroventricular injection of neonatal mice

[0200] The neonatal mice used in the experiment can be used for injection 1 - 3 days after birth. Place the aluminum foil and medical gauze on wet ice in turn. Place the neonatal mice to be injected on the medical gauze and wait for 2 - 3 minutes to anesthetize them with low temperature. After the neonatal mice enter the anesthetized state (the activity is significantly reduced), gently fix the head with your hand to facilitate positioning the injection site. Mark at the 2 / 5 of the distance between the lambda and one eye and 0.8 - 1 mm from the sagittal suture on the brain. Use a microsyringe to draw a certain amount of injection sample. Hold the end of the syringe plunger and keep the syringe perpendicular to the skull surface, gently insert it into the above marked point, and the needle insertion depth is about 3 mm. Slowly push the injection sample to complete the injection. After the injection is completed, keep the needle in place for about 30 s, and then slowly pull out the needle to ensure no leakage. Then inject the contralateral ventricle in the same way. Then place the mouse on a hot plate and wait for its body temperature to recover (the mouse's color returns to normal). Before putting the mouse back, let it be contaminated with the urine smell of the mother mouse and mix with the mouse for more than 10 min before putting it back into the mother mouse's cage.

[0201] 3.5 Methods for collecting mouse brain tissue and liver samples

[0202] Choose a suitable height and a stable position to place the small animal gas anesthesia machine (Nanjing Calvin, #KW-MZJ). Place the mouse in the pre-anesthesia device of the small animal gas anesthesia machine, start the anesthesia switch, adjust the flow rate to the scale "5", and continue anesthesia for 5 minutes to put the mouse into an anesthesia state. Take out the mouse, place it on a foam board, and fix the limbs with a needle. Use surgical scissors to open the abdomen and chest. Puncture the left ventricle with an injection needle, and the needle stays in the left ventricle. Gently push the syringe to confirm that the liquid has not leaked. Cut the right atrial appendage for bleeding, and start to slowly push the perfusion PBS solution until the liquid flowing out of the right atrial appendage is basically bloodless.

[0203] After the perfusion is completed, surgical instruments are used to clamp the liver marginal membrane structure with blunt forceps and right-angle scissors to remove the complete liver tissue. According to the sampling requirements, use a sharp blade or right-angle scissors to cut the corresponding position. Generally, the outer part of the left lobe of the liver is taken. The removed liver tissue is placed in a centrifuge tube of appropriate size and directly frozen at -80° or fixed in 4% paraformaldehyde according to the requirements of subsequent testing.

[0204] Spray with alcohol for disinfection, and cut the neck with tissue scissors, making sure the cutting point is at the back of the skull. Try to keep the tip of the scissors in the shallow layer to avoid damaging the brain tissue. Starting from the midline incision near the eyes, open one side of the skull flap toward the sagittal suture of the skull, remove the complete brain tissue, and place it in a centrifuge tube of appropriate size. Depending on the requirements of subsequent testing, either directly freeze at -80° or fix it in 4% paraformaldehyde.

[0205] The method for immunofluorescence staining of mouse brain tissue is as follows:

[0206] After fixation, the brain tissue was embedded in paraffin. Sagittal sections were taken, 3-5 μm thick. The sections were washed with xylene-anhydrous ethanol-85% alcohol-75% alcohol-distilled water in sequence. The tissue sections were placed in a repair box filled with citric acid antigen repair buffer (PH6.0) in a microwave oven for antigen repair. After boiling on medium heat, turn off the power for 15 minutes and boil on medium-low heat. After natural cooling, the slides were placed in PBS (PH7.4) and washed on a decolorizing shaker for 3 times, 5 minutes each time. After the sections were slightly dried, 5% goat serum was evenly covered with the tissue and blocked at room temperature for 60 minutes. Gently shake off the blocking solution, add 5% BSA to the sections according to the proportion of primary antibodies, and the sections were placed flat in a humidified box and incubated overnight at 4°C. The slides were placed in PBS (PH7.4) and washed on a decolorizing shaker for 3 times, 5 minutes each time. After the sections were slightly dried, the secondary antibody added in the circle was covered with the tissue (antibody information is shown in Table 1), and incubated at room temperature for 60 minutes away from light. The slides were placed in PBS (PH7.4) and washed 3 times on a decolorizing shaker, 5 minutes each time. The sections were slightly dried and then sealed with DAPI anti-fluorescence quenching sealing medium (Biyuntian, #P0131-25mL). The sections were placed under a fluorescence microscope and photographed.

[0207] Table 1. Antibody Information

[0208]

[0209]

[0210] The HE staining method for mouse brain tissue is as follows:

[0211] After rehydrating the paraffin sections of mouse brain tissue in sequence, hematoxylin (Solarbio, #G1080) was added for staining for 5 minutes. Rinsed with running water for 10 minutes and immersed in distilled water for several seconds. Differentiated with hematoxylin differentiation solution (Solarbio, #G1039) for 30 seconds. Eosin staining solution (Solarbio, #G1001) was added for staining for 30 seconds. Placed in 80% ethanol for 10 seconds, 90% ethanol for 10 seconds, absolute ethanol for 10 seconds, xylene I for 5 minutes, and xylene II for 5 minutes in sequence. Air-dried naturally, sealed with neutral gum, and photographed.

[0212] Example 1: Construction and virus production and purification of adeno-associated virus vector

[0213] 1.1 Construction of recombinant adeno-associated virus vector

[0214] The structure of the hMeCP2 expression cassette without regulatory elements is as shown in Figure 1 A. The hMeCP2 expression cassette without regulatory elements contains 5' ITR, CBh promoter (CMV enhancer, CAG promoter, hybrid intron) / Mecp2 promoter, Kozak sequence, full-length hMeCP2-EGFP fusion protein gene / full-length hMeCP2 gene, BGH polyA, and 3' ITR in sequence from the 5' end to the 3' end.

[0215] The structure of the hMeCP2 expression cassette containing regulatory elements such as ATHS, 2*ATHS, eAT1-loop, eAT2-loop, eAT3-loop, or miniMBD-loop is as shown in Figure 1 B. The hMeCP2 expression cassette containing these regulatory elements contains 5' ITR, CBh promoter (CMV enhancer, CAG promoter, hybrid intron) / Mecp2 promoter, regulatory sequence (REG), Kozak sequence, full-length hMeCP2-EGFP fusion protein gene / full-length hMeCP2 gene, BGH polyA, and 3' ITR in sequence from the 5' end to the 3' end.

[0216] Among them, the nucleotide sequence of the 5' ITR is as shown in SEQ ID NO: 4 (TTGGCCACTCCCTCTCTGCGCGCTCGCTCGC TCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCG AGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT);

[0217] CBh promoter (CMV enhancer, CAG promoter, hybrid intron), whose nucleotide sequence is shown in SEQ ID NO: 5 (TTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAAC TTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTTGGCAGTACATCTCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGCTGCGTTGCCTTCGCCCCGTGCCCCGCTCCGCGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTGTAATTAGCAAGAGGTAAGGGTTTAAGGGATGGTTGGTTGGTGGGGTATTAATGTTTAATTACCTGTTTTACAGGCCTGAAATCACTTGGTTTTAGGTTGG); The CBh promoter can initiate the expression of the target gene in cultured tissue cells and can also stably and long-term express in the nervous system, especially neurons;

[0218] The Mecp2 promoter is a part (426 bp) of the mouse Mecp2 promoter, and its nucleotide sequence is shown in SEQ ID NO: 6 (AT AGGCGCCAAGAGCCTAGACTTCCTTAAGCGCCAGAGTCCACAAGGGCCCAGTTAATCCTCAACATTCAAATGCTGCCCACAAAACCAGCCCCTCTGTGCCCTAGCCGCCTCTTTTTTCCAAGTGACAGTAGAACTCCACCAATCCGCAGCTGAATGGGGTCCGCCTCTTTTCCCTGCCTAAACAGACAGGAACTCCTGCCAATTGAGGGCGTCACCGCTAAGGCTCCGCCCCAGCCTGGGCTCCACAACCAATGAAGGGTAATCTCGACAAAGAGCAAGGGGTGGGGCGCGGGCGCGCAGGTGCAGCAGCACACAGGCTGGTCGGGAGGGCGGGGCGCGACGTCTGCCGTGCGGGGTCCCGGCATCGGTTGCGCGCGCGCTCCCTCCTCTCGGAGAGAGGGCTGTGGTAAAACCCGTCCGGAAA); the Mecp2 promoter is a nervous system-specific promoter, which is beneficial to the stable expression of the vector in the nervous system, especially in neurons;

[0219] The Kozak sequence was inserted before the hMeCP2 gene sequence, and its sequence is: gccacc.

[0220]

[0221] The full-length hMeCP2-EGFP fusion protein contains full-length hMeCP2 and EGFP, which are directly linked. The nucleotide sequence of EGFP is shown in SEQ ID NO: 12 (CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGC CTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCA TTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTG GGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGG).

[0222] BGH polyA is the bovine growth hormone polyadenylation signal, and its nucleotide sequence is shown in SEQ ID NO: 8 (CTGTGCCTTC TAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGG). BGH polyA can effectively terminate the transcription process of the vector.

[0223] The nucleotide sequence of the 3’ ITR is shown in SEQ ID NO: 9 (AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCG GGCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAA).

[0224] Regulatory sequences containing different regulatory elements or combinations thereof are as follows:

[0225] Modified AT-hook binding sequence (ATHS), whose nucleotide sequence is shown in SEQ ID NO: 10 (GGACCTGGAATATCGCGAGAAAACTGAAAATCACGGAAAATAAGAAATACACACTTTAGGACGTGAAATATCGCGAGGAAAACTGAAAAGGTGGAAAATTTAGAAATATCCACTGTAGGACGTGGAATATCGCAAGACACTGAAAATCATCGAAAATTAGAAACATCCACTTGACGACTTGAAAAATAACGAAATCACTAAAAAACGTGAAAAAAGAGAAATCCACACTGA). The ATHS sequence is a mouse satellite DNA sequence that can be recognized and bound by the MeCP2 protein. After the MeCP2 protein binds to the ATHS, it can play a role in occupying the position and reduce the gene expression level of the vector. The hMeCP2 expression cassette containing ATHS sequentially includes 5' ITR, CBh promoter / Mecp2 promoter, ATHS, Kozak sequence, full-length hMeCP2-EGFP fusion protein gene, BGH polyA, and 3' ITR from the 5' end to the 3' end.

[0226] 2*ATHS, whose nucleotide sequence is shown in SEQ ID NO: 11 (GGACCTGGAATATCGCGAGAAAACTGAAAATCACGGAAAATAAGAAATACACACTTTAGGACGTGAAATATCGCGAGGAAAACTGAAAAGGTGGAAAATTTAGAAATATCCACTGTAGGACGTGGAATATCGCAAGACACTGAAAATCATCGAAAATTAGAAACATCCACTTGACGACTTGAAAAATAACGAAATCACTAAAAAACGTGAAAAAAGAGAAATCCACACTGA AACGCGTcgtGGACCTGGAATATCGCGAGAAAACTGAAAATCACGGAAAATAAGAAATACACACTTTAGGACGTGAAATATCGCGAGGAAAACTGAAAAGGTGGAAAATTTAGAAATATCCACTGTAGGACGTGGAATATCGCAAGACACTGAAAATCATCGAAAATTAGAAACATCCACTTGACGACTTGAAAAATAACGAAATCACTAAAAAACGTGAAAAAAGAGAAATCCACACTGA). The 2*ATHS sequence is a tandem of two ATHS sequences (tandemly linked by a linker sequence (underlined)), and 2*ATHS binds to the MeCP2 protein, reducing the gene expression level of the vector. The hMeCP2 expression cassette containing 2*ATHS sequentially contains, from the 5' end to the 3' end, 5' ITR, CBh promoter / Mecp2 promoter, 2*ATHS, Kozak sequence, full-length hMeCP2-EGFP fusion protein gene / full-length hMeCP2 gene, BGH polyA, and 3' ITR.

[0227] 3*ATHS. 3*ATHS is composed of a 2*ATHS sequence in front of the target gene and an ATHS sequence behind the target gene. The MeCP2 sequence binds to 3*ATHS, which can reduce the gene expression level of the vector. The structure of the hMeCP2 expression cassette containing the 3*ATHS regulatory element is as Figure 1 shown in C. The hMeCP2 expression cassette containing 3*ATHS sequentially contains, from the 5' end to the 3' end, 5' ITR, CBh promoter / Mecp2 promoter, 2*ATHS, Kozak sequence, full-length hMeCP2-EGFP fusion protein gene, ATHS, BGH polyA, and 3' ITR.

[0228] eAT-loop1, whose sequence is shown in SEQ ID NO: 13 (GAGAAACCGTGTAAACAAAACATAACTGAGAGG). eAT-loop1 can form a circular RNA after transcription, which can be recognized and bound by the MeCP2 protein, preventing other proteins from binding to the mRNA and reducing the translation level. The hMeCP2 expression cassette containing eAT-loop1 sequentially contains, from the 5' end to the 3' end, 5' ITR, CB h promoter / Mecp2 promoter, eAT-loop1, Kozak sequence, full-length hMeCP2-EGFP fusion protein gene, BGH polyA, and 3' ITR.

[0229] eAT-loop2, whose sequence is shown in SEQ ID NO: 14 (AGTTCCATTTTGTTTTCAAACTCTATTACCTACAA GATTTGAAC). eAT-loop2 can form a circular RNA after transcription. This RNA can be recognized and bound by the MeCP2 protein, hindering the binding of other proteins to mRNA and reducing the translation level. The hMeCP2 expression cassette containing eAT-loop2 sequentially includes 5' ITR, CBh promoter / Mecp2 promoter, eAT-loop2, Kozak sequence, full-length hMeCP2-EGFP fusion protein gene, BGH polyA, and 3' ITR from the 5' end to the 3' end.

[0230] eAT-loop3, whose sequence is shown in SEQ ID NO: 15 (AGTTCCATAGTGTTTTCAAACTCTATTACCTACAC TATTTGAAC). eAT-loop3 can form a circular RNA after transcription. This RNA can be recognized and bound by the MeCP2 protein, hindering the binding of other proteins to mRNA and reducing the translation level. The hMeCP2 expression cassette containing eAT-loop3 sequentially includes 5' ITR, CBh promoter / Mecp2 promoter, eAT-loop3, Kozak sequence, full-length hMeCP2-EGFP fusion protein gene, BGH polyA, and 3' ITR from the 5' end to the 3' end.

[0231] miniMBD-loop, whose sequence is shown in SEQ ID NO: 16 (GGGGGGGTCATTTTTGGGGAAACCCTGTCTCTT TCC). miniMBD-loop can form a circular RNA after transcription. This RNA can be recognized and bound by the MBD structure of the MeCP2 protein, hindering the binding of other proteins to mRNA and reducing the translation level. The hMeCP2 expression cassette containing miniMBD-loop sequentially includes 5' ITR, CBh promoter / Mecp2 promoter, miniMBD-loop, Kozak sequence, full-length hMeCP2-EG FP fusion protein gene / full-length hMeCP2 gene, BGH polyA, and 3' ITR from the 5' end to the 3' end.

[0232] The above hMeCP2 expression cassette without regulatory elements or hMeCP2 expression cassette containing regulatory elements was inserted between the promoter sequence and the target gene sequence of vector pAAV through the SpeI / BglII sites in a seamless homologous recombination manner (where 3*ATHS was formed by inserting 2*ATHS sequence before the target gene and ATHS sequence after the target gene), obtaining shuttle plasmids with hMeCP2 expression cassette without regulatory elements and CBh promoter (pAAV-CBh-Non-REG-hMeCP2-EGFP, pAAV-CBh-Non-REG-hMeCP2), shuttle plasmids with hMeCP2 expression cassette without regulatory elements and Mecp2 promoter (pAAV-Mecp2-Non-REG-hMeCP2-EGFP, pAAV-Mecp2-Non-REG-hMeCP2), shuttle plasmids with hMeCP2 expression cassette containing regulatory elements and CBh promoter (pAAV-CBh-ATHS-hMECP2-EGFP, pAAV-CBh-2*ATHS-hMECP2-EGFP, pAAV-CBh-3*ATHS-hMECP2-EGFP, pAAV-CBh-eAT-loop1-hMeCP2-EGFP, pAAV-CBh-eAT-loop2-hMeCP2-EGFP, pAAV-CBh-eAT-loop3-hMeCP2-EGFP, pAAV-CBh-miniMBD-loop-hMeCP2-EGFP, pAAV-CBh-2*ATHS-hMECP2, pAAV-CBh-miniMBD-loop-hMeCP2), shuttle plasmids with hMeCP2 expression cassette containing regulatory elements and Mecp2 promoter (pAAV-Mecp2-2*ATHS-hMeCP2, pAAV-Mecp2-miniMBD-loop-hMeCP2).

[0233] Example 2: Regulation of transgenic expression by different REG elements and combinations in combination with CBh promoter in wild-type 293 cells

[0234] In this example, the regulatory effects of different REG combinations on overexpression of transgenic vectors were evaluated in the 293 cell line (293-WT) as follows:

[0235] The method of liposome transfection of plasmids (the shuttle plasmids are pAAV-CBh-Non-REG-hMeCP2-EGFP (CBh-Non-REG), pAAV-CBh-ATHS-hMeCP2-EGFP (CBh-ATHS), pAAV-CBh-2*ATHS-hMeCP2-EGFP (CBh-2*ATHS), pAAV-CBh-3*ATHS-hMeCP2-EGFP (CBh-3*ATHS) respectively) was used to introduce the target gene into cells (293-WT) (the transfection concentrations were 500 ng / 4.5E+5 cells respectively), cultured, total cellular proteins were extracted, and semi-quantitative analysis by Western Blot was performed. The results are as Figure 2 Shown in A and 2B: Compared with pAAV-CBh-Non-REG-hMeCP2-EGFP, the expression levels of the full-length hMeCP2-EGFP fusion protein in pAAV-CBh-ATHS-hMeCP2-EGFP, pAAV-CBh-2*ATHS-hMeCP2-EGFP, and pAAV-CBh-3*ATHS-hMeCP2-EGFP were down-regulated to varying degrees, indicating that the regulatory elements (ATHS, 2*ATHS, 3*ATHS) in the present invention can down-regulate the expression level of the full-length hMeCP2-EGFP fusion protein, and with the increase of ATHS, the down-regulation amplitude is greater.

[0236] The method of liposome transfection of plasmids (the shuttle plasmids are pAAV-CBh-Non-REG-hMeCP2-EGFP (CBh-Non-REG), pAAV-CBh-eAT-loop1-hMeCP2-EGFP (CBh-eAT1-loop), pAAV-CBh-eAT-loop2-hMeCP2-EGFP (CBh-eAT2-loop), pAAV-CBh-eAT-loop3-hMeCP2-EGFP (CBh-eAT3-loop), pAAV-CBh-miniMBD-loop-hMeCP2-EGFP (CBh-miniMBD) respectively) was used to introduce the target gene into cells (293-WT) (the transfection concentrations were 500 ng / 4.5E+5 cells respectively), cultured, total cellular proteins were extracted, and semi-quantitative analysis by Western Blot was performed. The results are as Figure 2 Shown in C and 2D: The regulatory elements (eAT-loop2, miniMBD-loop) in the present invention can down-regulate the expression level of the full-length hMeCP2-EGFP fusion protein.

[0237] Example 3: Regulation of Transgene Expression by Different REG Elements Binding to the CBh Promoter in MeCP2 Mutant 293 Cells

[0238] In this example, the regulatory effects of different REG combinations on the overexpression of transgenic vectors were evaluated in a 293 cell line (293-270X) with a nonsense mutation at position 270 of the MeCP2 gene (using the CRISPR-Cas9 gene editing technique, the gene sequence encoding the 270th amino acid of the MeCP2 protein in 293 cells was mutated to nonsense, so that only truncated hMeCP2 protein could be translated. Since this protein has functional defects and will be degraded quickly, there is a lack of intact MeCP2 protein in the cells). The specific steps are as follows:

[0239] The target genes were introduced into the cells (293-270X) by liposome transfection of plasmids (the shuttle plasmids were pAAV-CBh-Non-REG-hMeCP2-EGFP (CBh-Non-REG), pAAV-CBh-ATHS-hMeCP2-EGFP (CBh-ATHS), pAAV-CBh-2*ATHS-hMeCP2-EGFP (CBh-2*ATHS), pAAV-CBh-3*ATHS-hMeCP2-EGFP (CBh-3*ATHS)) (the transfection concentrations were 500 ng / 4.5E+5 cells respectively). After culturing, the total cell proteins were extracted and subjected to Western Blot semi-quantitative analysis. The results are as Figure 3 shown in Figures A and 3B: Compared with pAAV-CBh-Non-REG-hMeCP2-EGFP, the expression levels of the full-length hMeCP2-EGFP fusion protein in pAAV-CBh-ATHS-hMeCP2-EGFP, pAAV-CBh-2*ATHS-hMeCP2-EGFP, and pAAV-CBh-3*ATHS-hMeCP2-EGFP were down-regulated to varying degrees, but the decline was reduced (compared with Example 2); indicating that the regulatory elements (ATHS, 2*ATHS, 3*ATHS) in the present invention can respond to the endogenous hMeCP2 level and relieve the negative regulation of the expression of the hMeCP2-EGFP fusion protein in cells without endogenous MeCP2.

[0240] The method of liposome transfection of plasmids (the shuttle plasmids are pAAV-CBh-Non-REG-hMeCP2-EGFP (CBh-Non-REG), pAAV-CBh-eAT-loop1-hMeCP2-EGFP (CBh-eAT1-loop), pAAV-CBh-eAT-loop2-hMeCP2-EGFP (CBh-eAT2-loop), pAAV-CBh-eAT-loop3-hMeCP2-EGFP (CBh-eAT3-loop), pAAV-CBh-miniMBD-loop-hMeCP2-EGFP (CBh-miniMBD)) was used to introduce the target gene into cells (293-270X) (the transfection concentrations were 500 ng / 4.5E+5 cells), cultured, total cellular proteins were extracted, and Western Blot semi-quantitative analysis was performed. The results are as Figure 3 Shown in C and 3D: The regulatory elements (eAT-loop2, miniMBD-loop) in the present invention can down-regulate the expression level of the full-length hMeCP2-EGFP fusion protein, but the decrease amplitude is reduced, indicating that the regulatory elements (eAT-loop2, miniMBD-loop) in the present disclosure can respond to the endogenous hMeCP2 level and alleviate the negative regulation of the expression of the hMeCP2-EGFP fusion protein in cells without endogenous MeCP2.

[0241] Example 4: Regulation of transgenic expression concentration gradient curve by the 2*ATHS element binding to the CBh promoter in MeCP2-KO type 293 cells

[0242] In this example, the regulatory effects of different REG combinations on the overexpression of transgenic vectors were evaluated in a 293 cell line with MeCP2 gene knockout (293-KO, MECP2 gene mutation) (using the CRISPR-Cas9 gene editing technology, a frameshift mutation was introduced at the gene sequence encoding the 76th amino acid Glu of the MeCP2 protein in 293 cells, resulting in the inability of the cells to express the complete MeCP2 protein). The specific steps are as follows:

[0243] The method of liposome transfection of plasmids (the shuttle plasmids are pAAV-CBh-Non-REG-hMeCP2-EGFP (CBh-Non-REG), pAAV-CBh-2*ATHS-hMeCP2-EGFP (CBh-2*ATHS)) was used to introduce the target gene into cells (293-KO) (the transfection concentrations were 0.00, 0.05, 0.10, 0.20, 0.40, 0.80, 1.60 μg / 4.5E+5 cells), cultured, photographed under the green fluorescence channel of a fluorescence microscope, and then ImageJ analysis was performed. The results are asFigure 4 As shown, compared with pAAV-CBh-Non-REG-hMeCP2-EGFP, pAAV-CBh-2*ATHS-hMeCP2-EGFP down-regulates the expression level of the full-length hMeCP2-EGFP fusion protein at different transfection concentrations, indicating that the regulatory element (2*ATHS) in the present invention can down-regulate the expression level of the full-length hMeCP2-EGFP fusion protein.

[0244] Example 5. Different REG elements and combinations bind to the Mecp2 promoter to regulate transgene expression in wild-type 293 cells

[0245] In this example, the regulatory effects of different REG combinations and Mecp2 promoter combinations on the overexpression of transgenic vectors were evaluated in the 293 cell line (293-WT) as follows:

[0246] Using the method of liposome transfection of plasmids (the shuttle plasmids were pAAV-Mecp2-Non-REG-hMeCP2 (Mecp2-Non-REG), pAAV-Mecp2-2*ATHS-hMeCP2 (Mecp2-2*ATHS), pAAV-Mecp2-miniMBD-loop-hMeCP2 (Mecp2-mini MBD)), the target gene was introduced into the cells (293-WT) (the transfection concentrations were 500 ng / 4.5E+5 cells), cultured, the total cell protein was extracted, and Western Blot semi-quantitative analysis was performed. The results are as Figure 5 Shown in A, 5B: Under the Mecp2 promoter, adding the 2*ATHS regulatory element or the miniMBD regulatory element can down-regulate the expression of exogenous hMeCP protein. Combining the results of Examples 2-4, it shows that the regulatory elements (2*ATHS, miniMBD) of the present invention can down-regulate the expression level of hMeCP under the drive of different promoters.

[0247] Example 6: After intracerebroventricular administration of AAV virus of the hMeCP2 / EGFP fusion protein expression vector carrying the 2*ATHS or miniMBD regulatory element under the CBh promoter to 4-5-week-old WT mice, the safety can be improved compared with the AAV virus without the regulatory element

[0248] 4- to 5-week-old mice can mimic RTT patients around 10 years old in humans. Intracerebroventricular injection was performed on male C57 mice at 4-5 weeks of age. Each mouse was injected with 10 μL of AAV9 virus carrying different vectors (shuttle plasmids were pAAV-CBh-Non-REG-hMeCP2-EGFP (CBh-Non-REG), pAAV-CBh-2*ATHS-hMeCP2-EGFP (CBh-2*ATHS), pAAV-CBh-miniMBD-loop-hMeCP2-EGFP (CBh-miniMBD)) at a dose of 5E+11 vg / mouse, and a vehicle control group was also established. After injection, the mice were normally raised and subjected to behavioral observation for 10 W (the injection day was recorded as the 0th W). The results are as Figure 6 shown: The mortality rate of mice decreased for the transgenic vectors carrying the 2*ATHS and miniMBD regulatory elements compared to the Non-REG vector ( Figure 6 A); and the body weight of the mice in the groups carrying the 2*ATHS and miniMBD regulatory elements continued to increase and was significantly higher than that of the Non-REG vector group at 3-7 weeks ( Figure 6 B). Moreover, the hindlimb clasping score of the mice (total score of 2 points) showed that the degree of hindlimb clasping decreased in the groups carrying the 2*ATHS and miniMBD regulatory elements ( Figure 6 C). After immunohistofluorescence analysis, the results showed that adding the 2*ATHS regulatory element could downregulate the expression intensity of the full-length hMeCP2-EGFP transgene mediated by AAV9 ( Figure 6 D-6E).

[0249] Example 7: After intracerebroventricular administration of AAV virus carrying the hMeCP2 protein expression vector with the 2*ATHS or miniMBD regulatory element under the CBh promoter to neonatal 1-3-day-old WT mice, the safety can be significantly improved compared to the AAV virus without regulatory elements

[0250] Intracerebroventricular injection was performed on neonatal 1-3-day-old C57 mice. Each mouse was injected with 6 μL of AAV9 virus carrying different vectors (shuttle plasmids were pAAV-CBh-Non-REG-hMeCP2 (CBh-Non-REG), pAAV-CBh-2*ATHS-hMeCP2 (CBh-2*ATHS), pAAV-CBh-miniMBD-loop-hMeCP2 (CBh-miniMBD)) at a dose of 3E+11 vg / mouse, and a vehicle control group was also established. After injection, the mice were normally raised and subjected to behavioral observation for 20 W (the injection day was recorded as the 0th W). The results are as Figure 7Shown: Under the drive of the CBh promoter, the mortality rate of mice carrying the 2*ATHS and miniMBD regulatory elements is much lower than that of the Non-REG vector injection group ( Figure 7 A), and the body weight of mice in the group carrying the 2*ATHS and miniMBD regulatory elements continued to increase and was higher than that of the Non-REG vector group ( Figure 7 B).

[0251] Example 8: Under the Mecp2 promoter, an AAV virus of an hMeCP2 protein expression vector carrying the 2*ATHS or miniMBD regulatory element was administered intracerebroventricularly to neonatal WT mice aged 1-3 days. Compared with the AAV virus without the regulatory element, the safety can be improved.

[0252] Neonatal C57 mice aged 1-3 days were injected intracerebroventricularly, and each mouse was injected with 6 μL of AAV9 virus carrying different vectors (the shuttle plasmids were pAAV-Mecp2-Non-REG-hMeCP2 (Mecp2-Non-REG), pAAV-Mecp2-2*ATHS-hMeCP2 (Mecp2-2*ATHS), pAAV-Mecp2-miniMBD-loop-hMeCP2 (Mecp2-miniMBD)) (the dose was 3E+11 vg / mouse), and a solvent administration control group was established at the same time. The mice were normally raised and behaviorally observed for 20W (the injection day was recorded as the 0W). The results are as Figure 8 Shown: Under the drive of the Mecp2 promoter, the mortality rate of mice carrying the 2*ATHS and miniMBD regulatory elements is much lower than that of the Non-REG vector injection group ( Figure 8 A), and the body weight of mice with 2*ATHS and miniMBD continued to increase and was higher than that of the Non-REG vector group ( Figure 8 B).

[0253] Example 9: Under the Mecp2 promoter, an AAV virus of an hMeCP2P protein expression vector carrying the 2*ATHS element was administered intracerebroventricularly to neonatal MeCP2-KO (mecp2 - / Y ) mice, and the lifespan of the mice can be extended

[0254] Male C57 mice (C57BL / 6J-Mecp2 - / Y ) aged 1-3 days of MeCP2-KO (mecp2 em1CIntracerebroventricular injection was performed with different doses (1E+11 vg / mouse and 3E+11 vg / mouse respectively) of AAV9 virus carrying the vector (shuttle plasmid is pAAV-Mecp2-2*ATHS-hMeCP2) into male C57 normal mice (vehicle (WT)) and MeCP2-KO (mecp2 - / Y ) male C57 mice (vehicle) at 1-2 days after birth. Equal amounts of vehicle were injected intracerebroventricularly. After injection, the mice were normally fed and observed behaviorally (the injection day was recorded as week 0W). The results are as Figure 9 shown: Injecting AAV9 virus carrying the vector (shuttle plasmid is pAAV-Mecp2-2*ATHS-hMeCP2) can extend the lifespan of mice. The longest lifespan in the 1E+11 vg / mouse dose group was 19W, and the longest lifespan in the 3E+11 vg / mouse dose group was 31W, while the average lifespan of the mice in the vehicle injection group was 9W ( Figure 9 A). And compared with the vehicle group, the body weight of the mice injected with AAV9 virus carrying the vector (shuttle plasmid is pAAV-Mecp2-2*ATHS-hMeCP2) continued to increase ( Figure 9 B).

[0255] Example 10: After intracisternal injection of AAV virus carrying the hMeCP2P protein expression vector with the 2*ATHS element under the MeCP2 promoter into 4-5-week-old MeCP2-KO (mecp2 - / Y ) mice, the lifespan of the mice can be extended

[0256] Intracisternal injection was performed on 4-5-week-old MeCP2-KO (mecp2 - / Y ) male C57 mice. Each mouse was injected with 1E+12 vg / mouse of AAV9 virus carrying the vector (shuttle plasmid is pAAV-Mecp2-2*ATHS-hMeCP2), and a vehicle administration control group was established at the same time. After injection, the mice were normally fed and observed behaviorally for 20W (the injection day was recorded as week 0W). The results are as Figure 10 shown. Injecting AAV9 virus carrying the vector (shuttle plasmid is pAAV-Mecp2-2*ATHS-hMeCP2) can extend the average lifespan of mice by 15W (50%) ( Figure 10 A). The body weight of the mice showed an upward trend from 5 to 12 weeks ( Figure 10 B).

[0257] The technical solutions of the present invention are not limited to the limitations of the above specific embodiments. Any technical deformation made according to the technical solutions of the present invention falls within the protection scope of the present invention.

Claims

1. Regulatory element or combination thereof, said regulatory element comprising: DNA regulatory element and / or RNA regulatory element; Said DNA regulatory element specifically binds to the protein encoded by the target gene to inhibit the transcription of said target gene; The transcription product of said RNA regulatory element specifically binds to the protein encoded by the target gene to inhibit the translation of said target gene.

2. The regulatory element or combination thereof according to claim 1, wherein: The target genes include MeCP2, PRKCZ, TTC34, PRDM16, ARHGEF16, PARK7, PRDM2, IGSF21, PTCH2, NFIA, ST6GALNAC3, DPYD, COL11A1, PDZK1, GPR89A, NBPF11, GPR89B, KCNT2, CFHR2, ASPM, PTPRC, GPATCH2, DUSP10, GPR137B, RYR2, CHRM3, RGS7, AKT3, KIF26B, SMYD3, LPIN1, EPCAM, MSH2, NRXN1, XPO1, LRP1B, ZEB2, ACVR2A, MBD5, KIF5C, SCN1A, COL3A1, PMS1, PLCL1, SATB2, PARD3B, EPHA4, SPHKAP, CHL1, GRM7, TRANK1, DOCK3, FAM19A1, FOXP1, ROBO1, CADM2, FOXL2, SOX2, LPP, RASGEF1B, GRID2, FAT4, NR3C2, LRBA, FGA, GALNTL6, WWC2, TLR3, IRX2, IRX1, CDH12, CDH9, NIPBL, HEXB, MEF2C, GRAMD3, FBN2, PRELID2, TCOF1, GABRG2, MSX2, NSD1, FOXC1, CDYL, TBC1D7, RUNX2, MUT, RIMS1, NKAIN2, LAMA2, ARID1B, PARK2, PACRG, QKI, TNRC18, FBXL18, SUGCT, GLI3, AUTS2, MLXIPL, COL1A2, PPP1R9A, CFTR, TSPAN12, GRM8, CNTNAP2, MNX1, CSMD1, MCPH1, LPL, ANK1, IMPAD1, CHD7, VCPIP1, TRPS1, PARP10, DOCK8, KANK1, GLIS3, PTPRD, MLLT3, ROR2, PTCH1, AL162389.

1. At least one of ARRDC1, EHMT1, PCDH15, CTNNA3, ADK, BMPR1A, PAX2, BTRC, INPP5A, MRPL23, ELP4, PAX6, CPT1A, DYNC2H1, KIRREL3, WNK1, CACNA1C, PPFIBP1, TBX5, MED13L, NALCN, CHD8, MYH7, TTC6, DAAM1, NRXN3, MTA1, SNRPN, UBE3A, OCA2, HERC2, CHRFAM7A, ARHGAP11B, OTUD7A, FBN1, HEXA, SNUPN, NRG4, AC112693.2, IGF1R, LRRC28, HBA2, HBQ1, CREBBP, RBFOX1, CDR2, CDH13, CYBA, NXN, YWHAE, SMG6, METTL16, PAFAH1B1, ADORA2B, NT5M, RAI1, NF1, C17orf67, PITPNC1, ACOX1, TCF4, DOCK6, CACNA1A, LPHN1, ZSCAN5A, BMP2, MYT1, PEX26, USP18, DGCR6L, USP41, UBE2L3, NF2, LARGE, BRD1, SHANK3, CDKL5, FXN, SMN1, F8, and INS; further being MeCP2;. Preferably, said DNA regulatory element is ATHS; Preferably, said RNA regulatory element is eAT1-loop, eAT2-loop, eAT3-loop, or miniMBD-loop.

3. The regulatory element or combination thereof according to claim 2, wherein, The sequence of said ATHS comprises: c1) SEQ ID NO: 10; or c2) A nucleotide sequence obtained by substituting, deleting and / or adding one or several nucleotides to SEQ ID NO: 10 and having the same function as the nucleic acid molecule shown in SEQ ID NO: 10; or c3) A nucleotide sequence having at least 99%, 98%, 97%, 96%, 95% homology with SEQ ID NO: 10 and having the same function as the nucleic acid molecule shown in SEQ ID NO: 10; Preferably, the sequence of said eAT-loop1 comprises: d1) SEQ ID NO: 13; or d2) A nucleotide sequence obtained by substituting, deleting and / or adding one or several nucleotides to SEQ ID NO: 13 and having the same function as the nucleic acid molecule shown in SEQ ID NO: 13; or d3) A nucleotide sequence having at least 99%, 98%, 97%, 96%, 95% homology with SEQ ID NO: 13 and having the same function as the nucleic acid molecule shown in SEQ ID NO: 13; Preferably, the sequence of said eAT-loop2 comprises: e1) SEQ ID NO: 14; or e2) A nucleotide sequence obtained by substituting, deleting and / or adding one or several nucleotides to SEQ ID NO: 14 and having the same function as the nucleic acid molecule shown in SEQ ID NO: 14; or e3) A nucleotide sequence having at least 99%, 98%, 97%, 96%, 95% homology with SEQ ID NO: 14 and having the same function as the nucleic acid molecule shown in SEQ ID NO: 14; Preferably, the sequence of said eAT-loop3 comprises: f1) SEQ ID NO: 15; or f2) A nucleotide sequence obtained by substituting, deleting and / or adding one or several nucleotides to SEQ ID NO: 15 and having the same function as the nucleic acid molecule shown in SEQ ID NO: 15; or f3) A nucleotide sequence having at least 99%, 98%, 97%, 96%, 95% homology with SEQ ID NO: 15 and having the same function as the nucleic acid molecule shown in SEQ ID NO: 15; Preferably, the sequence of the miniMBD-loop comprises: g1) SEQ ID NO: 16; or g2) a nucleotide sequence obtained by substituting, deleting, and / or adding one or several nucleotides to SEQ ID NO: 16 and having the same function as the nucleic acid molecule shown in SEQ ID NO: 16; or g3) a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95% homology with SEQ ID NO: 16 and having the same function as the nucleic acid molecule shown in SEQ ID NO: 16; Preferably, the regulatory element combination comprises a plurality of the regulatory elements; Preferably, the regulatory elements in the regulatory element combination may be the same or different; Preferably, the regulatory element or its combination is ATHS, 2*ATHS, 3*ATHS, eAT1-loop, eAT2-loop, eAT3-loop, or miniMBD-loop; 2*ATHS comprises 2 ATHS; 3*ATHS comprises 3 ATHS; further preferably 2*ATHS, 3*ATHS, eAT2-loop, or miniMBD-loop; more preferably 2*ATHS, or miniMBD-loop; Preferably, the sequence of the 2*ATHS comprises: h1) SEQ ID NO: 11; or h2) a nucleotide sequence obtained by substituting, deleting, and / or adding one or several nucleotides to SEQ ID NO: 11 and having the same function as the nucleic acid molecule shown in SEQ ID NO: 11; or h3) a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95% homology with SEQ ID NO: 11 and having the same function as the nucleic acid molecule shown in SEQ ID NO:

11.

4. An expression cassette, which comprises: j1) the regulatory element or its combination according to any one of claims 1-3.

5. The expression cassette according to claim 4, wherein the expression cassette further comprises: j2) the target gene according to any one of claims 1-3; Preferably, the DNA regulatory element is ATHS and the target gene is MeCP2; Preferably, the RNA regulatory element is eAT1-loop, eAT2-loop, eAT3-loop, or miniMBD-loop and the target gene is MeCP2; Preferably, the regulatory element or its combination is ATHS, 2*ATHS, 3*ATHS, eAT1-loop, eAT2-loop, eAT3-loop, or miniMBD-loop and the target gene is MeCP2; Preferably, the regulatory element or its combination is 2*ATHS, 3*ATHS, eAT2-loop, or miniMBD-loop and the target gene is MeCP2; Preferably, the regulatory element or its combination is 2*ATHS or miniMBD-loop, and the target gene is MeCP2.

6. The expression cassette according to any one of claims 4-5, characterized in that the expression cassette further comprises: a promoter; Preferably, the promoter comprises at least one of an inducible promoter, a constitutive promoter, and a tissue-specific promoter; and further comprises at least one of a CBh promoter, a methyl CpG-binding protein 2 promoter, an α-synuclein promoter, and a Ca 2+ / calmodulin-dependent protein kinase II promoter.

7. The expression cassette according to any one of claims 4-6, characterized in that the expression cassette further comprises: a polyadenylation signal; Preferably, the polyadenylation signal comprises one or more of SV40 polyA, human growth hormone polyA, bovine growth hormone polyA, β-globin polyA, α-globin polyA, ovalbumin polyA, κ-light chain polyA, synthetic polyA; more preferably bovine growth hormone polyA; Preferably, the expression cassette further comprises: a Kozak sequence; Preferably, the expression cassette further comprises: 5' inverted terminal repeat sequence and 3' inverted terminal repeat sequence; Preferably, the 5' inverted terminal repeat sequence is a 5' adeno-associated virus inverted terminal repeat sequence; Preferably, the 3' inverted terminal repeat sequence is a 3' adeno-associated virus inverted terminal repeat sequence.

8. The expression cassette according to any one of claims 4-7, characterized in that the expression cassette comprises: a 5' inverted terminal repeat sequence, a promoter, a regulatory element or its combination, a Kozak sequence, a target gene, a polyadenylation signal, and a 3' inverted terminal repeat sequence; Preferably, the expression cassette sequentially comprises from 5'-3': o1) a 5' inverted terminal repeat sequence, a promoter, a regulatory element or its combination, a Kozak sequence, the target gene MeCP2, a polyadenylation signal, and a 3' inverted terminal repeat sequence; the regulatory element or its combination is ATHS, 2*ATHS, eAT1-loop, eAT2-loop, eAT3-loop, or miniMBD-loop; or o2) a 5' inverted terminal repeat sequence, a promoter, a part of the regulatory element combination, a Kozak sequence, the target gene MeCP2, another part of the regulatory element combination, a polyadenylation signal, and a 3' inverted terminal repeat sequence; the regulatory element combination is 3*ATHS, a part of the regulatory element combination is 2*ATHS, and another part of the regulatory element combination is ATHS; Preferably, the expression cassette further comprises: a post-transcriptional regulatory element.

9. A vector comprising: the regulatory element or its combination according to any one of claims 1-3, or the expression cassette according to any one of claims 4-8.

10. The vector according to claim 9, characterized in that the vector is a viral vector; more preferably an adeno-associated virus vector.

11. A recombinant adeno-associated virus comprising: (p1) the regulatory element or its combination according to any one of claims 1-3, the expression cassette according to any one of claims 4-8, or the vector according to any one of claims 9-10.

12. The recombinant adeno-associated virus according to claim 11, characterized in that the recombinant adeno-associated virus further comprises: (p2) a capsid protein; Preferably, the capsid protein is selected from one or more of AAV2, AAV5, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAVtt, AAV2 / 2-7m8, and AAV2-HBKO serotype capsid proteins.

13. The method for preparing a recombinant adeno-associated virus according to any one of claims 11-12, which is packaged by the recombinant adeno-associated virus vector described in claim 10; Preferably, the method for preparing the recombinant adeno-associated virus comprises the following steps: transfecting a production cell with the recombinant adeno-associated virus vector, the packaging plasmid pAAV-RC, and the helper plasmid pHelper described in claim 10; Preferably, the method for preparing the recombinant adeno-associated virus further comprises a purification step.

14. A host cell, which comprises: the regulatory element or a combination thereof according to any one of claims 1-3, the expression cassette according to any one of claims 4-8, the vector according to any one of claims 9-10, or the recombinant adeno-associated virus according to any one of claims 11-12; Preferably, the host cell does not contain propagation materials.

15. A pharmaceutical composition, which comprises: the regulatory element or a combination thereof according to any one of claims 1-3, the expression cassette according to any one of claims 4-8, the vector according to any one of claims 9-10, the recombinant adeno-associated virus according to any one of claims 11-12, or the host cell according to claim 14.

16. The pharmaceutical composition according to claim 15, wherein the pharmaceutical composition further comprises: a pharmaceutically acceptable carrier; Preferably, the pharmaceutical composition further comprises: other active ingredients for preventing and / or treating diseases caused by insufficient expression of a target gene; Preferably, the diseases caused by insufficient expression of the target gene include at least one of Rett syndrome, fragile X syndrome, Angelman syndrome, Syngap-related intellectual disability, CDKl5 deficiency, Friedreich ataxia, spinal muscular atrophy, hemophilia, and diabetes; more preferably Rett syndrome.

17. The application of the regulatory element or a combination thereof according to any one of claims 1-3, the expression cassette according to any one of claims 4-8, the vector according to any one of claims 9-10, the recombinant adeno-associated virus according to any one of claims 11-12, the host cell according to claim 14, or the pharmaceutical composition according to any one of claims 15-16 in any one of a1)-a3): a1) Autoregulation of target gene expression; a2) Preparing a product for autoregulation of target gene expression; a3) Preparing a drug for preventing and / or treating diseases caused by insufficient expression of a target gene.

18. The application according to claim 17, wherein the target gene is the target gene described in any one of claims 1-3; Preferably, the diseases caused by insufficient expression of the target gene are the diseases described in claim 16; Preferably, the application in a1) is a non-therapeutic application.

Images