Application of BtRPSA gene in prevention and control of bemisia tabaci, reagent for prevention and control of bemisia tabaci and prevention and control method

Abstract

The invention discloses application of a BtRPSA gene in bemisia tabaci prevention and control, a bemisia tabaci prevention and control reagent and a bemisia tabaci prevention and control method, and belongs to the technical field of pest prevention and control. The nucleotide sequence of the bemisia tabaci BtRPSA gene is shown as SEQ ID NO.1, efficient silencing dsBtRPSA of the bemisia tabaci BtRPSA gene is prepared according to the BtRPSA gene, the dsBtRPSA is introduced into a bemisia tabaci body through a feeding method, the heat resistance of the bemisia tabaci can be remarkably reduced, and therefore the prevention and treatment purpose is achieved. The method is convenient to operate, high in effectiveness and specificity and remarkable in effect, has the advantages of being environmentally friendly and the like, and has a good application prospect in prevention and treatment of bemisia tabaci.

Description

Technical Field

[0001] The present invention belongs to the technical field of pest control, and particularly relates to the application of the BtRPSA gene in the control of Bemisia tabaci, a reagent for controlling Bemisia tabaci, and a control method. Background Art

[0002] Bemisia tabaci (Gennadius) belongs to the order Hemiptera, family Aleyrodidae, class Insecta. It was first reported in 1889 and was found on tobacco in Greece. In the past more than 40 years, this pest has become an important agricultural pest worldwide, causing serious economic losses to vegetables, cotton, etc.

[0003] Currently, the main method for controlling Bemisia tabaci is chemical control. Spraying with chemically synthesized insecticides such as organophosphates and carbamates can quickly and effectively kill Bemisia tabaci. The operation is simple and the effect is obvious, but it may cause harm to non-target organisms, and long-term use may lead to pest resistance to pesticides, causing environmental pollution and potential safety hazards. Biological control methods are environmentally friendly to the ecological environment and do not cause chemical residues, becoming a research hotspot in recent years.

[0004] RNA interference (RNAi) is a mechanism triggered by short fragments of RNAs (siRNAs) that promotes the degradation of homologous mRNA or inhibits its translation. RNAi was first discovered in nematodes and can function in most organisms. Using RNAi technology for gene function research, transgenic insect-resistant plants, and new nucleic acid pesticides has gradually become an important green biological control means in the plant protection industry. RNAi technology can specifically inhibit gene expression, efficiently target and silence pest genes, thereby achieving the purpose of pest control, showing great potential in developing new pest control strategies. Developing exogenous dsRNA products suitable for controlling Bemisia tabaci at the gene level is convenient to use, low in cost, and due to the specificity of genes, it can achieve precise control effects, is environmentally friendly, and has great application prospects in the control of Bemisia tabaci. Summary of the Invention

[0005] Aiming at the problems existing in the prior art, the purpose of the present invention is to provide the application of the BtRPSA gene in the control of Bemisia tabaci, a reagent for controlling Bemisia tabaci, and a control method.

[0006] To achieve the above purpose, the present invention adopts the following technical solutions:

[0007] Use of the Bemisia tabaci BtRPSA gene in the control of Bemisia tabaci or the preparation of a reagent for controlling Bemisia tabaci, wherein the nucleic acid sequence of the Bemisia tabaci BtRPSA gene is as shown in SEQ ID NO.1.

[0008] On the basis of the above solution, by means of gene silencing, the expression of the BtRPSA gene in Bemisia tabaci is inhibited, and the heat tolerance of Bemisia tabaci is reduced.

[0009] On the basis of the above solution, the means of gene silencing is RNA interference.

[0010] A dsRNA for the biological control of Bemisia tabaci, primers are designed for the Bemisia tabaci BtRPSA gene, and dsRNA targeting the Bemisia tabaci BtRPSA gene is synthesized; the nucleic acid sequence of the Bemisia tabaci BtRPSA gene is as shown in SEQ ID NO.1.

[0011] On the basis of the above solution, the primers are as shown in SEQ ID NO.2 and SEQ ID NO.3.

[0012] On the basis of the above solution, the nucleic acid sequence corresponding to the sense strand of the dsRNA is as shown in SEQ ID NO.4; the nucleotide sequence corresponding to the antisense strand is the reverse complementary sequence of SEQ ID NO.4.

[0013] A reagent for controlling Bemisia tabaci, containing the above dsRNA.

[0014] On the basis of the above solution, the concentration of dsRNA in the reagent for controlling Bemisia tabaci is ≥750 ng / μL.

[0015] A method for controlling Bemisia tabaci, by means of gene silencing, the expression of the BtRPSA gene in Bemisia tabaci is inhibited, and the heat tolerance of Bemisia tabaci is reduced, wherein the nucleic acid sequence of the Bemisia tabaci BtRPSA gene is as shown in SEQ ID NO.1.

[0016] On the basis of the above solution, the means of gene silencing is RNA interference.

[0017] On the basis of the above solution, the RNA interference is by means of feeding, so that Bemisia tabaci ingests the dsRNA of the BtRPSA gene.

[0018] On the basis of the above solution, the dsRNA of the BtRPSA gene is prepared by the following method:

[0019] Using the cDNA reverse transcribed from the total RNA of Bemisia tabaci as a template, PCR amplification is carried out with primers for synthesizing dsRNA, the PCR amplification product is recovered and purified and used as a template for in vitro transcription of dsRNA, and dsRNA is synthesized by in vitro transcription.

[0020] On the basis of the above solution, the primers for synthesizing dsRNA are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0021] On the basis of the above solution, the nucleic acid sequence corresponding to the sense strand of the dsRNA is shown in SEQ ID NO.4; the nucleotide sequence corresponding to the antisense strand is the reverse complementary sequence of SEQ ID NO.4.

[0022] On the basis of the above solution, the Bemisia tabaci is the MED cryptic species (Mediterranean, i.e., the Q biotype of Bemisia tabaci).

[0023] The present invention has the following beneficial effects:

[0024] The present invention provides the BtRPSA gene of Bemisia tabaci and its application in the control of Bemisia tabaci, and develops its highly efficient silencing dsRNA, and develops a technology capable of highly efficiently controlling Bemisia tabaci, that is, introducing dsBtRPSA into Bemisia tabaci by the feeding method, significantly reducing the heat tolerance of Bemisia tabaci, so as to achieve the control purpose. This method is convenient to operate, has strong effectiveness and specificity, remarkable effects, and has many advantages such as environmental friendliness, and has a good application prospect in the control of Bemisia tabaci. Description of the Drawings

[0025] Figure 1 Changes in the expression level of the BtRPSA gene in Bemisia tabaci in Lingshui area after feeding on dsEGFP and dsBtRPSA (* indicates significant differences between the control group and the treatment group, 0.01 < P ≤ 0.05);

[0026] Figure 2 Differences in the heat tolerance of Bemisia tabaci in Lingshui area at 42°C before and after interfering with BtRPSA (*** indicates significant differences between the control group and the treatment group, P ≤ 0.001).

[0027] Figure 3 Differences in the heat tolerance of Bemisia tabaci in Lingshui area at 43°C before and after interfering with BtRPSA (* indicates significant differences between the control group and the treatment group, 0.01 < P ≤ 0.05). Detailed Embodiments

[0028] The terms used in the present invention generally have the meanings commonly understood by those of ordinary skill in the art unless otherwise specified. The present invention will be further described in detail below with reference to specific examples and data. The following examples are only for illustrating the present invention and do not limit the scope of the present invention in any way.

[0029] In the experimental methods of the following examples, unless otherwise specified, they are all conventional methods, carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial channels.

[0030] The Bemisia tabaci used in the following examples is the MED cryptic species (Mediterranean, i.e., Q-type Bemisia tabaci), collected from Lingshui, Hainan in 2017, and then reared on tobacco plants in an insect rearing room (temperature 27±1°C, relative humidity 60±5%, photoperiod 16L:8D).

[0031] RNA extraction was carried out using the TRIzol extraction method (Thermo Fisher Scientific, USA). The reverse transcription reagent (EvoM-MLV RT Mix Kit with gDNA Clean for qPCR) was purchased from AG Ecorui Biotechnology Co., Ltd. The dsRNA synthesis kit (TranscriptAid T7 High Yield Transcription Kit) was purchased from Thermo Fisher Scientific Co., Ltd. The kit used for the PCR reaction system (Premix TaqTM) was purchased from TAKARA Biotechnology Co., Ltd. The SteadyPure micro PCR & gel extraction reagent was purchased from AG Ecorui Biotechnology Co., Ltd.

[0032] The data processing method for the following examples: For the analysis of the results of the bioassay of dsRNA on Bemisia tabaci, Excel 2021 was used to statistically analyze the searching speed of Bemisia tabaci, and the SPSS 26.0 software was used to perform independent sample T-tests for the analysis of differences between different groups. For the analysis of the changes in the expression levels of target genes after RNA interference, the RT-qPCR data was calculated using the 2 -△△Ct -ΔΔCt method (Ct represents the number of cycles). The SPSS 26.0 software was used to perform independent sample T-tests for data analysis.

[0033] Example 1

[0034] A dsRNA for the biological control of Bemisia tabaci was prepared by the following method:

[0035] (1) Primers were designed according to the open reading frame of the Bemisia tabaci BtRPSA gene (shown in SEQ ID NO.1) for the synthesis of dsRNA. The primer sequences are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0036] SEQ ID NO.1 (5’→3’):

[0037] ATGTCAGGCGGGCTAGACGTATTGAGTCTCAAAGAAGATGATGTGACCAAAATGCTGGTTGCCACTGCGCACATTGGCACAACCAATGTTAACTTCCAGTTGGAATCCTATGTCTACAAACGGAGGAAGGATGGTGTTCACATCATCAACCTGCGCAAAACTTGGGAGAAACTCCTGTTGGCCGCAAGAGCAATTGCTGCTGTAGAAAACCCTGCTGATGTCTACGTCATCTCTTCCCGGCCTTATGGACAGAGAGCAGTTCTTAAATTCGCCACTCACACTGGTGCCACCCCCATCGCTGGGCGATTCACACCTGGTGCTTTCACCAATCAGATTCAAGCTGCTTTCCGAGAGCCGCGTATCTTAGTTGTCACAGACCCTGAATTTGACCACCAACCTGTGACAGAAGGATCATATGTGAATATTCCTGTTATTGCGCTGTGCAGCACAGACTCCCCCACTCGTTACATCGATATCGCTATTCCATGTAATAACAAGACACCCACCTCAATAGGTCTTATGTGGTGGTTATTAGCACGTGAGGTTCTGAGGTTACGAGGTTTAATCACCCGAGAAAGCAAATGGGACGTCGTCGTTGACTTGTTCTTCTACAGAGACCCAGAAGAGGCAGAGAAAGAAGAACTGGCTGCAAAGGAAGCTGCTCCTGCTGCTGTCCCAGCTGTAAAGGCTGCTGAAGGTATCGAATACACAGCCCAGGCCGATGACTGGAATATCCCAGCCGTACCTGAGGTCGCCCCAGTCGCCCAAGATTGGAATGCTGAGGTCCCAGCCGTAGCTCCAGTCCCTGTTGCTGCTGCTGCACCAGTGTACGCACCACCCCCCACACAAGCTGCCGATGACTGGACTGCACCCGTTTCAGAGGAATGGCAAGCAGGCACAGAATGGGCCAGTGGTAGTGGGAACTGGAACTAA

[0038] dsBtRPSA-F: 5’-taatacgactcactatagggAAACGGAGGAAGGATGGTGT-3’ (SEQ ID NO.2);

[0039] dsBtRPSA-R: 5’-taatacgactcactatagggCGTCCCATTTGCTTTCTCGG-3’ (SEQ ID NO.3);

[0040] (2) Take 40 newly emerged adult Bemisia tabaci in a 1.5 mL centrifuge tube. Use the TRIzol method to extract the total RNA of Bemisia tabaci. After measuring the concentration and quality of the RNA using a NanoDrop One / OneC Microvolume UV-Vis Spectrophotometer (N60), use a reverse transcription kit (EvoM-MLV RT Mix Kit with gDNA Clean for qPCR, AG) to perform reverse transcription according to the instructions in the manual to synthesize the first strand of cDNA.

[0041] (3) Using the Bemisia tabaci cDNA synthesized in step (2) as a template, perform PCR amplification using the primer pairs shown in SEQ ID NO.2 and SEQ ID NO.3;

[0042] The reaction system for PCR amplification is: Premix Taq (TaKaRa TaqTM Version 2.0 plus dye) 25 μL, upstream primer (10 μmol / L) 2 μL, downstream primer (10 μmol / L) 2 μL, template 2 μL, supplemented with dd H2O to 50 μL.

[0043] The reaction program for PCR amplification is: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 40 s, for a total of 40 cycles; extension at 72°C for 10 min. Store the amplified product at 4°C.

[0044] (4) After the PCR program in step (3) is completed, use agarose gel electrophoresis to detect the amplification results, and use SteadyPure Micro PCR & Gel Extraction Kit (AG Inc.) to recover and purify the PCR product obtained above as a template for in vitro transcription of dsRNA.

[0045] The PCR amplification product with a size of 512 bp was obtained by PCR amplification. After sequencing and deleting the T7 promoter sequence, the nucleotide sequence with a size of 472 bp is the target sequence of gene BtRPSA for synthesizing dsRNA, as shown in SEQ ID NO.4; the dsRNA of gene BtRPSA is double-stranded RNA, consisting of a sense strand and an antisense strand. The nucleotide sequence corresponding to the sense strand is as shown in SEQ ID NO.4, and the nucleotide sequence corresponding to the antisense strand is the reverse complementary sequence of SEQ ID NO.4.

[0046] SEQ ID NO.4 (5’→3’):

[0047] AAACGGAGGAAGGATGGTGTTCACATCATCAACCTGCGCAAAACTTGGGAGAAACTCCTGTTGGCCGCAAGAGCAATTGCTGCTGTAGAAAACCCTGCTGATGTCTACGTCATCTCTTCCCGGCCTTATGGACAGAGAGCAGTTCTTAAATTCGCCACTCACACTGGTGCCACCCCCATCGCTGGGCGATTCACACCTGGTGCTTTCACCAATCAGATTCAAGCTGCTTTCCGAGAGCCGCGTATCTTAGTTGTCACAGACCCTGAATTTGACCACCAACCTGTGACAGAAGGATCATATGTGAATATTCCTGTTATTGCGCTGTGCAGCACAGACTCCCCCACTCGTTACATCGATATCGCTATTCCATGTAATAACAAGACACCCACCTCAATAGGTCTTATGTGGTGGTTATTAGCACGTGAGGTTCTGAGGTTACGAGGTTTAATCACCCGAGAAAGCAAATGGGACG

[0048] (5) Using the purified PCR product in step (4) as a template for in vitro transcription of dsRNA to prepare dsRNA;

[0049] The in vitro transcription system for dsRNA is: 8 μL of NTPMix, 4 μL of 5×TranscriptAid Reaction Buffer, 2 μL of TrunscriptAid Enzyme Mix, and 6 μL of template. Incubate at 37°C for more than 2 h.

[0050] After the reaction, a single-enzyme digestion system was added to remove the remaining template DNA and single-stranded RNA. The single-enzyme digestion system was as follows: 2 μL of DNaseⅠ. Incubate at 37 °C for 30 min.

[0051] The product was stored in a -20 °C refrigerator to obtain dsRNA for the biological control of Bemisia tabaci, denoted as dsBtRPSA.

[0052] Example 2 Inhibition of BtRPSA gene expression in Bemisia tabaci by dsBtRPSA

[0053] The following experiment was conducted in Lingshui (LS):

[0054] 100 newly emerged adults of Bemisia tabaci were placed separately in cylindrical bioassay tubes. The tube caps were sealed with filter paper. The dsBtRPSA prepared in Example 1 was diluted to 750 ng / μL with 20% sucrose solution and added to the filter paper from above the tube cap. The bioassay tubes were gently rotated to make the filter paper fully adhere to the dsBtRPSA solution, and then placed in an insect rearing room for feeding. The newly emerged adults of Bemisia tabaci fed with dsEGFP were used as the control group, specifically, fed with an equal-concentration dsEGFP sucrose solution. Three replicates were set for each group.

[0055] Here, dsEGFP refers to the dsRNA of the enhanced green fluorescent protein gene (EGFP). In its preparation method, the primers used for synthesizing dsRNA are shown as SEQ ID NO.5 and SEQ ID NO.6. The template used for PCR amplification is the plasmid containing the EGFP gene stored in the laboratory. The size of the product obtained by PCR amplification is 520 bp, and the specific sequence is shown as SEQ ID NO.7. The other reagents and methods used are the same as those for preparing dsBtRPSA in Example 1. Among them, the dsRNA of the gene EGFP is double-stranded RNA, composed of a sense strand and an antisense strand. The nucleotide sequence corresponding to the sense strand is shown as SEQ ID NO.7, and the nucleotide sequence corresponding to the antisense strand is the reverse complementary sequence of SEQ ID NO.7.

[0056] dsEGFP-F: 5’-taatacgactcactataggg CCTGAAGTTCATCTGCACCA-3’ (SEQ ID NO.5);

[0057] dsEGFP-R: 5’-taatacgactcactataggg GTGCTCAGGTAGTGGTTGTCG-3’ (SEQ ID NO.6);

[0058] SEQ ID NO.7 (5’→3’):

[0059] CCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCAC

[0060] On the 2nd day after Bemisia tabaci started feeding on dsRNA, newly emerged adults of Bemisia tabaci treated with 750 ng / μL dsBtRPSA and dsEGFP were collected respectively, and 3 biological replicates were collected for each treatment. RNA of each group of Bemisia tabaci was extracted and purified respectively, and then reverse transcribed into cDNA, which was diluted 20 times as the template for fluorescence quantitative PCR. The following primers were used for RT-qPCR analysis.

[0061] The quantitative primers for the BtRPSA gene are as follows:

[0062] F: 5’-CCGAGAAAGCAAATGGGACG-3’ (SEQ ID NO.8);

[0063] R: 5’-CAGTTCTTCTTTCTCTGCCTCT-3’ (SEQ ID NO.9);

[0064] The primers for the internal reference gene Actin are as follows:

[0065] F: 5’-TCTTCCAGCCATCCTTCTTG-3’ (SEQ ID NO.10);

[0066] R: 5’-CGGTGATTTCCTTCTGCATT-3’ (SEQ ID NO.11);

[0067] The RT-qPCR system (10 μL) was as follows: 1.6 μL of ddH2O, 5 μL of 2×SYBR Green (AG), 0.20 μL of the forward primer and the reverse primer (10 μM), and 3.0 μL of the first-strand cDNA template.

[0068] The reaction instrument for RT-qPCR was the Bio-Rad CFX Connect Real-Time system (BIO-RAD, USA).

[0069] The reaction conditions were 95°C for 2 min; 95°C for 15 s, 60°C for 30 s, for 39 cycles, with 3 technical replicates for each sample.

[0070] The results were as Figure 1 shown. Using the feeding of dsEGFP as a control, the relative expression level changes of the BtRPSA gene in Bemisia tabaci were statistically analyzed on the 2nd day after feeding dsBtRPSA. The results showed that the expression level of the BtRPSA gene in Bemisia tabaci fed with dsBtRPSA showed an obvious downward trend compared with that in Bemisia tabaci fed with dsEGFP. On the 2nd day after feeding dsRPSA, the expression level of the BtRPSA gene in the LS strain of Bemisia tabaci decreased by about 36.6% compared with the control group, further indicating that feeding dsBtRPSA could cause a strong RNAi effect in Bemisia tabaci, resulting in a significant decrease in the expression level of the BtRPSA gene in vivo, and further leading to the inhibition of the heat tolerance of Bemisia tabaci.

[0071] Example 3 Application of dsBtRPSA in reducing the heat tolerance of Bemisia tabaci

[0072] An experiment on the effect of feeding dsBtRPSA on the heat tolerance of Bemisia tabaci was conducted in the LS area.

[0073] 100 newly emerged adults of Bemisia tabaci were respectively placed in cylindrical bioassay tubes. The tube lids were sealed with filter paper. The prepared dsBtRPSA was diluted to 750 ng / μL with 20% sucrose solution and added to the filter paper from above the tube lid. The bioassay tubes were gently rotated to make the filter paper fully adhere to the dsBtRPSA solution, and then placed in the insect rearing room for feeding for 48 h. The newly emerged adults of Bemisia tabaci fed with dsEGFP were used as the control group, specifically fed with an equal-concentration dsEGFP sucrose solution. Each group was set with 3 replicates.

[0074] The heat tolerance of Bemisia tabaci after feeding with dsRNA was detected by heat shock method. The specific method was as follows: A group of 60 Bemisia tabaci were placed into a bioassay tube with one end covered with 1% agar and covered with tobacco leaves, and the other end was breathable. It was placed in a constant temperature incubator and treated for 2 h in a constant temperature room at 42 °C and relative humidity of 60%. After heat shock, the mortality rate was counted.

[0075] The results were as Figure 2 shown. After continuously feeding the newly emerged adults of Bemisia tabaci with dsBtRPSA for 48 h, the mortality rate of the newly emerged adults of Bemisia tabaci showed an upward trend. According to Figure 2 the results, it was found that there were significant differences between the Lingshui dsBtRPSA treatment group and the control group. It indicated that feeding on dsBtRPSA could trigger a strong RNAi effect in the body of Bemisia tabaci and affect the heat tolerance of Bemisia tabaci.

[0076] Example 4 Application of dsBtRPSA in reducing the heat tolerance of Bemisia tabaci

[0077] An experiment on the effect of feeding dsBtRPSA on the heat tolerance of Bemisia tabaci was carried out in Lingshui (LS) area.

[0078] The newly emerged adults of 100 Bemisia tabaci were respectively placed into cylindrical bioassay tubes. The tube caps were sealed with filter paper. The prepared dsBtRPSA was diluted to 750 ng / μL with 20% sucrose solution and added to the filter paper from above the tube cap. The bioassay tubes were gently rotated to make the filter paper fully adhere to the dsBtRPSA solution, and then placed in an insect rearing room for feeding for 48 h. The newly emerged adults of Bemisia tabaci fed with dsEGFP were used as the control group, specifically, they were fed with an equal-concentration dsEGFP sucrose solution. Three replicates were set for each group.

[0079] The heat tolerance of Bemisia tabaci after feeding with dsRNA was detected by heat shock method. The specific method was as follows: A group of 60 Bemisia tabaci were placed into a bioassay tube with one end covered with 1% agar and covered with tobacco leaves, and the other end was breathable. It was placed in a constant temperature incubator and treated for 1 h in a constant temperature room at 43 °C and relative humidity of 60%. After heat shock, the mortality rate was counted.

[0080] The results were as Figure 3 shown. After continuously feeding the newly emerged adults of Bemisia tabaci with dsBtRPSA for 48 h, the mortality rate of the newly emerged adults of Bemisia tabaci showed an upward trend. According to Figure 3 the results, it was found that there were significant differences between the Lingshui dsBtRPSA treatment group and the control group. It indicated that feeding on dsBtRPSA could trigger a strong RNAi effect in the body of Bemisia tabaci and affect the heat tolerance of Bemisia tabaci.

[0081] The above are only the preferred embodiments of the present invention, and are not intended to limit the present invention in any other form. Any person skilled in the relevant art may use the technical content disclosed above to make changes or modifications into equivalent embodiments with equivalent changes. However, any simple modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention without departing from the technical solution content of the present invention still fall within the protection scope of the technical solution of the present invention.

Claims

1. Use of Bemisia tabaci BtRPSA gene in the prevention and control of Bemisia tabaci or the preparation of reagents for preventing and controlling Bemisia tabaci, characterized in that, The nucleic acid sequence of the Bemisia tabaci BtRPSA gene is shown in SEQ ID NO.

1.

2. The application according to claim 1, wherein By means of gene silencing, the expression of the BtRPSA gene in Bemisia tabaci is inhibited, and the heat tolerance of Bemisia tabaci is reduced.

3. The application according to claim 2, wherein The said means of gene silencing is RNA interference.

4. A dsRNA for the biological control of Bemisia tabaci, characterized in that, Primers are designed for the Bemisia tabaci BtRPSA gene, and dsRNA targeting the Bemisia tabaci BtRPSA gene is synthesized; the nucleic acid sequence of the Bemisia tabaci BtRPSA gene is shown in SEQ ID NO.

1.

5. The dsRNA for biological control of Bemisia tabaci according to claim 4, characterized in that, The said primers are shown in SEQ IDNO.2 and SEQ ID NO.

3.

6. The dsRNA for biological control of Bemisia tabaci according to claim 5, characterized in that, The nucleic acid sequence corresponding to the sense strand of the said dsRNA is shown in SEQ ID NO.4; the nucleotide sequence corresponding to the antisense strand is the reverse complementary sequence of SEQ ID NO.

4.

7. A reagent for controlling Bemisia tabaci, characterized in that, Containing the dsRNA described in any one of claims 4-6.

8. A method for controlling Bemisia tabaci, characterized in that, By means of gene silencing, the expression of the BtRPSA gene in Bemisia tabaci is inhibited, and the heat tolerance of Bemisia tabaci is reduced. The nucleic acid sequence of the Bemisia tabaci BtRPSA gene is shown in SEQ ID NO.

1.

9. The method for controlling Bemisia tabaci according to claim 8, characterized in that, The said means of gene silencing is RNA interference.

10. The method for controlling Bemisia tabaci according to claim 9, wherein, The said RNA interference is by means of feeding, so that Bemisia tabaci ingests the dsRNA of the BtRPSA gene.

Images