Rice phospholipase D coding gene OsNRF14 and application thereof in high yield of crops

Through gene editing technology, the OsNRF14 gene was knocked out or overexpressed in rice, and the rice protein content was regulated, which solved the unknown application of rice phospholipase D family members in high yield and high quality rice, achieved significant regulation of rice yield and protein content, and provided a cultivation plan for new high-yield and high-quality rice varieties.

CN120290607APending Publication Date: 2025-07-11CHINA NAT RICE RES INST
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202411961660.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-12-30
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

The role of rice phospholipase D family members in rice yield and quality regulation has not been clarified in the prior art, especially the application of OsNRF14-encoded genes in high yield and high quality rice is unknown.

Method used

Through gene editing technology, knockout and overexpression vectors of OsNRF14 gene were constructed, knockout or overexpression of the OsNRF14 gene in rice, respectively, regulate rice yield and rice protein content, and gene editing and overexpression were used using pC1300-Cas9-SK5G and pUbi-GFP vectors.

Benefits of technology

The yield and protein content of rice in gene knockout strains were significantly improved, while the yield of rice in overexpressed strains was significantly reduced, but the protein content did not change significantly, providing guidance on cultivating new varieties of high-yield and high-quality rice.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290607A_ABST
    Figure CN120290607A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of plant genetic engineering, and particularly relates to a rice phospholipase D coding gene OsNRF14 and application thereof in high yield of crops. The invention discloses a rice phospholipase D coding gene OsNRF14, and the genome nucleotide sequence of the OsNRF14 is as shown in Seq ID No.1. The invention also discloses a preparation method of the rice phospholipase D coding gene OsNRF14. The invention also provides application of the gene OsNRF14. The gene OsNRF14 in rice is knocked out by using a gene editing technology CRISPR-Cas9, so that the rice yield and the rice protein content can be increased; on the contrary, the OsNRF14 gene is over-expressed in the rice, so that the rice yield is reduced, and the protein content of the rice is not influenced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of plant genetic engineering, and particularly relates to the rice phospholipase D encoding gene OsNRF14 and its application in crop high-yield production. Background Art

[0002] Rice is one of the important food crops in the world, and the expectations for rice varieties are high yield and good quality.

[0003] In recent years, scientific researchers have conducted extensive research on the molecular genetic basis of rice high-yield and good-quality related traits and achieved a series of results. For example, the ideal plant type gene IPA1, erect panicle gene DEP1, high-yield early-maturing gene OsDREB1C, high-quality high-yield gene OsMADS1, and the major gene Waxy for amylose synthesis in rice have been discovered and cloned. The genetic improvement and molecular pyramiding design of target genes have also become one of the most feasible solutions for high-yield and good-quality rice.

[0004] Phospholipase D (PLD) can catalyze the hydrolysis of phospholipids to produce phosphatidic acid and a free head group, and is widely present in various higher plants. 17 PLD family members have been found in the rice genome by using bioinformatics means. Phospholipase D (PLD) has multiple biological functions in rice, including regulating phospholipid metabolism, seed germination, heading date, resistance defense against rice blast and bacterial blight, and abiotic stresses such as salt stress, drought stress, and low temperature stress. There is currently no research on the participation of PLD family members in the regulation of rice yield and quality. OsNRF14 (also known as OsPLDα4) encodes a chloroplast-localized phospholipase D, affects the biosynthesis of jasmonic acid, salicylic acid, ethylene, and green leaf volatiles, and regulates the direct and indirect defense mechanisms in rice induced by herbivores, but whether it is related to rice yield and quality is currently unknown. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide the application of the rice phospholipase D encoding gene OsNRF14 in crop high-yield production.

[0006] To solve the above technical problem, the present invention provides the rice phospholipase D encoding gene OsNRF14, and its genomic nucleotide sequence is as shown in Seq ID No.1.

[0007] As an improvement of the OsNRF14 gene of the present invention: the cDNA and CDS nucleotide sequences of OsNRF14 are as shown in SeqIDNo.2 and Seq ID No.3 respectively.

[0008] The present invention also simultaneously provides the protein encoded by the above OsNRF14 gene, and its amino acid sequence is as shown in Seq IDNo.4.

[0009] The present invention also simultaneously provides a knockout vector containing the above-mentioned OsNRF14 gene: based on the vector pC1300-Cas9-SK5G, obtained by inserting the editing target site sequence CTGTACGCGACGGTGGATCT or GTCGGGGACCTCCTGTCCGG located on the second exon of the gene OsNRF14 between two AarI restriction endonuclease cleavage sites of the basic vector.

[0010] The present invention also simultaneously provides an overexpression vector containing the above-mentioned OsNRF14 gene, which is obtained by inserting the CDS sequence (excluding the stop codon) described in Seq ID No.3 between the SacI restriction endonuclease cleavage sites of the basic vector pUbi-GFP.

[0011] The present invention also simultaneously provides the use of the OsNRF14 gene: regulating rice grain yield and rice protein content.

[0012] As an improvement to the use of the OsNRF14 gene of the present invention: transforming the knockout vector and the overexpression vector into monocotyledonous plant (such as rice) cells, and then cultivating the transformed monocotyledonous plant cells into plants.

[0013] The present invention also simultaneously provides a method for regulating rice yield and rice protein content:

[0014] Transforming the knockout vector pC1300-Cas9-SK5G-OsNRF14 into rice cells to obtain knockout mutants, and the rice yield and rice protein content are significantly increased;

[0015] Transforming the overexpression vector pUbi-OsNRF14-GFP into rice cells, the yield of transgenic rice is significantly reduced, and the protein content has no obvious change.

[0016] The technical solution provided by the present invention is specifically as follows:

[0017] The rice phospholipase D encoding gene OsNRF14 of the present invention has the sequences shown in (a) and (b):

[0018] (a) The genomic nucleotide sequence shown in Seq ID No.1;

[0019] (b) The cDNA and CDS nucleotide sequences shown in Seq ID No.2 and Seq ID No.3;

[0020] The genomic nucleotide sequence of OsNRF14 of Nipponbare shown in Seq ID No.1 has a total of 4,880 nucleotides, the cDNA sequence of OsNRF14 of Nipponbare shown in Seq ID No.2 has a total of 2,821 nucleotides, and the CDS sequence of OsNRF14 of Nipponbare shown in Seq ID No.3 has a total of 2,499 nucleotides (including the terminator TAG).

[0021] Another object of the present invention is to provide a protein encoded by the above OsNRF14 gene, having the sequence shown in (A):

[0022] (A) The amino acid sequence shown in Seq ID No.4;

[0023] The protein shown in Seq ID No.4 is phospholipase D and has 832 amino acids.

[0024] The object of the present invention also includes providing a knockout vector containing the above-mentioned rice phospholipase D-encoding gene OsNRF14. The knockout vector is Figure 1 pC1300-Cas9-SK5G shown in A. After gene editing: 48 bases are deleted from OsNRF14 in the OsNRF14-KO1 plant, and finally 16 amino acids are deleted from the OsNRF14 protein, as shown in Seq ID No.5; 1 base is inserted into OsNRF14 in the OsNRF14-KO2 plant, and finally the translation of the OsNRF14 protein is terminated prematurely, as shown in Seq ID No.6.

[0025] The object of the present invention also includes providing an overexpression vector containing the above-mentioned rice phospholipase D-encoding gene OsNRF14. The overexpression vector is Figure 1 pUbi-GFP shown in B, and this vector can increase the gene expression of OsNRF14.

[0026] The object of the present invention also includes providing a host cell containing the above-mentioned rice OsNRF14 gene, and the host cell is an Escherichia coli cell, an Agrobacterium cell or a plant cell.

[0027] The object of the present invention also includes regulating rice yield and seed protein content by using the above OsNRF14 gene, including transforming rice cells with knockout and overexpression vectors constructed with genes having the nucleotide sequences shown in the above OsNRF14, and then cultivating the transformed rice cells into plants.

[0028] The specific technology for realizing the present invention is as follows:

[0029] Through transgenic technology, the present invention obtained gene knockout and overexpression plants of the OsNRF14 gene( Figure 1)。Compared with the wild-type Nipponbare (WT), the grain yield per plant and the brown rice protein content of the two knockout lines, OsNRF14-KO1 and OsNRF14-KO2, were significantly increased ( Figure 2 ), while the grain yield per plant of the two overexpression lines, OsNRF14-OE1 and OsNRF14-OE2, was significantly decreased, but the brown rice protein content showed no obvious change.

[0030] The present invention provides the application of gene editing to knockout or negatively regulate the OsNRF14 gene in one or more of improving crop yield and brown rice protein content. The rice yield and rice protein content in the gene editing knockout lines were both significantly increased. The present invention provides important guidance for cultivating new rice varieties with high yield and good quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] The following further describes the specific embodiments of the present invention in conjunction with the drawings.

[0032] Figure 1 For vector schematic diagrams and transgenic molecule identification:

[0033] Figure 1 In: (A) pC1300-Cas9-SK5G knockout vector; (B) pUbi-GFP overexpression vector; (C) Mutation situation of the edited target site sequence in the knockout plants OsNRF14-KO1 and OsNRF14-KO2, and the sequence shown by the green line represents the target site sequence; (D) Relative gene expression levels of the OsNRF14 gene in the wild type and overexpression lines (OsNRF14-OE1 and OsNRF14-OE2), and the data are presented as mean ± standard deviation (SD).

[0034] Figure 2 For comparison of the grain yield per plant (A) and brown rice protein content (B) of wild-type Nipponbare, OsNRF14 gene knockout mutants (OsNRF14-KO1 and OsNRF14-KO2), and overexpression plants (OsNRF14-OE1 and OsNRF14-OE2). The data are presented as mean ± standard error of the mean (SEM). * indicates a significant difference by t-test at the P < 0.05 level, and ** indicates a significant difference by t-test at the P < 0.01 level. SPECIFIC EMBODIMENTS

[0035] The following further describes the present invention in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0036] Example 1: Obtaining of OsNRF14 gene knockout mutants

[0037] 1. The pC1300-Cas9-SK5G gene editing vector provided by the Wang Kejian research group of the China National Rice Research Institute was used to knockout OsNRF14. The CTGTACGCGACGGTGGATCT and GTCGGGGACCTCCTGTCCGG sequences on the second exon of the OsNRF14 gene were selected as the editing target sites respectively ( Figure 1 A). The primer sequences related to vector construction are as follows:

[0038] Forward primer for target site 1, OsNRF14-sgRNA1-F: GGCACTGTACGCGACGGTGGATCT

[0039] Reverse primer for target site 1, OsNRF14-sgRNA1-R: AAACAGATCCACCGTCGCGTACAG

[0040] Forward primer for target site 2, OsNRF14-sgRNA2-F: GGCACCGGACAGGAGGTCCCCGAC

[0041] Reverse primer for target site 2, OsNRF14-sgRNA2-R: AAACGTCGGGGACCTCCTGTCCGG

[0042] Target site identification primer pC1300-F: ACACTTTATGCTTCCGGCTC.

[0043] Note: The pC1300-Cas9-SK5G gene editing vector was modified from pC1300-Cas9 (Barman 2021; Xiong, et al. 2021). The fragment of the original intermediate vector SK-gRNA containing the gRNA expression cassette after double digestion with KpnI and BglII was ligated in advance to the pC1300-Cas9 vector double-digested with KpnI and BamHI. This is the prior art.

[0044] 2. Steps for constructing the OsNRF14 gene knockout vector:

[0045] Preparation of target adapter 1: Take 20 μl each of the 100 μM concentration OsNRF14-sgRNA1-F and OsNRF14-sgRNA1-R primers, mix them, incubate in a water bath at 100 °C for 5 minutes, and cool to room temperature to form primer dimers.

[0046] Preparation of target adapter 2: Take 20 μl each of the 100 μM concentration OsNRF14-sgRNA2-F and OsNRF14-sgRNA2-R primers, mix them, incubate in a water bath at 100 °C for 5 minutes, and cool to room temperature to form primer dimers.

[0047] Linearization of the expression vector: The pC1300-Cas9-SK5G gene editing vector was digested with the restriction endonuclease AarI (Ferment). The digestion reaction system was as follows: 1.5 μg of pC1300-Cas9-SK5G plasmid; 5 μl of 10× AarI buffer; 1 μL of 50× oligonucleotide; 1 μL of AarI; ddH2O was added to make up to 50 μL. The digestion was carried out at 37 °C for 6 hours, and the digested product was purified using a kit.

[0048] Ligation of the target adapter 1 or target adapter 2 to the expression vector: The prepared target adapter 1 or target adapter 2 was ligated to the linearized pC1300-Cas9-SK5G gene editing vector using T4 ligase (NEB). The ligation reaction system was: 20 ng of linearized pC1300-Cas9-SK5G; 7 μL of target adapter 1 / target adapter 2; 1 μL of 10× T4 ligase buffer; 0.5 μL of T4 ligase; ddH2O was added to make up to 10 μL. The ligation was carried out at 16 °C for 1 hour.

[0049] The above ligation reaction product was transformed into competent Escherichia coli DH5α cells, and single colonies were picked for sequencing.

[0050] Single colonies containing the specific target sequence of the OsNRF14 gene (i.e., CTGTACGCGACGGTGGATCT and GTCGGGGACCTCCTGTCCGG) were screened by sequencing using the primer pC1300-F, and the plasmid was extracted to obtain the recombinant knockout vector pC1300-Cas9-SK5G-OsNRF14.

[0051] 3. The pC1300-Cas9-SK5G-OsNRF14 vector containing the specific target site of OsNRF14 was transformed into the rice variety Nipponbare using the Agrobacterium-mediated rice callus infection method. Using the transgenic plant DNA as a template, the sequences at both ends of the OsNRF14 target site were amplified by PCR using the knockout identification primers and then sequenced for identification.

[0052] The sequences of the knockout identification primers are as follows:

[0053] OsNRF14-CRISPR-F: GAGTGGCAATGGCGGAGC

[0054] OsNRF14-CRISPR-R: GCCCCTGCTGGTAGTGCG

[0055] The leaf DNA of wild-type Nipponbare and gene-edited rice lines was extracted using the CTAB method.

[0056] PCR reaction system for identifying mutant transgenic plants: 25 μL of 2×Rapid Taq Master Mix (Novoprotein Co., Ltd., Nanjing); 2 μL of DNA from transgenic plant leaves; 1 μL each of primers OsNRF14-CRISPR-F and OsNRF14-CRISPR-R at a concentration of 10 μM; 21 μL of ddH2O.

[0057] PCR reaction program: (1) 95 °C, 3 minutes; (2) 98 °C, 15 seconds; (3) 58 °C, 15 seconds; (4) 72 °C, 15 seconds; (5) 72 °C, 5 minutes; Steps (2)-(4) are repeated 38 cycles.

[0058] By comparing with the wild-type Seq ID No.1 of Nipponbare, OsNRF14 gene knockout mutants were obtained. The obtained gene knockout mutants OsNRF14-KO1 and OsNRF14-KO2 carried deletion or insertion mutations ( Figure 1 C), and the amino acid sequences of OsNRF14 in the gene knockout mutants OsNRF14-KO1 and OsNRF14-KO2 are shown in Seq ID No.5 and Seq ID No.6 respectively.

[0059] Example 2: Obtaining OsNRF14 gene overexpression lines

[0060] 1. Total RNA extraction and RNA reverse transcription

[0061] Take 50-100 mg of Nipponbare rice seedling leaf samples, put them into liquid nitrogen for freezing and grind them into powder. Use the Novoprotein FastPure Universal Plant Total RNA Isolation Kit extraction kit to extract total RNA according to the operation instructions.

[0062] Use the MonScript TM RTIII Super Mix with dsDNase (Two-Step) kit to perform RNA reverse transcription according to the operation instructions to obtain the first-strand cDNA.

[0063] 2. Obtaining the target gene

[0064] Using the reverse-transcribed cDNA as a template, use the high-success-rate PCR enzyme KOD FX (TOYOBO Co., Ltd.) to PCR amplify the CDS sequence of the OsNRF14 gene of Nipponbare (Seq ID No.3, removing the stop codon), and add the recombinant linker of the target expression vector. The primer sequences involved are as follows:

[0065] OsNRF14-F: gtgttacttctgcaggagctcATGGCGGAGCAGCAGCTG

[0066] OsNRF14-R: catggatccggtaccgagctcCGAGGTGATATCGGGGGT

[0067] PCR reaction system: 25 μL of 2x PCR buffer for KOD FX; 10 μL of 2 mM dNTPs; 1 μL of cDNA template; 1.5 μL each of primers OsNRF14-F and OsNRF14-R at a concentration of 10 μM; 1 μL of KOD FX; 10 μL of ddH2O. PCR reaction procedure: (1) 94°C, 2 minutes; (2) 98°C, 10 seconds; (3) 58°C, 30 seconds; (4) 68°C, 3 minutes; (5) 68°C, 5 minutes; Steps (2)-(4) are repeated 35 cycles.

[0068] Purify the PCR product using the Easy Gel Extraction&Clean-up Kit (Eastep).

[0069] 3. Construction of overexpression recombinant vector

[0070] Linearization of the expression vector: Digest the pUbi-GFP expression vector (Wen, et al. 2023) with the restriction endonuclease SacI (NEB). Restriction digestion reaction system: 1.5 μg of Ubi-GFP plasmid; 5 μl of 10×rCutSmart TM Buffer; 1 μL of SacI; Make up to 50 μL with ddH2O. Digest at 37°C for 6 hours, and purify the digested product using the kit.

[0071] Recombinant ligation of the OsNRF14 gene CDS sequence and the expression vector: Use the Novoprotein ClonExpress II One Step Cloning Kit to recombinantly ligate the OsNRF14 CDS (without the stop codon) with the recombinant adapter to the linearized pUbi-GFP expression vector.

[0072] Recombinant ligation reaction system: 30 ng of linearized pUbi-GFP vector; 100 ng of OsNRF14 CDS (SeqID No. 3, without the stop codon) with the recombinant adapter; 2 μL of 5×CE II Buffer; 1 μL of Exnase II; Make up to 10 μL with ddH2O. React at 37°C for 30 minutes and immediately place on ice to cool.

[0073] Transfer the above recombinant ligation reaction product into competent Escherichia coli DH5α cells, pick single colonies for sequencing, and extract the plasmid with correct sequencing to obtain the recombinant overexpression vector pUbi-OsNRF14-GFP.

[0074] 4. Transform the recombinant overexpression vector pUbi-OsNRF14-GFP into the rice variety Nipponbare using the Agrobacterium-mediated rice callus infection method. Using the transgenic plant leaf cDNA as a template, use the Novoprotein Taq Pro Universal SYBR qPCR Master Mix kit, and screen for OsNRF14 overexpression positive plants using qRT-PCR.

[0075] The primer sequences for qRT-PCR identification are as follows:

[0076] qOsNRF14-F: GCCAAGGCACAAAAGACGC

[0077] qOsNRF14-R: TTGATGTTGGCCGATCCCA

[0078] The primer sequences for the qRT-PCR internal reference are as follows:

[0079] qActin-F: ATCAATCCTTGCATCTCTGAGC

[0080] qActin-R: TAGAAGCACTTCCTGTGGACGA

[0081] The qRT-PCR reaction system: 7.5 μL of 2×Taq Pro Universal SYBR qPCR Master Mix; 3 μL of 10-fold diluted cDNA template; 0.3 μL each of the forward and reverse primers at a concentration of 10 μM; 3.9 μL of ddH2O.

[0082] The qRT-PCR reaction program: (1) 95°C, 2 minutes; (2) 95°C, 10 seconds; (3) 60°C, 15 seconds; Steps (2)-(3) are repeated 42 cycles.

[0083] According to the 2 -ΔCT method, calculate and compare the relative expression levels of OsNRF14 in wild-type and overexpressing plants. As Figure 1 shown in D, the relative expression levels of OsNRF14 in the OsNRF14-OE1 and OsNRF14-OE2 overexpressing lines are 126.9 times and 235.7 times that of the wild-type Nipponbare, respectively.

[0084] Example 3: Investigation of the single-plant yield of OsNRF14 gene knockout mutants and overexpressing lines in the field

[0085] Determine the yield per plant of the OsNRF14 gene knockout mutants and overexpression lines in the transgenic plot in Fuyang, Hangzhou. The results showed that the yield per plant of the knockout mutants OsNRF14-KO1 and OsNRF14-KO2 increased significantly ( Figure 2 A), increasing by 22.1% and 22.8% respectively compared to the wild-type Nipponbare. In contrast, the yield per plant of the overexpression lines OsNRF14-OE1 and OsNRF14-OE2 decreased significantly ( Figure 2 A), decreasing by 18.7% and 21.5% respectively compared to the wild-type Nipponbare. The above results suggest that OsNRF14 negatively regulates yield.

[0086] Example 4: Detection of rice grain protein content in OsNRF14 gene knockout mutants and overexpression lines

[0087] The above results showed that the yield per plant of the OsNRF14 gene knockout mutants increased significantly. The Kjeldahl method was used to further detect whether the rice grain protein content was optimized.

[0088] Referring to the national standard of the People's Republic of China GB 5009.5—2016, 10 g of mature paddy rice was weighed, and the husk was removed using a rice huller to obtain brown rice, which was then ground into powder. 0.5 g of the well-mixed solid sample was weighed into a digestion tube, and then 0.4 g of copper sulfate, 3.6 g of potassium sulfate, and 10 mL of sulfuric acid were added, and digestion was carried out in a graphite digestion furnace. After the digestion temperature reached 420 °C, digestion continued for 1 hour. At this time, the liquid in the digestion tube was green and transparent. It was taken out and waited to cool before being put on the machine. 80 ml of distilled water was automatically added for dilution and 50 ml of 40% sodium hydroxide was added to the sample digestion tube on the FOSS automatic Kjeldahl apparatus, and 30 ml of boric acid receiving solution (1% boric acid plus bromocresol green / methyl red indicator) was added to the titration bar, and distillation, titration, and titration data were recorded.

[0089] According to the formula: protein % = 5.95 * (T – B) * N * 14 * 100 / sample weight (mg), calculate the percentage content of protein. T = sample standard acid consumption volume (mL), B = blank, N = standard acid concentration (0.09914 M).

[0090] As Figure 2 shown in B, the brown rice protein content of the wild-type Nipponbare was about 85 mg / g. The brown rice protein contents of OsNRF14-KO1 and OsNRF14-KO2 were about 92.5 and 91.2 mg / g respectively, increasing by 8.9% and 7.4% respectively compared to the wild-type. However, there was no obvious change in the brown rice protein content in the overexpression lines OsNRF14-OE1 and OsNRF14-OE2.

[0091] Finally, it should be noted that the above examples are only some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by a person skilled in the art should be considered as the protection scope of the present invention.

Claims

1. The rice phospholipase D encoding gene OsNRF14, characterized in that: The nucleotide sequence of the OsNRF14 gene is shown in Seq ID No.

1.

2. The rice phospholipase D encoding gene OsNRF14 according to claim 1, characterized in that: The cDNA nucleotide sequence of OsNRF14 is shown in Seq ID No.2, and the CDS nucleotide sequence of OsNRF14 is shown in Seq ID No.

3.

3. The protein encoded by OsNRF14 as claimed in claim 1 or 2, characterized in that: The amino acid sequence of the protein is shown in Seq ID No.

4.

4. The knockout vector of the OsNRF14 gene according to claim 1 or 2, characterized in that: It is obtained by inserting the editing target site sequence CTGTACGCGACGGTGGATCT or GTCGGGGACCTCCTGTCCGG located in the exon of the gene OsNRF14 between the two AarI restriction enzyme cleavage sites of the basic vector pC1300-Cas9-SK5G.

5. The overexpression vector of the OsNRF14 gene according to claim 1 or 2, characterized in that: It is obtained by inserting the CDS sequence described in Seq ID No.3 between the SacI cleavage sites of the basic vector pUbi-GFP.

6. Use of the OsNRF14 gene according to claim 1 or 2, characterized in that: Regulate rice grain yield and rice protein content.

7. A method for regulating rice yield and rice protein content, characterized in that: Use the knockout vector and overexpression vector to transform monocotyledonous plant cells, and then cultivate the transformed monocotyledonous plant cells into plants.

8. The method for regulating rice yield and rice protein content according to claim 7, characterized in that: Transforming the rice cells with the knockout vector pC1300-Cas9-SK5G-OsNRF14 to obtain knockout mutants, the rice yield and rice protein content are significantly increased; transforming the rice cells with the overexpression vector pUbi-OsNRF14-GFP, the yield of transgenic rice is significantly decreased, and the rice protein content has no obvious change.

9. The method according to claim 8, wherein: The OsNRF14 amino acid sequences of the OsNRF14-KO1 and OsNRF14-KO2 plants corresponding to the knockout vector pC1300-Cas9-SK5G-OsNRF14 are shown in Seq ID No.5 and Seq ID No.6 respectively.

Citation Information

Patent Citations

  • Rice lipid A biosynthetic gene OsLpxA mutant, construction method and application

    CN116004559A

  • Rice calcium and magnesium accumulation gene CMC1 as well as encoded protein and application thereof

    CN118685420A

  • Phospholipase d-deficient rice plant lineage

    JP2008245638A