Crocodile-source Aeromonas daka argH gene deleted strain, back-complemented strain, and construction method and application thereof

Abstract

The invention provides a crocodile source Aeromonas daka argH gene deletion strain, a crocodile source Aeromonas daka argH gene back-filling strain and a construction method and application of the crocodile source Aeromonas daka argH gene deletion strain and the crocodile source Aeromonas daka argH gene back-filling strain, an argH gene recombinant suicide plasmid pRE112-delta argH is constructed by adopting a seamless cloning method, an Aeromonas daka strain is jointed with E.coli WM3064 containing the pRE112-delta argH to obtain the argH gene deletion strain delta argH, and a corresponding gene back-filling strain C delta argH is further constructed. Through biological characteristic analysis, the argH gene deletion reduces synthesis of arginine of Aeromonas dakara and biofilm formation amount, reduces growth rate, proteolytic activity and resistance to crocodile-derived antibacterial peptide, but enhances hemolytic activity, and significantly improves the survival rate of Caenorhabditis elegans, so that the Aeromonas dakara has a good application prospect in treatment of caenorhabditis elegans, and the Aeromonas dakara has a good application prospect in treatment of caenorhabditis elegans. Important reference is provided for further researching the regulation effect of the argH gene in a bacterial pathogenic mechanism and developing related prevention and control strategies.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and relates to a crocodile-derived Aeromonas dhaka argH gene deletion strain, a complementation strain, and a construction method and application thereof. Background Art

[0002] Aeromonas dakar is a Gram-negative short rod of the genus Aeromonas in the family Aeromonadaceae. It has a wide range of host infection capabilities and can infect humans, animals and aquatic organisms, and exhibits extremely high pathogenicity.

[0003] In many past studies, Aeromonas dhaka was often misidentified as Aeromonas hydrophila, resulting in insufficient attention to its pathogenicity, which has an adverse effect on the timeliness of clinical treatment and the scientific selection of treatment strategies. In recent years, the frequency of isolation of Aeromonas dhaka in human infection cases has gradually increased (Zheng Zhen, Gong Yan, Lu Lequn, et al. Nursing of a patient with rare Aeromonas dhaka infection and large area of ​​skin tissue loss [J]. Contemporary Nurses (First Half), 2022, 29(02): 153-156.). At the same time, with the continuous expansion of crocodile farming and the deterioration of the ecological environment, the number of crocodile disease cases caused by bacterial pathogens has been on the rise, which not only endangers the sustainable and healthy development of aquaculture, but also poses a potential hidden danger to human public health and safety. However, research on the pathogenic mechanism and epidemiological characteristics of Aeromonas dhaka is still relatively scarce, and it is urgent to attract the attention of the academic community to promote in-depth research on the bacteria, so as to explore more effective prevention and control and treatment strategies. Summary of the invention

[0004] The present invention aims to provide a crocodile-derived Aeromonas dhaka argH gene deletion strain, a complementation strain, and a construction method and application thereof. Homologous recombination technology is used to perform gene editing on Aeromonas dhaka C160501 strain, and an argH gene deletion strain (ΔargH) and a gene complementation strain (CΔargH) are successfully constructed. Through biological characteristic analysis, the biological function of the argH gene in Aeromonas dhaka is preliminarily clarified.

[0005] To achieve the above object, the technical solution adopted by the present invention is:

[0006] The invention provides a method for constructing an argH gene deleted strain of Aeromonas dhaka origin from crocodile, comprising: constructing an argH gene recombinant suicide plasmid pRE112-ΔargH by a seamless cloning method, and joining the Aeromonas dhaka strain with E.coli WM3064 containing pRE112-ΔargH to obtain an argH gene deleted strain ΔargH.

[0007] Preferably, the construction of the recombinant suicide plasmid pRE112-ΔargH of the argH gene by seamless cloning method further includes: using the genomic DNA of Aeromonas dhakensis C160501 as a template, and using two pairs of primers argH-up-F / R and argH-down-F / R to amplify the upstream and downstream homologous arms of the argH gene respectively; extracting the pRE112 plasmid DNA, and using the primers reverse pRE112-F / R for PCR amplification to linearize the plasmid; ligating the pRE112 plasmid with the argH upstream and downstream homologous arm fragments to construct the recombinant suicide plasmid pRE112-ΔargH; the primer sequences are as follows:

[0008] argH-up-F: GCATATGACGCATTAATGAAATGC,

[0009] argH-up-R: TTATTTCACCACAATGTAATATTAAAC;

[0010] argH-down-F: TACCTGCAATAGTGTATGGGGC,

[0011] argH-down-R: GAAGCGTTCAATCACCAGCC;

[0012] reverse pRE112-F: TCTAGAAGAAGCTTGGGATCGGGC,

[0013] reverse pRE112-R: GAGCTCTCCCGGGAATTCATGC.

[0014] The present invention also provides an argH gene deletion strain of Aeromonas dhakensis from crocodile, which is obtained by the above construction method.

[0015] The present invention provides a construction method of an argH gene complementation strain of Aeromonas dhakensis from crocodile, including: constructing an argH gene complementation plasmid pBBR1MCS-2-ΔlacZα::argH by seamless cloning method, and conjugating the Aeromonas dhakensis strain with E. coli WM3064 containing pBBR1MCS-2-ΔlacZα::argH to obtain the argH gene complementation strain CΔargH.

[0016] Preferably, the construction of the argH gene complementation plasmid pBBR1MCS-2-ΔlacZα::argH using seamless cloning method further includes: using the genomic DNA of Aeromonas dhakensis C160501 as a template, amplifying the argH gene fragment with primers seamless argH-F / R; extracting the pBBR1MCS-2 plasmid DNA, performing PCR amplification with primers reverse pBBR1MCS-2-F / R to linearize the plasmid; ligating the pBBR1MCS-2 plasmid with the argH gene fragment to construct the complementation plasmid pBBR1MCS-2-ΔlacZα::argH; the primer sequences are as follows:

[0017] seamless argH-F: GAATTCTGGTGATGGCTAA,

[0018] seamless argH-R: GTTGAGAAGCGTTAGAGAC;

[0019] reverse pBBR1MCS-2-F: AGCTGTTTCCTGTGTGAAATTG,

[0020] reverse pBBR1MCS-2-R: GCGTTAATATTTTGTTAAAATTCGCGT.

[0021] The present invention also provides an argH gene complemented strain of Aeromonas dhakensis from crocodile, obtained by the above construction method.

[0022] The present invention also provides the application of the argH gene deletion of Aeromonas dhakensis from crocodile, including: slowing down the growth rate of the strain, changing the arginine content of the strain, significantly reducing the protease activity of the strain, significantly increasing the hemolytic activity of the strain, significantly reducing the swimming ability of the strain, significantly enhancing the swarming ability of the strain, changing the flagellar morphology of the strain, significantly up-regulating the transcriptional level of flagella-related genes, significantly enhancing the tolerance of the strain to hydrogen peroxide, significantly inhibiting the biofilm formation ability of the strain, significantly enhancing the sensitivity to crocodile-derived antimicrobial peptides, significantly reducing the adhesion rate of the strain to EPC cells, and significantly enhancing the toxicity of the strain to EPC cells.

[0023] Preferably, the application further includes: significantly increasing the survival rate of Caenorhabditis elegans under the infection of Aeromonas dhakensis.

[0024] The beneficial effects of the present invention are as follows:

[0025] The present invention successfully constructed an argH gene deletion strain using the suicidal plasmid pRE112. Utilizing the origin of transfer (oriT) on the pRE112 plasmid backbone, the recombinant pRE112 plasmid was transferred from the donor strain WM3064 to the recipient strain C160501. To further verify the function of the argH gene, the present invention also constructed a corresponding gene complementation strain. In addition, the present invention also constructed a control strain containing the empty vector pBBR1MCS-2 to exclude the possible effects of the plasmid itself on the strain phenotype. This series of rigorous experimental designs provided reliable technical guarantees for accurately analyzing the function of the argH gene. Through biological characteristic analysis, the deletion of the argH gene reduced the synthesis of arginine and the amount of biofilm formation in Aeromonas dhakensis, decreased the growth rate, proteolytic activity, and resistance to crocodile-derived antimicrobial peptides, but enhanced the hemolytic activity and significantly increased the survival rate of Caenorhabditis elegans. The present invention provides an important reference for further studying the regulatory role of the argH gene in the bacterial pathogenic mechanism and developing relevant prevention and control strategies. Brief Description of the Drawings

[0026] Figure 1 PCR verification of the deletion mutant strain, M: DL 5,000bp Marker; 1: C160501 wild strain; 2, 3: ΔargH deletion strain.

[0027] Figure 2 PCR verification of the genetic stability of the deletion mutant strain, M: DL 5,000bp Marker; 1: primary ΔargH deletion strain; 2 - 10: passaged ΔargH deletion strains; 11: C160501 wild strain.

[0028] Figure 3 PCR verification of the complementation strain, M: DL 5,000bp Marker; 1, 2: ΔargH deletion strains; 3, 4: complementation plasmid pBBR1MCS-2-ΔlacZα::argH strains; 6: C160501 wild strain; 7: empty plasmid pBBR1MCS-2 strain.

[0029] Figure 4 PCR verification of the strain containing the empty vector, M: DL 5,000bp Marker; 1, 2: ΔargH deletion strains; 3, 4, 7: empty plasmid pBBR1MCS-2 strains; 6: ΔargH + pBBR1MCS-2 strain.

[0030] Figure 5 Summary graph of the growth curves of each strain.

[0031] Figure 6Sakaguchi reaction color development result. Note: In an alkaline sodium hypobromite (or potassium hypobromite) solution, arginine will undergo a chemical reaction with α-naphthol to produce a red product.

[0032] Figure 7 Changes in protease activities of each strain. Note: Significance description: ns, P > 0.05; *, P ≤ 0.05; **, P ≤ 0.01; ***, P ≤ 0.001; ****, P ≤ 0.0001 (the same below).

[0033] Figure 8 Changes in hemolytic activities of each strain.

[0034] Figure 9 Changes in motility of each strain.

[0035] Figure 10 Observation of flagella by transmission electron microscopy. Note: Red arrows indicate flagella, and the scale bar represents 2 μm.

[0036] Figure 11 Relative expression levels of flagella-related genes.

[0037] Figure 12 Sensitivity of each strain to hydrogen peroxide.

[0038] Figure 13 Changes in biofilm formation ability of each strain

[0039] Figure 14 Observation results by CLSM. Note: FITC green fluorescence signal, PI red fluorescence signal (scale bar 20 μm).

[0040] Figure 15 Sensitivity of each strain to crocodile-derived antimicrobial peptides.

[0041] Figure 16 Adhesion ability of each strain to EPC cells.

[0042] Figure 17 Cytotoxicity of each strain to EPC.

[0043] Figure 18 Virulence of each strain to Caenorhabditis elegans. Specific implementation manners

[0044] To illustrate the present invention more clearly, the present invention will be further described in detail below with reference to examples and in comparison with the accompanying drawings.

[0045] Examples

[0046] I. Experimental materials

[0047] 1. Strains and plasmids: The wild strain of Aeromonas dhakensis C160501 (A. dhakensis C160501 is also known as Aeromonas dhakensis C4-1, abbreviated as C4-1 in the figures) used in this application was isolated from farmed Siamese crocodiles in Hainan Province and is recorded in the literature (Pu, W., G. Guo, N. Yang, Q. Li, F. Yin, P. Wang, J. Zheng, and J. Zeng. "Three Species of Aeromonas (A. Dhakensis, A. Hydrophila and A. Jandaei) Isolated from Freshwater Crocodiles (Crocodylus Siamensis) with Pneumonia and Septicemia." Lett Appl Microbiol 68, no. 3 (2019): 212-18.). It was isolated and preserved by this laboratory, and a certificate for the release of biological materials to the public has been submitted in the patent application CN202410970620.1, Mutant Strains, Complemented Strains of Aeromonas dhakensis with Deletion of Surface Polysaccharide Synthesis Genes, Their Construction Methods and Applications. E. coli WM3064 (auxotrophic strain, resistant to DAP); E. coli ATCC25922 (drug susceptibility, extracellular protease quality control strain); pRE112 suicide plasmid (E. coli suicide plasmid, sacB, resistant to Cm); pBBR1MCS-2 (broad-host shuttle plasmid, constitutive, low-copy, resistant to Km).

[0048] The plasmids constructed in this invention are as follows:

[0049] pRE112-ΔargH: Inserted with homologous arms upstream and downstream of argH, resistant to Cm;

[0050] ΔargH: The argH gene was knocked out in C160501;

[0051] C4-1-pBBR1MCS-2: An empty plasmid was inserted into C160501, resistant to Km;

[0052] ΔargH-pBBR1MCS-2: An empty plasmid was inserted into ΔargH, resistant to Km;

[0053] pBBR1MCS-2-ΔlacZα::argH: lacZα was replaced with argH, resistant to Km;

[0054] CΔargH: The argH gene was complemented in ΔargH, resistant to Km.

[0055] 2. Main reagents: 2×Phanta Max Master Mix, 2×F8 Fast PCR Master Mix, 2×A8 Fast PCR Master Mix, FastPure DNA Extraction Kit, FastPure Plasmid Maxi Kit, Bacterial Genomic DNA Extraction Kit, Bacterial Plasmid Extraction Kit, and PCR Product Purification Kit are all from Novoprotein (Nanjing) Biotechnology Co., Ltd.; the Super Competent Cell Preparation Kit is from Sangon Biotech (Shanghai) Co., Ltd.

[0056] 3. Primers: The primers used in this experiment were designed based on the complete genome sequence of Aeromonas dhakensis C160501 and in combination with the literature, using Snapgene (version 6.0.2) and Primer Premier 6.0, and were synthesized by Beijing Tsingke Biotechnology Co., Ltd., Hainan Branch, as shown in Table 1.

[0057] Table 1. Primers used in this application

[0058]

[0059]

[0060] 4. Experimental animals and cells

[0061] Epithelioma Papulosum Cyprinid (EPC) cells were provided by Teacher Li Xuesong from the Infection and Immunology Laboratory of the School of Life and Health Sciences, Hainan University.

[0062] II. Experimental methods

[0063] 1. Extraction of the genome of Aeromonas dhakensis C160501

[0064] Take the wild strain of Aeromonas dhakensis C160501 stored in a -80°C low-temperature refrigerator, inoculate it on an agar culture plate using the quadrant streaking method, place it in a 37°C incubator for overnight culture, then pick a single colony for colony PCR, and continue culturing after correct identification. Inoculate the activated and identified wild strain of Aeromonas dhakensis C160501 into LB liquid medium and culture it overnight at 37°C. Select the bacterial DNA extraction kit from Novoprotein to extract the bacterial DNA and measure its concentration.

[0065] 2. Construction of the argH gene deletion strain

[0066] 1) Amplification of upstream and downstream homologous arms: Using the extracted C160501 genome as a template for PCR amplification. The primers used for amplifying the upstream and downstream homologous arms of the argH gene are argH-up-F / R and argH-down-F / R respectively. After the PCR reaction, 1% agarose gel electrophoresis was used to detect the amplification products of the upstream and downstream homologous arms, and the gel imaging system was used to confirm whether the product size was consistent with the expectation. If they were consistent, the DNA purification kit was used to purify the products and determine their concentrations.

[0067] 2) Reverse amplification of pRE112 plasmid: Use the plasmid extraction kit to extract pRE112 plasmid DNA, and use the primers reverse pRE112-F / R for PCR amplification to linearize the plasmid.

[0068] 3) Recombination reaction (seamless cloning): Refer to the instructions of the Universal One Step Cloning Kit for the multi-fragment recombination reaction (in a PCR instrument, react at 50 °C for 20 min). Use Hieff Universal Enzyme Premix to ligate the pRE112 plasmid with the argH upstream and downstream homologous arm fragments to construct the recombinant suicide plasmid pRE112-ΔargH.

[0069] Mix the recombinant reaction product with E. coli WM3064 competent cells in a centrifuge tube, gently pipette and mix well, and then incubate on ice for 30 min. Subsequently, place the centrifuge tube in a 42 °C water bath for heat shock for 90 s, and immediately transfer it to ice for cooling for 3 min. Then, add 900 μL of fresh LB liquid medium, and place it in a 37 °C constant temperature shaker for culturing for 1 h. After incubation, aspirate 100 μL of the cultured bacterial solution, and spread it on LB agar medium containing Cm (50 μg / mL) and DAP (25 μg / mL) according to three different high and low concentration gradients, and invert it and incubate overnight at 37 °C.

[0070] The next day, use a sterile inoculation loop to pick positive clone colonies for colony PCR verification. Use the outer primers pRE112 verification-F / R of the inserted fragment on the plasmid to perform PCR identification (1% agarose gel electrophoresis) on the recombinant transformants. Analyze the colony PCR products by 1% agarose gel electrophoresis, and use the gel imaging system to confirm whether the product size meets the expectation. If they are consistent, send the PCR products to Hainan Sangon for sequencing, and then extract a large amount of the successfully recombinant plasmid pRE112-ΔargH. At the same time, add the bacterial solution of the strain with correct sequencing results to a cryopreservation tube and store it at -80 °C.

[0071] 4) Conjugative transfer: After activating the donor strain WM3064(pRE112-ΔargH) and the wild strain C160501, 50 μL of each was taken and inoculated into LB liquid medium, and cultured with shaking at 37 °C and 180 rpm until OD 600 ≈0.5 or so. 3×2 mL of WM3064(pRE112-ΔargH) and 1×2 mL of C160501 bacterial liquid were respectively pipetted into 2 mL centrifuge tubes, and the cell pellets were collected by centrifugation at 5000 rpm for 5 min. The cell pellets of WM3064(pRE112-ΔargH) and C160501 were resuspended with 1 mL of fresh LB liquid medium, and this step was repeated twice to ensure thorough mixing. The resuspended liquid was added dropwise to an LB agar plate containing DAP (25 μg / mL), and after the liquid was absorbed, it was cultured overnight in an incubator at 37 °C. The next day, an appropriate amount of fresh LB liquid medium was added dropwise to the plate, and the cells were scraped and collected with an inoculation loop. After the bacterial liquid was shaken and mixed to wash away DAP, 100 μL of the bacterial liquid was pipetted and spread on an LB agar medium containing Cm (50 μg / mL) at three different high and low concentrations, and then inverted and cultured overnight at 37 °C.

[0072] 5) Screening of deletion strains: Use an inoculation loop to pick single colonies on the LB plate (containing Cm), spot them on an LB plate containing chloramphenicol, and streak them on a 20% sucrose plate (cultured overnight at 30 °C). The LB plate was cultured overnight at 37 °C and stored in a refrigerator at 4 °C for later use: If the corresponding gene deletion strain was not screened out from the sucrose plate, it could be streaked again on the sucrose plate. Pick single colonies and perform PCR identification (1% agarose gel electrophoresis) on the strains using the ΔargH verification-F / R pair. After screening out the gene deletion strain, the remaining bacterial liquid was spread on an LB agar medium (purification to avoid contamination of trace amounts of wild-type strains in the single colonies), and single colonies were selected again for PCR identification, and this step was repeated twice. The purified strains were streaked on an LB plate and cultured overnight at 37 °C. Pick single colonies and verify the strains using the ΔargH verification-F / R pair and send them for sequencing. The strains with correct verification results were stored in an ultra-low temperature refrigerator at -80 °C.

[0073] 3. Genetic stability detection of argH gene deletion strains

[0074] The Aeromonas dhakensis ΔargH deletion strain was inoculated into a shaking flask and cultured at 37 °C for 12 h. Then, 100 μL was taken and inoculated into fresh LB liquid medium, and blindly passaged continuously for 30 generations.

[0075] 4. Construction of argH gene complementation strains

[0076] 1) Amplification of the argH gene fragment: Using the extracted C160501 genome as a template, perform PCR amplification. The primers used for the amplification of the argH gene fragment are seamless argH-F / R. After the PCR reaction is completed, use 1% agarose gel electrophoresis to detect the amplification product, and confirm whether the product size is consistent with the expected size through a gel imaging system. If they are consistent, use a DNA purification kit to purify the product and measure its concentration.

[0077] 2) Reverse amplification of the pBBR1MCS-2 plasmid: Use a plasmid extraction kit to extract pBBR1MCS-2 plasmid DNA, and use the primers reverse pBBR1MCS-2-F / R for PCR amplification to linearize the plasmid.

[0078] 3) Recombination reaction (seamless cloning): Refer to the instructions of the Universal One Step Cloning Kit to perform a multi-fragment recombination reaction (in a PCR instrument, react at 50 °C for 20 min). Use Hieff Universal Enzyme Premix to ligate the pBBR1MCS-2 plasmid with the argH gene fragment to construct the complementation plasmid pBBR1MCS-2-ΔlacZα::argH.

[0079] 4) Mix the recombination reaction product with E. coli WM3064 competent cells in a centrifuge tube. After gently pipetting and mixing, incubate on ice for 30 min. Subsequently, place the centrifuge tube in a 42 °C water bath for heat shock for 90 s, and immediately transfer it to ice for cooling for 3 min. Then, add 900 μL of fresh LB liquid medium, and place it in a 37 °C constant temperature shaker for culturing for 1 h. After incubation is completed, aspirate 100 μL of the cultured bacterial solution and spread it on LB agar medium containing Kan (50 μg / mL) and DAP (25 μg / mL) at three different high and low concentrations, and invert it and place it in an incubator at 37 °C overnight.

[0080] The next day, use a sterile inoculation loop to pick positive clone colonies for colony PCR verification. Use the outer primers pBBR1MCS-2-F / R of the inserted fragment on the plasmid to perform PCR identification (1% agarose gel electrophoresis) on the recombinant transformants. The product obtained by colony PCR is subjected to electrophoresis detection on a 1% agarose gel, and the size of the PCR product is detected by a gel imaging system to see if it is consistent with the expected size. If they are consistent, the PCR product can be sent to Sangon Biotech (Shanghai) Co., Ltd. in Hainan to complete sequencing and other matters, and then extract a large amount of the successfully recombined plasmid pBBR1MCS-2-ΔlacZα::argH. At the same time, add the bacterial solution of the strain with correct sequencing results to a cryopreservation tube and store it at -80 °C.

[0081] 5) Conjugative transfer: After activating the donor strain WM3064(pBBR1MCS-2-ΔlacZα::argH) and the wild strain C160501, 50 μL of each was taken and inoculated into LB liquid medium, and cultured with shaking at 37 °C and 180 rpm until OD 600 ≈0.5 or so. 3×2 mL of WM3064(pBBR1MCS-2-ΔlacZα::argH) and 1×2 mL of C160501 bacterial liquid were respectively pipetted into 2 mL centrifuge tubes, and the cell pellets were collected by centrifugation at 5000 rpm for 5 min. The cell pellets of WM3064(pBBR1MCS-2-ΔlacZα::argH) and C160501 were resuspended with 1 mL of fresh LB liquid medium, and this step was repeated twice to ensure thorough mixing. It was dropped onto an LB agar plate containing DAP (25 μg / mL), and after it was completely absorbed, it was placed upright in an incubator at 37 °C for 12 h. The next day, an appropriate amount of fresh LB liquid medium was dropped onto the plate, and the cells were scraped and collected with an inoculation loop. After the bacterial liquid was shaken and mixed to wash away DAP, 100 μL of the bacterial liquid was pipetted and spread on an LB agar medium containing Kan (50 μg / mL) at three different concentrations, and it was inverted and cultured overnight at 37 °C.

[0082] 6) Screening of complemented strains: Single colonies were picked and identified by PCR (1% agarose gel electrophoresis). After the gene complemented strains were screened, the remaining bacterial liquid was spread on LB agar medium (purification to avoid contamination of trace wild-type strains in the single colonies), and single colonies were picked again for PCR identification, and this step was repeated twice. The purified strains were streaked on an LB plate and cultured overnight at 37 °C. Single colonies were picked and the strains were verified using the outer primers pBBR1MCS-2 verification-F / R and argH verification-F / R containing the inserted fragment on the plasmid and sent for sequencing. The strains with correct verification results were stored in a -80 °C ultra-low temperature freezer.

[0083] 5. Construction of strains containing empty vectors

[0084] After conjugating ΔargH with E. coli WM3064 carrying the pBBR1MCS plasmid, a strain containing an empty plasmid was obtained.

[0085] 6. Determination of the growth curve of strains

[0086] After activating the resuscitated and preserved Aeromonas dhakensis C160501, ΔargH, CΔargH, C4-1-pBBR1MCS-2, and ΔargH-pBBR1MCS-2 respectively, they were cultured to the logarithmic growth phase (OD 600≈0.5 or so), add the bacterial liquid to 200 μL of fresh LB liquid medium (in a 96-well plate) at a rate of 1% respectively. There are three parallels in each group, and the blank control does not inoculate bacteria. Use a microplate reader to detect the OD of the bacterial liquid every 1 h under the conditions of 37 °C and 180 rpm. 600 Taking the absorbance as the abscissa and the culture time as the ordinate, take the average value of the three groups of data to draw a growth curve.

[0087] 7. Determination of Arginine - Sakaguchi Reaction

[0088] Determine the enzyme activity by the Sakaguchi test. First, dissolve 0.2 g of α-naphthol and 5 g of urea in 100 mL of 95% ethanol to prepare Sakaguchi reagent A. Prepare Sakaguchi reagent B by mixing 5 mL of 10 mmol / L NaOH and 2 mL of 2% NaClO. Drop a drop of the supernatant of the bacterial liquid fermentation on the filter paper, and then drop Sakaguchi reagents A and B on the same point in sequence. Finally, after the filter paper is completely dry, observe the color development of the spot. Pink to red indicates the presence of arginine in the sample.

[0089] 8. Determination of Protease Activity

[0090] After activating and preserving the Aeromonas dhakensis C160501, ΔargH, CΔargH, C4-1-pBBR1MCS-2, ΔargH-pBBR1MCS-2 by resuscitation, culture them until the logarithmic growth phase (OD 600 ≈0.5 or so), use a pipette to gently spot 3 μL of the bacterial liquid on the protease activity detection medium. Place the plate upright for half an hour to allow it to solidify completely, and then place it in a 37 °C constant temperature incubator and incubate it upright for 24 h. Measure the colony diffusion diameter and take the average value of three repetitions.

[0091] 9. Determination of Hemolytic Activity

[0092] After activating and preserving the Aeromonas dhakensis C160501, ΔargH, CΔargH by resuscitation, culture them until the logarithmic growth phase (OD 600 ≈0.5 or so), use a pipette to gently spot 3 μL of the bacterial liquid on a sterile sheep blood plate. Place the plate upright for half an hour to allow it to solidify completely, and then place it in a 37 °C constant temperature incubator and incubate it upright for 24 h. Measure the colony diffusion diameter and take the average value of three repetitions.

[0093] 10. Motility Detection

[0094] After activating and preserving the Aeromonas dhakensis C160501, ΔargH, CΔargH by resuscitation, culture them until the logarithmic growth phase (OD 600Approximately 3 μL of the bacterial solution (about 0.5) was taken with a pipette and gently spotted on 0.3% TSA (swimming ability detection) and 0.5% TSA (swarming ability detection) solid media. The plates were placed upright for half an hour to allow complete solidification, and then incubated upright in a 37 °C incubator for 24 h. The colony diffusion diameter was measured, and the average value was taken after three repetitions.

[0095] 11. Transmission electron microscopy (TEM)

[0096] To investigate the effect of the argH gene on flagella formation in Aeromonas dhakensis C160501, the strain was streaked on LB solid medium. After being identified as the target strain by Nanshan Sequencing Company, transmission electron microscopy was used to observe the flagella and cell morphology of the wild type C160501, the ΔargH deletion strain, and the CΔargH complemented strain. The experimental method refers to the literature (Kang Yuanhuan. Comparative proteomics and genomics analysis of different virulent strains of Aeromonas veronii and preliminary study on the function of related genes [D]. Jilin. Jilin Agricultural University. 2017.).

[0097] 12. qRT-PCR detection of the expression level of flagella-related genes

[0098] To further analyze the effect of the argH gene on flagella in Aeromonas dhakensis C160501, the expression changes of flagella-related genes in C160501 were detected at the gene level by fluorescence quantitative PCR. The primers used are shown in Table 1.

[0099] 13. Hydrogen peroxide resistance detection

[0100] After the revived and preserved Aeromonas dhakensis C160501, ΔargH, and CΔargH were activated respectively and cultured to the logarithmic growth phase (OD 600 ≈0.5), 100 μL of the bacterial solution was evenly spread on the LB solid plate. Then, a sterile paper sheet pre-soaked in H2O2 solution was attached to the surface of the medium, and it was incubated upside down in a 37 °C incubator for 24 h. The colony diffusion diameter was measured, and the average value was taken after three repetitions.

[0101] 14. Crystal violet staining method for detecting the formation of bacterial biofilms

[0102] After the revived and preserved Aeromonas dhakensis C160501, ΔargH, and CΔargH were activated respectively, using the crystal violet staining method, the bacterial solution with an OD 600 value of about 0.5 was diluted 100 times, and 200 μL was taken and added to a 96-well plate and cultured at 37 °C for 24 h. After taking it out, the OD 600Values, rinse three times with PBS buffer, add 100 μL of methanol and fix for 20 min, discard the methanol and air dry. Subsequently, stain with crystal violet ammonium oxalate for 6 min, wash three times with PBS buffer and air dry. Add 100 μL of 95% ethanol to each well, let stand at room temperature for 30 min and then measure the OD 600 value, and repeat the experiment three times.

[0103] 15. Detection of the formation of bacterial biofilms by laser confocal fluorescence microscopy

[0104] Take a confocal culture dish, add 2 mL of diluted bacterial solution to it, and incubate in a 37 °C constant temperature incubator for 24 h. After the incubation, gently rinse the culture dish three times with PBS buffer, add methanol solution and fix for 20 min, discard the methanol solution and air dry. Add an appropriate amount of propidium iodide (PI) staining solution and stain for 25 min. After staining, rinse with PBS buffer; then stain with fluorescein isothiocyanate (FITC-ConA) for 30 min, then rinse again with PBS buffer, blot off the excess moisture with absorbent paper, and add an appropriate amount of anti-fluorescence quenching mounting medium. Prepare the observation sample, use a laser confocal fluorescence microscope to observe the biofilm, receive green and red fluorescence signals at wavelengths of 488 nm and 535 nm respectively, after positioning the fluorescence signal with a 60× oil immersion lens, scan along the Z-axis from the free surface of the biofilm towards the attachment surface, and set the scanning thickness of each layer to 1 - 2 μm. After completing the image acquisition, process the image with the help of NIS software to finally obtain a three-dimensional image of the biofilm for subsequent analysis and research.

[0105] 16. Antibacterial peptide sensitivity detection

[0106] After activating Aeromonas dhakensis C160501, ΔargH, and CΔargH preserved by resuscitation, adjust the bacterial solution to an OD 600 value of approximately 0.5, and dilute the antibacterial peptide concentrations to 25 ng / mL, 50 ng / mL, 100 ng / mL, and 200 ng / mL with ddH2O. Take 100 μL of the bacterial solution and mix it with different concentrations of antibacterial peptides in equal volumes, then add them to a 96-well plate, and set three parallel wells for each concentration. After incubating at 37 °C for 1 h, dilute the mixture 1000 times with ddH2O, spread it on an LB solid medium, and perform colony counting after overnight culture at 37 °C. The formula for calculating the bacterial survival rate is: the number of colonies in the sample / the number of colonies of the untreated strain.

[0107] 17. Detection of the adhesion ability to EPC cells

[0108] Pre-culture EPC cells in a 24-well cell culture plate using M199 cell culture medium. After overnight culture, discard the cell culture medium and wash away the non-adherent cells with M199 medium without antibiotics. After activating the Aeromonas dhakensis C160501, ΔargH, and CΔargH strains preserved by resuscitation, dilute the bacterial solution to an OD 600 value of about 0.5 and inoculate it into the 24-well cell culture plate at a ratio of 10:1 (bacteria: cells). Set three replicates for each group and use PBS solution as a blank control. After culturing in a 37°C cell incubator for 3 h, wash three times with PBS solution, add 1% Tritonx-100 and mix well to lyse the cells, and incubate at 37°C for 45 min. Dilute the lysate to an appropriate concentration, coat it, and count. Adhesion was evaluated by the adhesion index: the total number of bacteria adhering to the cell surface / the number of cells.

[0109] 18. Detection of the cytotoxic effect of bacteria on EPC cells by CCK8 method

[0110] Co-culture 100 μL of bacterial solution with a concentration of 1×10 6 CFU / mL with EPC cells for 30 min, 1 h, and 2 h, and detect the cytotoxic effect of different strains on EPC cells according to the instructions of the Solarbio CCK-8 cell cytotoxicity kit. The experiment was repeated three times.

[0111] 19. Virulence detection of Caenorhabditis elegans

[0112] After activating the Aeromonas dhakensis C160501, ΔargH, and CΔargH strains preserved by resuscitation, culture them to the logarithmic growth phase (OD 600 ≈0.5). Take 100 μL of the bacterial suspension and spread it evenly on NGM (Nematode Growth Medium) agar plates, and incubate in a 37°C constant temperature incubator for 12 h.

[0113] Inoculate L1-stage nematode larvae on NGM plates containing Escherichia coli OP50 (E.coli OP50) for synchronization, and culture them in a 20°C constant temperature incubator until the L4 stage or young adult stage. Subsequently, inoculate the synchronized L4-stage nematodes onto NGM plates coated with wild-type strains, gene knockout strains, and gene complementation strains. Use no less than 30 nematodes for each experimental group and set up triple biological replicates. Use NGM plates inoculated with E.coli OP50 as a negative control. Place the inoculated plates in a 20°C incubator for culture and regularly observe the survival status of the nematodes. Record the number of surviving nematodes every 24 h until all nematodes die and the experiment ends (Kang Yuanhuan. Comparative proteomics and genomics analysis of different virulent strains of Aeromonas veronii and preliminary study on the functions of related genes [D]. Jilin. Jilin Agricultural University. 2017.).

[0114] 20. Data Statistics and Analysis

[0115] Use SPSS 10 software to calculate the LD of the strains 50 value, and use GraphPad Prism software for data statistics and visualization analysis. One-way analysis of variance (ANOVA) and Tukey test are used to determine the differences between groups. A p-value < 0.05 represents statistically significant differences.

[0116] III. Experimental Results and Analysis

[0117] 1. Construction of Tool Strains

[0118] 1.1 Construction of argH Gene Deletion Strains

[0119] Use the primer pair ΔargH verification-F / R to perform PCR verification on the ΔargH gene deletion strain. As Figure 1 shown, the amplified fragment size using the genomic DNA of wild-type Aeromonas dhakensis as a template is 2,657 bp (lane 1), and the amplified fragment size of the PCR product of the ΔargH deletion strain is 1,271 bp (lanes 2 and 3), which is consistent with the expected fragment size. The construction of the ΔargH Aeromonas dhakensis is completed.

[0120] 1.2 Detection of Genetic Stability of argH Gene Deletion Strains

[0121] To detect whether the genetic characteristics of the ΔargH gene deletion strain are stable, the present invention performs PCR verification on the strains blindly passaged continuously for 30 generations. Randomly select 9 monoclonal isolates and perform PCR amplification using the primer pair ΔargH verification-F / R. As Figure 2 shown, specific bands of 1,271 bp are stably amplified in each generation of strains, and the sizes of the PCR products of all detected strains are consistent with the expected results. These results indicate that the ΔargH gene deletion strain can maintain stable genetic characteristics during continuous passage and can be used for subsequent experimental studies.

[0122] 1.3 Construction of argH Gene Complemented Strains

[0123] Genotype identification of the CΔwecA complemented strain is performed by double PCR verification. Use the primer pair ΔwecA verification-F / R to amplify the genome, and at the same time use the primer pair pBBR1MCS-2 verification-F / R to verify the plasmid insertion fragment. As Figure 3As shown, a 1,289 bp ΔwecA deletion fragment was amplified in lanes 1 - 2, a 2,258 bp plasmid insertion fragment was obtained in lanes 3 - 4, a 2,081 bp wild-type fragment was amplified using the wild strain as a template in lane 6, and a 969 bp plasmid backbone fragment was obtained in lane 7. All amplified products were consistent with the expected sizes. These results indicate that the CΔwecA complemented strain has been successfully constructed and the plasmid has been stably integrated into the genome.

[0124] 1.4 Construction of the strain containing the empty vector

[0125] The transformants were screened and identified using the pBBR1MCS-2 verification - F / R primer pair. As Figure 4 shown, through PCR amplification and agarose gel electrophoresis analysis, the Aeromonas dhakensis ΔargH transformants containing the pBBR1MCS-2 empty plasmid were successfully screened. The positive clones were verified by sequencing to confirm that the plasmid was intact and correctly inserted.

[0126] 2. The deletion of the argH gene has a significant inhibitory effect on the bacterial growth rate

[0127] The results of the growth curve analysis are as Figure 5 shown. Compared with the wild strain C160501, the growth rates of the ΔargH and ΔargH + pBBR1MCS-2 strains were significantly slowed down (P ≤ 0.0001). This result indicates that the deletion of the argH gene has a significant impact on its growth. The key metabolic pathways in the ΔargH deletion strain may be inhibited, such as the tricarboxylic acid (TCA) cycle process, resulting in a significant difference in its growth rate compared with the wild strain C160501. In addition, the complemented strain did not have a significant impact on the growth rate of the strain.

[0128] 3. The deletion of the argH gene leads to changes in the arginine content of the bacteria

[0129] The statistical results are shown in Figure 6 . Except for the ΔargH and ΔargH + pBBR1MCS-2 strains not showing pink, the other strains all showed pink. It can be seen that the deletion of the argH gene will cause changes in the arginine content of the strain, indicating that in Aeromonas dhakensis, the argH gene is responsible for encoding argininosuccinate lyase and is a key link in the arginine biosynthesis pathway.

[0130] 4. The deletion of the argH gene leads to a significant decrease in the protease activity of the bacteria

[0131] The results of the protease activity assay showed ( Figure 7) The protease activity of the ΔargH deletion strain was significantly decreased compared with that of the wild strain statistically (P≤0.01), indicating that the argH gene plays an important role in the proteolytic regulation of Aeromonas dhakensis. In addition, there were no significant differences in protease activity between the argH gene complemented strain (CΔargH) and the empty plasmid control strain (ΔargH-pBBR1MCS-2) compared with the ΔargH deletion strain (P>0.05). Given that both the previous growth curve experiment and protease activity assay experiment confirmed that the pBBR1MCS-2 empty plasmid had no significant effect on the strain phenotype, to optimize the experimental design and reduce redundant controls, the control group with the empty vector strain will not be set in the subsequent experiments.

[0132] 5. Deletion of the argH gene leads to a significant increase in bacterial hemolytic activity

[0133] The results of hemolytic activity assay are as Figure 8 shown. The wild strain C160501, the ΔargH deletion strain and the CΔargH complemented strain all showed β-hemolytic activity; there was a significant difference in the hemolytic zone of ΔargH compared with C160501 (P≤0.001), and its hemolytic ability was significantly higher than that of C160501. The above results indicate that the deletion of the argH gene can significantly enhance the hemolytic activity of Aeromonas dhakensis. In addition, the complemented strain had no significant effect on the hemolytic activity of the strain.

[0134] 6. Deletion of the argH gene leads to a significant enhancement of bacterial swimming ability

[0135] The movement modes of Aeromonas dhakensis are divided into swimming and swarming. The results of motility detection are as Figure 9 shown. C160501, ΔargH, and CΔargH can all form swimming circles, and their diameters are 2.50±0.02 cm, 2.10±0.10 cm, and 2.56±0.01 cm respectively; the deletion of the argH gene can significantly reduce the swimming ability of Aeromonas dhakensis (P≤0.01). In the swarming test, their diameters are 2.07±0.08 cm, 2.68±0.30 cm, and 2.19±0.06 cm respectively; the deletion of the argH gene significantly enhances the swarming ability of Aeromonas dhakensis (P≤0.01). In addition, the complemented strain had no significant effect on the swimming and swarming abilities of the strain.

[0136] 7. Deletion of the argH gene leads to changes in bacterial flagellar morphology

[0137] To analyze the effect of the argH gene on flagellar assembly, the wild strain C160501, the ΔargH deletion strain and the CΔargH complemented strain were observed by transmission electron microscopy (TEM) in this invention. The electron microscopy analysis showed that:

[0138] The wild-type strain C160501 has a typical single polar flagellum structure. The diameter of the flagellum was quantitatively analyzed by ImageJ to be 16.2 ± 1.4 nm (n = 30), and the length distribution range was 1.3 - 3.1 μm. Its regular helical structure suggests that it may play a role in promoting bacterial chemotaxis; the ΔargH deletion strain showed significant phenotypic changes, with the presence of broken polar flagella, a significant decrease in flagellar density (58.3% less than that of the wild-type strain), and partial shrinkage and aggregation on the cell surface. However, the flagellar size parameters (diameter 16.1 ± 1.2 nm, length 1.2 - 3.0 μm) were not statistically different from those of the wild-type strain (p > 0.05); the CΔargH complemented strain had the flagellar density restored to the wild-type level, but 13.6% of the cells still retained the shrunk phenotype, indicating that the argH gene may be involved in the regulatory network for maintaining bacterial morphology ( Figure 10 ).

[0139] 8. Deletion of the argH gene leads to up-regulation of the transcription levels of bacterial flagella-related genes

[0140] The results of fluorescence quantitative PCR analysis showed that under the condition of argH gene deletion, the transcription levels of flagella-related genes (including fliA, fliC, fliS, fliK, fliL, and cheV) all showed a significant upward trend ( Figure 11 ). This indicates that the argH gene may affect the expression of flagella-related genes through a certain regulatory mechanism.

[0141] 9. Deletion of the argH gene leads to a significant increase in the tolerance of bacteria to hydrogen peroxide

[0142] To explore the effect of argH gene deletion on the oxidative stress response ability of bacteria, the present invention designed a hydrogen peroxide resistance experiment. As Figure 12 shown, the hydrogen peroxide resistance test results showed that compared with the wild-type strain, the ΔargH deletion strain had a significantly increased tolerance to hydrogen peroxide (P ≤ 0.05). This finding indicates that the deletion of the argH gene may enhance the ability of bacteria to cope with oxidative stress through a certain mechanism.

[0143] 10. Deletion of the argH gene leads to a significant decrease in the ability of bacteria to form biofilms

[0144] ① The experimental results of the crystal violet staining method are as Figure 13 shown. Compared with the wild-type strain, the ability of the ΔargH deletion strain to form biofilms was significantly decreased (P ≤ 0.0001). This result indicates that the deletion of the argH gene significantly inhibits the ability of Aeromonas dhakensis to form biofilms, and the complemented strain did not have a significant effect on the ability of the strain to form biofilms.

[0145] ② The observation results of the confocal laser scanning fluorescence microscope (CLSM) are as Figure 14As shown, the main structural components of the biofilm include biofilm-associated exopolysaccharides (EPS) and extracellular DNA (eDNA). In this invention, fluorescein isothiocyanate (FITC-ConA) and propidium iodide (PI) were used to specifically stain EPS and eDNA in the biofilm, respectively, and CLSM was used to quantitatively analyze their spatial distribution and relative content. The observation results showed that compared with the wild-type strain, the fluorescence signal intensities of FITC and PI in the biofilm of the ΔargH deletion strain were significantly reduced. This phenomenon is consistent with Figure 13 the result of weakened biofilm formation ability shown by the crystal violet staining method in

[0146] 11. Deletion of the argH gene leads to a significant increase in the sensitivity of bacteria to crocodile-derived antimicrobial peptides

[0147] To evaluate the effect of argH gene deletion on the sensitivity of Aeromonas dhakensis to antimicrobial peptides, in this invention, crocodile-derived antimicrobial peptides Leucrocin I and Leucrocin II were used to detect the drug sensitivity of each strain. As Figure 15 shown, compared with the wild strain C160501, the sensitivity of the ΔargH deletion mutant strain to the two antimicrobial peptides was significantly increased (P≤0.05), while the sensitivity of the complemented strain did not show a significant change. This result indicates that the deletion of the argH gene leads to a significant increase in the sensitivity of Aeromonas dhakensis to crocodile-derived antimicrobial peptides, suggesting that the argH gene may play an important role in bacterial cell membrane stability or the antimicrobial peptide resistance mechanism.

[0148] 12. Deletion of the argH gene leads to a significant decrease in the adhesion rate of bacteria to EPC cells

[0149] To study the effect of argH gene deletion on the host cell adhesion ability of Aeromonas dhakensis, in this invention, a quantitative analysis of the adhesion rate of each strain was performed using a carp epithelial tumor cell model. As Figure 16 shown, compared with the wild-type strain C160501, the adhesion rate of the ΔargH deletion strain was significantly reduced (P≤0.0001), while the adhesion rate of the complemented strain recovered to a level comparable to that of the wild-type strain. This result indicates that the argH gene plays a key role in regulating the adhesion of Aeromonas dhakensis to host cells, and its deletion may lead to significant changes in the expression of bacterial surface adhesion factors or related regulatory proteins, thereby affecting the interaction between bacteria and host cells.

[0150] 13. Deletion of the argH gene leads to enhanced cytotoxicity of bacteria against EPC cells

[0151] Quantitative analysis of cytotoxicity using the CCK-8 kit revealed that at the time points of 30 min, 1 h, and 2 h after infection, there were significant differences in cytotoxicity between the ΔargH deletion strain and the wild-type strain C160501 (P≤0.001), and the ΔargH deletion strain exhibited stronger cytotoxicity. The cytotoxicity of the CΔargH complemented strain was basically the same as that of the wild-type strain C160501( Figure 17 ). This result indicates that the deletion of the argH gene significantly enhances the virulence of Aeromonas dhakensis, and the gene complementation experiment further confirms the key role of the argH gene in regulating bacterial virulence.

[0152] 14. Deletion of the argH gene leads to increased survival rate of Caenorhabditis elegans

[0153] The results of the nematode virulence experiment showed that compared with the wild-type strain, the knockout of the argH gene significantly increased the survival rate of Caenorhabditis elegans. The average lifespan of the ΔargH deletion strain (15.11±0.19 days) exceeded that of the C160501 wild-type strain (10.70±0.21 days) and the CΔargH complemented strain (11.16±0.22 days), but the lifespan of all Aeromonas dhakensis strains was shorter than that of the OP50 strain (17.94±0.19 days)( Figure 18 ).

[0154] Argininosuccinate lyase (ASL), encoded by the argH gene, plays a key role in biochemical processes. It can promote the reaction of argininosuccinate to generate arginine and is an extremely important enzyme in the urea cycle system (Zhang Mingyang. Effects of argG, argH, and argR genes on the stress resistance of Lactococcus lactis NZ9000 [D]. Jiangnan. Jiangnan University. 2016.). Moreover, the protein synthesis process of this enzyme is under the precise regulation of the ArgR protein. Argininosuccinyl lyase (ASL) can promote the conversion of aspartic acid to arginine. Relevant studies have shown that the survival ability of strains under acid stress conditions has a significant impact on the metabolic status of arginine (Poolman B, Driessen A, Konings W N. Regulation of arginine-ornithine exchange and the arginine deiminase pathway in Streptococcus lactis [J]. Journal of Bacteriology, 1987, 169(12):5597-604.).

[0155] In this invention, an argH gene deletion strain was successfully constructed using the suicidal plasmid pRE112. Utilizing the origin of transfer (oriT) on the pRE112 plasmid backbone, the recombinant pRE112 plasmid was transferred from the donor strain WM3064 to the recipient strain C160501. To further verify the function of the argH gene, a corresponding gene complementation strain was also constructed in this invention. In addition, a control strain containing the empty vector pBBR1MCS-2 was constructed to exclude the possible effects of the plasmid itself on the strain phenotype. This series of rigorous experimental designs provided reliable technical guarantees for accurately analyzing the function of the argH gene.

[0156] The results of growth curve analysis showed that the deletion of the argH gene led to a significant decrease in the growth rate of Aeromonas dhakensis strain C160501. This phenomenon suggested that the deletion of the argH gene might inhibit the growth and reproduction of bacteria by affecting the energy metabolism process of key metabolic pathways such as the tricarboxylic acid cycle. Specifically, the argininosuccinate lyase encoded by the argH gene is a key enzyme in the arginine biosynthesis pathway, and its deletion might lead to a decrease in intracellular arginine levels, thereby affecting the metabolic flux of the urea cycle and the TCA cycle. The results of the Sakaguchi reaction experiment showed that the argH gene deletion mutant did not show a characteristic pink color reaction, indicating a significant change in the arginine metabolic pathway within the strain. This result not only confirmed the biological function of the argH gene encoding argininosuccinate lyase in Aeromonas dhakensis, but also implied that the reprogramming of the arginine metabolic pathway might affect multiple physiological processes of bacteria. The results of protease activity detection showed that the proteolytic activity of the argH gene deletion mutant was significantly reduced, which might be due to the reprogramming of the metabolic pathway resulting in more resources and energy being reallocated to the physiological processes maintaining the basic survival of bacteria rather than the synthesis and secretion of proteases.

[0157] It is worth noting that the hemolytic activity experiment showed that the diameter of the hemolytic zone of the argH gene deletion mutant was significantly increased, indicating a significant enhancement of its hemolytic activity. This phenomenon might be related to the expression regulation of the hemolysin hlyA and the aerolysin aerA genes.

[0158] The results of motility detection showed that the deletion of the argH gene led to a significant decrease in the swimming ability of Aeromonas dhakensis, while the swarming ability was significantly enhanced. In the argH gene complemented strain, the motility of the bacteria recovered to a level comparable to that of the wild-type strain, indicating that the deletion of the argH gene might affect the energy metabolism process of the cells, resulting in insufficient energy supply for swimming motility. Through transmission electron microscopy observation, it was found that the flagella of the ΔargH deletion strain were broken and the flagellar density was significantly reduced. Therefore, it was speculated that the deletion of the argH gene might interfere with the assembly process of bacterial flagella. To verify this hypothesis, the present invention used fluorescence quantitative PCR technology to detect the expression levels of flagella-related genes. The results showed that the expression levels of 6 genes related to flagella synthesis were all significantly increased, indicating that the shedding of flagella activated the self-repair system of bacteria, thus promoting the increase in the expression levels of related genes to repair the damaged flagellar structure. According to the analysis of the flagella experiment results, it was speculated that the argH gene might indirectly affect the formation of biofilm by regulating the flagella synthesis ability. In addition, the hydrogen peroxide resistance experiment showed that the antioxidant ability of the ΔargH deletion strain was significantly better than that of the wild-type strain, and this phenomenon might be related to the up-regulation of the expression levels of antioxidant stress-related genes in the strain. It was shown that the deletion of the argH gene might activate the antioxidant stress system of bacteria through a certain regulatory mechanism, thus enhancing its tolerance to oxidative damage.

[0159] The results of the biofilm formation experiment showed that the biofilm formation ability of the ΔargH deletion strain was significantly decreased compared with that of the wild-type strain C160501. Laser confocal microscopy (CLSM) observation showed that the fluorescence signal intensity of the biofilm of the ΔargH deletion strain was significantly weakened, the structure was loose, and the contents of extracellular polysaccharide and extracellular DNA were both significantly reduced. Therefore, the present invention speculated that the deletion of the argH gene might lead to a decrease in the ROS content in the bacterial biofilm by changing the arginine metabolic pathway, thus significantly inhibiting the biofilm formation ability. Crocodile serum is rich in various antimicrobial peptides, and these antimicrobial peptides play an important role in resisting the invasion of pathogenic bacteria. The results of the antimicrobial peptide sensitivity experiment showed that the sensitivity of the ΔargH deletion strain to crocodile-derived antimicrobial peptides was significantly higher than that of the wild-type strain C160501. In addition, the cell adhesion experiment showed that the adhesion ability of the ΔargH deletion strain to Epithelioma papulosum cyprini (EPC) cells was significantly reduced, and these phenomena might be related to the weakening of the biofilm barrier function. However, the results of the cytotoxicity detection experiment on EPC cells showed that the cytotoxicity of the ΔargH deletion strain was significantly stronger than that of the wild-type strain C160501, and this result was opposite to the regulatory trend of the hcp1 and vash genes on cytotoxicity in Aeromonas hydrophila. It was shown that the argH gene might participate in the regulation of the virulence phenotype of bacteria through a unique mechanism. Nevertheless, the specific molecular mechanism by which the argH gene affects the virulence of bacteria still needs to be further studied in depth to clarify its regulatory network.

[0160] The results of the nematode virulence experiment showed that the knockout of the argH gene significantly improved the survival rate of Caenorhabditis elegans under Aeromonas dhakensis infection. This finding indicates that the argH gene plays a key role in the virulence of Aeromonas dhakensis, and its deletion weakens the pathogenicity of the bacteria to nematodes. The immune system of Caenorhabditis elegans is relatively simple and mainly relies on innate immune responses, including physical barriers (such as the cuticle) and conserved immune signaling pathways (such as the p38 MAPK pathway). The deletion of the argH gene may weaken the survival ability of Aeromonas dhakensis in nematodes, leading to a decrease in its virulence. Specifically, the argH gene is involved in arginine metabolism, and its deletion may cause the bacteria to be unable to effectively synthesize arginine, thereby affecting the proliferation of the bacteria or the expression of virulence factors. This speculation was verified in the Sakaguchi reaction experiment. In nematodes, the deletion of the argH gene may reduce its pathogenicity by weakening the metabolic ability or virulence factor expression of the bacteria. The present invention provides an important reference for further studying the regulatory role of the argH gene in the pathogenic mechanism of bacteria.

[0161] The above embodiments of the present invention are merely examples for more clearly illustrating the present invention, rather than limiting the implementation manners of the present invention. Any obvious changes or variations derived from the technical solutions of the present invention still fall within the protection scope of the present invention.

Claims

1. Construction method of Aeromonas dhakensis argH gene deletion strain derived from crocodile, comprising: The recombinant suicide plasmid pRE112-ΔargH of the argH gene was constructed by seamless cloning method. The Aeromonas dhakensis strain was conjugated with E. coli WM3064 containing pRE112-ΔargH to obtain the argH gene deletion strain ΔargH.

2. The construction method according to claim 1, characterized in that, The construction of the recombinant suicide plasmid pRE112-ΔargH of the argH gene by seamless cloning method further includes: using the genomic DNA of Aeromonas dhakensis C160501 as a template, and using argH-up-F / R, two pairs of primers, argH-down-F / R, to amplify the upstream and downstream homologous arms of the argH gene respectively; extracting the pRE112 plasmid DNA, and using the primers reverse pRE112-F / R for PCR amplification to linearize the plasmid; ligating the pRE112 plasmid with the argH upstream and downstream homologous arm fragments to construct the recombinant suicide plasmid pRE112-ΔargH; the primer sequences are as follows: argH-up-F: GCATATGACGCATTAATGAAATGC, argH-up-R: TTATTTCACCACAATGTAATATTAAAC; argH-down-F: TACCTGCAATAGTGTATGGGGC, argH-down-R: GAAGCGTTCAATCACCAGCC; reverse pRE112-F: TCTAGAAGAAGCTTGGGATCGGGC, reverse pRE112-R: GAGCTCTCCCGGGAATTCATGC.

3. The Aeromonas dhakensis argH gene deletion strain sourced from crocodile is obtained by the construction method described in claim 1 or 2.

4. Construction method of argH gene complemented strain of Aeromonas dhakensis from crocodile, comprising: The complementary plasmid pBBR1MCS-2-ΔlacZα::argH of the argH gene was constructed by seamless cloning method. The Aeromonas dhakensis strain was conjugated with E. coli WM3064 containing pBBR1MCS-2-ΔlacZα::argH to obtain the argH gene complementary strain CΔargH.

5. The construction method according to claim 4, characterized in that The construction of the complementary plasmid of the argH gene by seamless cloning method pBBR1MCS-2-ΔlacZα::argH further includes: using the genomic DNA of Aeromonas dhakensis C160501 as a template, and using the primers seamless argH-F / R to amplify the argH gene fragment; extracting the pBBR1MCS-2 plasmid DNA, and using the primers reverse pBBR1MCS-2-F / R for PCR amplification to linearize the plasmid; ligating the pBBR1MCS-2 plasmid with the argH gene fragment to construct the complementary plasmid pBBR1MCS-2-ΔlacZα::argH; the primer sequences are as follows: seamless argH-F: GAATTCTGGTGATGGCTAA, seamless argH-R: GTTGAGAAGCGTTAGAGAC; reverse pBBR1MCS-2-F: AGCTGTTTCCTGTGTGAAATTG, Reverse pBBR1MCS-2-R: GCGTTAATATTTTGTTAAAATTCGCGT.

6. The argH gene complemented strain of Aeromonas dhakensis derived from crocodile is obtained by the construction method described in claim 4 or 5.

7. Application of deletion of argH gene of Aeromonas dhakensis from crocodile, including: Slow down the growth rate of the strain, change the arginine content of the strain, significantly reduce the protease activity of the strain, significantly increase the hemolytic activity of the strain, significantly reduce the swimming ability of the strain, significantly enhance the swarming ability of the strain, change the flagellar morphology of the strain, significantly up-regulate the transcriptional level of flagella-related genes, significantly enhance the tolerance of the strain to hydrogen peroxide, significantly inhibit the biofilm formation ability of the strain, significantly enhance the sensitivity to crocodile-derived antimicrobial peptides, significantly reduce the adhesion rate of the strain to EPC cells, and significantly enhance the toxicity of the strain to EPC cells.

8. The application according to claim 7, wherein The application also includes: significantly increasing the survival rate of Caenorhabditis elegans under the infection of Aeromonas dhakensis.

Images