Method for constructing and optimizing haploid induction line based on MIGS system and application thereof

Abstract

The invention provides a method for constructing a haploid induction line based on an MIGS system, the method utilizes an RPS5a promoter to drive a miRNA-mediated gene silencing (MIGS) technology to inhibit CENH3 gene expression in arabidopsis thaliana, constructs a CENH3-mediated haploid induction line which has no growth defect and haploid induction capability, and can be used for creating haploid induction lines of other various species. The invention further provides a method for optimizing the low-induction-efficiency haploid induction system based on the MIGS system, the induction efficiency of the haploid induction system can be optimized by transferring the MIGS system driven by the RPS5a promoter into an existing haploid induction system, growth defects of the induction system are not caused, and the method can also be used for optimizing induction systems of other species. The invention provides a novel and effective technical scheme for the research of the plant haploid induction line, and has a wide application prospect.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant breeding, and particularly relates to a method for constructing and optimizing a haploid inducer based on the MIGS system and its application. Background Art

[0002] A haploid is an individual that contains only the chromosomal number (n) of a single gamete. By treating with colchicine or spontaneous doubling, a homozygous doubled haploid (DH) material that can be stably inherited can be obtained. Traditional breeding techniques, such as self-crossing, hybridization, backcrossing, etc., require more than 6 to 8 generations to obtain relatively homozygous germplasm resources that can be relatively stably inherited. However, by using haploid breeding technology, after obtaining haploid offspring and subjecting them to doubling treatment, a homozygous doubled haploid line that can be stably inherited can be obtained within 1 generation, thus greatly accelerating the breeding process of crop varieties.

[0003] CENH3 is a centromere-specific histone that plays a crucial role in the accurate segregation of chromosomes during cell division. To date, a series of methods have been developed in Arabidopsis thaliana to create CENH3-mediated haploid induction lines. Ravi and Chan created a CENH3-based haploid induction line, GFP-tailswap, by replacing the N-terminal tail structure of Arabidopsis thaliana CENH3 (Ravi M, Chan S W. Haploid plants produced by centromere-mediated genome elimination[J]. Nature, 2010, 464(7288): 615-618). Editing the CENH3 gene using techniques such as CRISPR / Cas9, EMS mutagenesis, TILLING, and CBE can generate a large number of different types of point mutations and fragment deletion mutations, and these mutants all have varying degrees of haploid induction ability (Karimi-Ashtiyani R, Ishii T, Niessen M, et al. Point mutation impairs centromeric cenh3 loading and induces haploid plants[J]. Proc Natl Acad Sci U S A, 2015, 112(36): 11211-11216; Kuppu S, Tan E H, Nguyen H, et al. Point mutations in centromeric histone induce post-zygotic incompatibility and uniparental inheritance[J]. PLoS Genet, 2015, 11(9): e1005494; Kuppu S, Ron M, Marimuthu M P A, et al. A variety of changes, including crispr / cas9-mediated deletions, in cenh3 lead to haploid induction on outcrossing[J]. Plant Biotechnol J, 2020; Wang S, Ouyang K. Rapid creation of cenh3-mediated haploid induction lines using a cytosine base editor (cbe)[J]. Plant Biol(Stuttg), 2023, 25(1): 226-230.).While acquiring the ability of haploid induction, these mutants often exhibit some growth defects in plants, such as leaf curling, dwarfism, sterility, embryo lethality, etc. These defects limit the application and development of CENH3-based haploid induction lines. Some studies have shown that using RNA interference (RNAi) gene silencing technology to reduce the expression level of the CENH3 gene in Arabidopsis thaliana will also cause a series of growth defects in plants, hindering the normal growth of plants, but it cannot endow plants with the ability of haploid induction (Lermontova I, Koroleva O, Rutten T, et al. Knockdown of cenh3 in arabidopsis reduces mitotic divisions and causes sterility by disturbed meiotic chromosome segregation[J]. Plant J, 2011, 68(1):40-50; Ahmadli U, Kalidass M, Khaitova L C, et al. High temperature increases centromere-mediated genome elimination frequency and enhances haploid induction in arabidopsis[J]. Plant Commun, 2023, 4(3):100507).

[0004] Based on this, there is an urgent need for a technology that can create functional haploid induction lines without affecting the normal growth of plants. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a method for constructing and optimizing a haploid induction line based on the MIGS system and its application in view of the deficiencies of the above-mentioned prior art. This method uses the RPS5a promoter to drive miRNA-mediated gene silencing (MIGS) technology to inhibit the expression of the CENH3 gene in Arabidopsis thaliana, thereby creating a CENH3-mediated haploid induction line without growth defects and with the ability of haploid induction. This method can be used to optimize the induction ability of low-efficiency haploid induction lines.

[0006] To solve the above technical problems, the technical solution adopted by the present invention is:

[0007] A method for constructing a haploid induction line based on the MIGS system, the method comprising the following steps:

[0008] S1. Construct the pRPS5a::MIGS vector

[0009] Fuse the pRPS10B promoter with the miR173 element and the Nos terminator to obtain the pRPS10B::miR173-Nos fragment, and then insert the pRPS10B::miR173-Nos fragment into the linearized pSSR100 vector by the Gibson homologous recombination method to form the pSSR pRPS10B::miR173 vector; subsequently, fuse the miR173_ts element with the 0-337bp of the CENH3 gene sequence to obtain the miR173_ts-CENH3 fragment; finally, clone the miR173_ts-CENH3 fragment and the RPS5a promoter into the linearized pSSR pRPS10B::miR173 vector by the Gibson homologous recombination method, and drive the expression of miR173_ts-CENH3 through the RPS5a promoter to obtain the pRPS5a::MIGS vector;

[0010] The sequence of the RPS10B promoter is shown in SEQ ID NO.1;

[0011] The sequence of the miR173 element is shown in SEQ ID NO.2;

[0012] The sequence of the Nos terminator is shown in SEQ ID NO.3;

[0013] The sequence of the miR173_ts element is shown in SEQ ID NO.4;

[0014] The sequence of the CENH3 gene is shown in SEQ ID NO.5;

[0015] The RPS5a promoter uses the 1760bp base before the start codon ATG of the RPS5a gene as the RPS5a promoter, and the sequence is shown in SEQ ID NO.6;

[0016] S2. Create a haploid inducer

[0017] Transfer the pRPS5a::MIGS vector obtained in S1 into Agrobacterium tumefaciens GV3101, and then transform the wild-type plants by the floral dip method, and screen out the transgenic positive plants; then emasculate and hybridize the obtained transgenic positive plants at the full flowering stage to obtain hybrid progeny seedlings, count the haploid ratio in the hybrid progeny, and screen out the plants with induction ability to obtain the MIGS-based haploid inducer pRPS5a::MIGS.

[0018] Preferably, the method for identifying the haploid in S2: screen candidate haploids through the plant leaf phenotype, and then further confirm the plant ploidy of the candidate haploids by flow cytometry analysis.

[0019] The method for constructing a haploid inducer based on the MIGS system described in the present invention can be used to construct haploid inducers for any monocotyledonous and dicotyledonous plants, endowing wild-type plants with induction ability and not causing growth defects in plants.

[0020] The present invention also provides a method for optimizing a haploid inducer with low induction efficiency based on the MIGS system, and the method includes the following steps:

[0021] S1. Construct the pRPS5a::MIGS vector

[0022] Fuse the pRPS10B promoter with the miR173 element and the Nos terminator to obtain the pRPS10B::miR173-Nos fragment, and then insert the pRPS10B::miR173-Nos fragment into the linearized pSSR100 vector by the Gibson homologous recombination method to form the pSSR pRPS10B::miR173 vector; subsequently, fuse the miR173_ts element with the 0-337bp of the CENH3 gene sequence to obtain the miR173_ts-CENH3 fragment; finally, clone the miR173_ts-CENH3 fragment and the RPS5a promoter into the linearized pSSR pRPS10B::miR173 vector by the Gibson homologous recombination method, and drive the expression of miR173_ts-CENH3 through the RPS5a promoter to obtain the pRPS5a::MIGS vector;

[0023] The sequence of the RPS10B promoter is as shown in SEQ ID NO.1;

[0024] The sequence of the miR173 element is as shown in SEQ ID NO.2;

[0025] The sequence of the Nos terminator is as shown in SEQ ID NO.3;

[0026] The sequence of the miR173_ts element is as shown in SEQ ID NO.4;

[0027] The sequence of the CENH3 gene is as shown in SEQ ID NO.5;

[0028] The RPS5a promoter uses the 1760bp base before the start codon ATG of the RPS5a gene as the RPS5a promoter, and the sequence is as shown in SEQ ID NO.6;

[0029] S2. Optimize the haploid inducer with low induction efficiency

[0030] Transfer the pRPS5a::MIGS vector obtained in S1 into Agrobacterium tumefaciens GV3101, and transform the existing haploid inducer GFP-CENH3 with low induction efficiency by the floral dip method. Screen the transgenic positive inducer plants; then emasculate and hybridize the obtained transgenic positive inducer plants at the full flowering stage to obtain hybrid offspring seedlings, count the haploid ratio in the hybrid offspring, and screen the transgenic inducer with an induction efficiency higher than that of the haploid inducer GFP-CENH3, which is the optimized transgenic inducer GN; pRPS5a::MIGS.

[0031] The method for optimizing the haploid inducer with low induction efficiency based on the MIGS system of the present invention can be used to optimize the existing haploid inducers of any monocotyledonous and dicotyledonous plants, improve the induction efficiency of the haploid inducer, and do not cause growth defects in plants.

[0032] Due to the adoption of the above technical solutions, the present invention has significant technical effects:

[0033] 1. By using the MIGS system driven by the RPS5a promoter to inhibit the expression of the CENH3 gene, the present invention can construct a haploid inducer that has no growth defects and can effectively obtain haploids. This method can be used to create haploid inducers for other various species.

[0034] 2. Transferring the MIGS system driven by the RPS5a promoter into the existing haploid inducer can optimize its induction efficiency and does not cause growth defects in the inducer. This method can also be used to optimize the inducers of other various species.

[0035] 3. The present invention provides a new and effective technical solution for the research of plant haploid inducers, with broad application prospects.

[0036] The following further elaborates the present invention in detail with reference to the drawings and embodiments. Brief Description of the Drawings

[0037] Figure 1 It is the structural diagram of the pRPS5a::MIGS vector in Example 1 of the present invention;

[0038] Figure 2 It is the representative phenotype photo of haploids, aneuploids, and diploids (from left to right) of the offspring of the hybridization between the transgenic plant (male) and gl1 Ler (female) in Example 2 of the present invention;

[0039] Figure 3 It is the flow cytometry analysis result of the diploid (gl1, left) and haploid offspring (right) in Example 2 of the present invention;

[0040] Figure 4 It is the pollen viability detection result of the transgenic plant pRPS5a::MIGS of Example 2 of the present invention and Arabidopsis wild type Col;

[0041] Figure 5 It is the phenotype of the transgenic plant pRPS5a::MIGS of Example 2 of the present invention and Arabidopsis wild type Col;

[0042] Figure 6 It is the pollen viability detection result of the transgenic inducer line GN; pRPS5a::MIGS of Example 3 of the present invention and the Arabidopsis haploid inducer line GFP-CENH3;

[0043] Figure 7 It is the phenotype of the transgenic inducer line GN; pRPS5a::MIGS of Example 3 of the present invention and the Arabidopsis haploid inducer line GFP-CENH3. Detailed implementation mode

[0044] Example 1

[0045] This example is to construct the pRPS5a::MIGS vector.

[0046] The construction method of the pRPS5a::MIGS vector is as follows: The pRPS10B promoter, the miR173 element and the Nos terminator are used to generate the pRPS10B::miR173-Nos fragment through fusion PCR, and then the pRPS10B::miR173-Nos fragment is inserted into the linearized pSSR100 vector through the Gibson homologous recombination method to form the pSSR pRPS10B::miR173 vector; Subsequently, the miR173_ts element is fused with the 0-337bp of the CENH3 gene sequence to obtain the miR173_ts-CENH3 fragment, and finally the miR173_ts-CENH3 fragment and the RPS5a promoter are cloned into the linearized pSSRpRPS10B::miR173 vector through the Gibson homologous recombination method, and the expression of miR173_ts-CENH3 is driven by the RPS5a promoter to obtain the pRPS5a::MIGS vector;

[0047] The RPS10B promoter sequence is shown in SEQ ID NO.1;

[0048] The miR173 element sequence is shown in SEQ ID NO.2;

[0049] The Nos terminator sequence is shown in SEQ ID NO.3;

[0050] The miR173_ts element sequence is as shown in SEQ ID NO.4;

[0051] The CENH3 gene sequence is as shown in SEQ ID NO.5;

[0052] The RPS5a promoter uses the 1760 bp base before the start codon ATG of the RPS5a gene as the RPS5a promoter, and the sequence is as shown in SEQ ID NO.6.

[0053] The construction method specifically includes the following steps:

[0054] 1. Obtain the pRPS10B promoter, miR173, and Nos terminator fragments

[0055] The primers for amplifying the RPS10B promoter are:

[0056] pSSR_pRPS10B-F:

[0057] TCTGCAAGCGAAAGTACTTAGATTGCGATGAGATTGAAGAAGGA;

[0058] pSSR_pRPS10B-R:

[0059] AACAATTGGTCCCACTAGTGACGTCGTCTGGGGAGGATGGAACCT.

[0060] The primers for amplifying miR173 are:

[0061] miR173-F: AATGTTTGAACGATCCAAGCTCTTTCGCTTACACAGA; miR173-R:

[0062] TCCTTCTTCAATCTCATCGCAATCTAAGTACTTTCGCTTGCAGA. The primers for amplifying the Nos terminator are:

[0063] pRPS10Ba-miR173-Nos-F:

[0064] CCACCGCGGTGGCGGCCGCTAACATAGATGACACCGCGCG; pRPS10Ba-miR173-Nos-R:

[0065] AAGCGAAAGAGCTTGGATCGTTCAAACATTTGGCAATAAA.

[0066] The PCR amplification reaction system is shown in Table 1:

[0067] Table 1 PCR amplification reaction system

[0068] Component Volume (μL) 2×PhantaMax Buffer 25 dNTP Mix (10 mM) 1 Primer-F (10 μM) 1 Primer-R (10 μM) 1 DNA 2 PhantaMax Super-Fidelity DNA Polymerase 1 <![CDATA[ddH2O]]> 19

[0069] The PCR amplification reaction procedure is shown in Table 2:

[0070] Table 2 PCR amplification reaction procedure

[0071]

[0072] Recover the RPS10B promoter, miR173, and Nos terminator fragments after PCR amplification. The recovery kit is the SanPrep column PCR product purification kit produced by Sangon Biotech Co., Ltd. The detailed steps are operated according to the kit instruction manual.

[0073] 2. Obtain pRPS10B::miR173-Nos

[0074] Mix the respective fragments obtained in step 1 together at an equal concentration of 1:1:1 as the template for fusion PCR. The amplification primers are:

[0075] pRPS10Ba-miR173-Nos-F:

[0076] CCACCGCGGTGGCGGCCGCTAACATAGATGACACCGCGCG;

[0077] pRPS10B-miR173-Nos-R:

[0078] TATCAACTACCCACTTTGATATCGTCTGGGGAGGATGGAACCT.

[0079] The amplification reaction system is the same as Table 1, and the amplification reaction procedure is the same as Table 2.

[0080] Recover the pRPS10B::miR173-Nos product fragment after fusion PCR amplification. The recovery kit is the SanPrep column PCR product purification kit produced by Sangon Biotech Co., Ltd. The detailed steps are operated according to the kit instruction manual.

[0081] 3. Linearize the pSSR100 vector

[0082] Use two restriction endonucleases, XbaI and SalI, to perform double digestion on the pSSR100 vector. The digestion system is:

[0083] Table 3 Digestion reaction system

[0084] Component Volume (μL) XbaI 1 SalI 1 10×CutSmart Buffer 10 Plasmid 1000 ng <![CDATA[ddH2O]]> Make up to 50 μL

[0085] The restriction enzyme reaction procedure is as follows: 37°C, overnight incubation, about 12 hours.

[0086] 4. Obtain the vector pSSR pRPS10B::miR173

[0087] Ligate the pRPS10B::miR173-Nos fragment obtained in step 2 with the linearized pSSR100 vector obtained in step 3 by Gibson homologous recombination method. The kit used is the Hieff Plus One StepCloning Kit one-step rapid cloning kit. The usage amounts of the vector and the insert fragment are calculated according to the instructions. The ligation reaction system is as follows:

[0088] Table 4 Ligation reaction system

[0089] Component Volume (μL) pRPS10B::miR173-Nos 1 Linearized pSSR100 2 2×HieffClone Enzyme Premix 3

[0090] The reaction conditions are: incubate at 50°C for 40 min, and the reaction time can be extended to 40 min.

[0091] Add the ligation product to the melted Escherichia coli competent cell DH5α. After ice-bathing for 30 min, heat-shock at 42°C for 90 s and then quickly place on ice for 5 min. Add 500 μL of antibiotic-free LB and resuscitate in a shaker at 37°C for 30 min, then spread on a solid medium with kanamycin resistance. After single colonies grow out, shake the bacteria with liquid LB medium containing kanamycin antibiotic. After culturing overnight in a shaker at 37°C, extract the plasmid. After obtaining a sufficient amount of plasmid, send it to a gene company for sequencing. The vector plasmid with correct sequencing is pSSR pRPS10B::miR173.

[0092] 5. Obtain the RPS5a promoter fragment and the miR173_ts-CENH3 fragment

[0093] When synthesizing the primers, miR173_ts is synthesized together with the F-terminal primer, and PCR amplification is carried out using DNA as the template. The amplification primers for the RPS5a promoter are:

[0094] RPS5a-F:

[0095] GGTTCCATCCTCCCCAGACGACGTCACTAGTGGGACCAATTGTTGTT TGAT;

[0096] RPS5a-R:

[0097] CACTTCGCTTGTAGAGAAAAATCACGGATCCGGCTGTGGTGAGAGA AACA.

[0098] The amplification primers for miR173_ts-CENH3 are as follows:

[0099] pRPS5a-CENH3-C-F:

[0100] TGTTTCTCTCACCACAGCCGGATCCGTGATTTTTCTCTACAAGCGAA GTG;

[0101] pRPS5a-CENH3-C-R:

[0102] TATCAACTACCCACTTTGATAGAGTAACACGTCTTGCATGGA.

[0103] The reaction system is the same as that in Table 1, and the reaction procedure is the same as that in Table 2.

[0104] Recover the RPS5a promoter fragment and miR173_ts-CENH3 fragment products after PCR amplification. The recovery kit is the SanPrep Column PCR Product Purification Kit produced by Sangon Biotech Co., Ltd. The detailed steps are operated according to the kit instructions.

[0105] 6. Linearize pSSR pRPS10B::miR173

[0106] Use EcoRV endonuclease to perform single enzyme digestion on pSSR pRPS10B::miR173 to linearize the vector pSSR pRPS10B::miR173. The reaction system is as follows:

[0107] Table 5 Enzyme digestion reaction system

[0108] Component Volume (μL) EcoRV 2 10×CutSmart Buffer 10 Plasmid pSSRpRPS10B::miR173 1000 ng <![CDATA[ddH2O]]> Make up to 50 μL

[0109] The enzyme digestion reaction procedure is: 37 °C, overnight incubation, about 12 hours.

[0110] 7. Obtain the pRPS5a::MIGS vector

[0111] Ligate the RPS5a fragment and miR173_ts-CENH3 fragment obtained in step 5 with the linearized pSSR pRPS10B::miR173 vector obtained in step 6 by Gibson homologous recombination method. The kit used is the Hieff Plus One Step Cloning Kit one-step rapid cloning kit produced by Yeasen Biotech Co., Ltd. The usage amounts of the vector and the inserted fragment are calculated according to the instructions. The ligation reaction system is as follows: Plus One Step Cloning Kit one-step rapid cloning kit. The usage amounts of the vector and the inserted fragment are calculated according to the instructions. The ligation reaction system is as follows:

[0112] Table 6 Ligation reaction system

[0113]

[0114]

[0115] The reaction conditions are: incubation at 50 °C for 40 min, and the reaction time can be extended to 40 min.

[0116] The ligation product was added to the thawed Escherichia coli competent cells DH5α. After ice-bathing for 30 minutes, heat shock at 42 °C for 90 s, and then quickly placed on ice for 5 min. Then, add 500 μL of antibiotic-free LB, resuscitate in a shaker at 37 °C for 30 min, and spread it on a solid medium with kanamycin resistance. After single colonies grew, shake the bacteria in liquid LB medium containing kanamycin antibiotic. Culture overnight in a shaker at 37 °C and then extract the plasmid. After obtaining a sufficient amount of plasmid, send it to a gene company for sequencing. The vector plasmid with correct sequencing is pRPS5a::MIGS. The structure of the pRPS5a::MIGS vector is as Figure 1 shown.

[0117] Example 2

[0118] This example is to create a CENH3-based haploid inducer through the MIGS system.

[0119] 1. Obtain transgenic positive seedlings

[0120] The constructed pRPS5a::MIGS vector in Example 1 was transferred into Agrobacterium tumefaciens GV3101, and the vector was transferred into wild-type Arabidopsis thaliana Col-0 by the floral dip method. Since the pSSR100 vector carries the mcherry fluorescence screening marker, under the microscope, transgenic positive seeds were selected by the fluorescence of mature seeds, and the seeds were sown to obtain T1 generation transgenic positive seedlings.

[0121] 2. Hybridization

[0122] The transgenic plants (male) were grown in a greenhouse at 22 °C. At the full-bloom stage, immature flower buds and open flowers on the transgenic plants were removed, and 1 - 3 unopened large flower buds were left. The petals and stamens of the flower buds were removed with forceps. The emasculated transgenic plants were grown in a greenhouse at 22 °C for 2 days, and then between 10 am and 4 pm, the stigmas of the transgenic plants were pollinated with the blooming flowers of Arabidopsis thaliana Ler gl1 mutant (female, diploid). After hybridization, the plants were placed in incubators at 22 °C, 25 °C, and 30 °C for temperature treatment.

[0123] 3. Statistically analyze the haploid induction efficiency

[0124] Haploid induction efficiency = number of haploid offspring / total number of offspring * 100%.

[0125] Identification method of haploid: Candidate haploids were screened out by judging the leaf phenotypes, and then the ploidy of the candidate haploid plants was further confirmed by flow cytometry analysis.

[0126] Figure 2 It is a representative phenotype photo of the offspring of a transgenic plant (male) crossed with gl1 Ler (female). From left to right are haploid, aneuploid, and diploid, and the scale bar in the figure is 4 cm. The phenotypes of haploid plants are: short plants, narrow and hairless leaves, small flowers, and sterile siliques.

[0127] The specific identification method for detecting leaf ploidy by flow cytometry is as follows: Using the leaves of gl1 diploid plants as a control, the PI (propidium iodide) signal was detected by flow cytometry. If the nuclear signal peak of the diploid control group appears around 50, and the nuclear signal peak of the candidate haploid plant appears around 25, then the plant is determined to be a haploid. Figure 3 It is the flow cytometry analysis result of diploid (gl1, left) and haploid offspring (right).

[0128] By counting the proportion of haploids in the offspring, 4 functional haploid inducers pRPS5a::MIGS created through the MIGS system were screened out, namely pRPS5a::MIGS#1, pRPS5a::MIGS#13, pRPS5a::MIGS#19, and pRPS5a::MIGS#24. The induction ability of these inducers is 0%-0.2% at 22°C, 0.2%-3.4% at 25°C, and can reach 6.1%-14.2% at 30°C (Table 7).

[0129] Table 7 Statistics of haploid induction efficiency of haploid inducer pRPS5a::MIGS

[0130]

[0131] 4. Pollen viability detection

[0132] Use forceps to take out the anthers of transgenic plants from mature flower buds and place them on a glass slide. Drop 50 μL of Alexander Stain solution (Solarbio, G3050) on the glass slide, immerse the anthers in the staining solution, and cover with a coverslip. Place the slide in a 4°C refrigerator and incubate overnight in the dark. Use a stereomicroscope (Olympus, SZX16) for image acquisition. Figure 4 It is the pollen viability detection result of transgenic plant pRPS5a::MIGS and Arabidopsis wild-type Col.

[0133] 5. Plant growth phenotype collection: Place the transgenic plants under the same conditions for growth. During the full-bloom stage, use a single-lens reflex camera to collect their phenotypes, and determine whether there are growth defects in the plants by observing the leaf, silique, and flower sizes of the plants. Figure 5 Phenotypes of transgenic plant pRPS5a::MIGS and Arabidopsis wild-type Col.

[0134] From the pollen viability detection and plant phenotype identification results, it can be seen that the functional haploid inducer plants (GFP-CENH3) constructed by this system have no obvious growth defects and do not affect the fertility of plants.

[0135] Example 3

[0136] This example is about optimizing the inducer system through the MIGS system.

[0137] 1. Obtain transgenic positive inducers

[0138] Transfer the constructed pRPS5a::MIGS vector in Example 1 into Agrobacterium tumefaciens GV3101, and use the floral dip method to transfer the vector into the Arabidopsis haploid inducer GFP-CENH3. Since the pSSR100 vector carries the mcherry fluorescence screening marker, under the microscope, select the transgenic positive seeds by the fluorescence of mature seeds, and sow the seeds to obtain the T1 generation transgenic positive inducers.

[0139] 2. Hybridization

[0140] Grow the transgenic positive inducer plants in a 22°C greenhouse. During the full-bloom stage, remove the immature flower buds and open flowers on the transgenic positive inducer plants, leaving 1 - 3 unopened large flower buds. Use forceps to remove the petals and stamens of the flower buds. Grow the emasculated transgenic positive inducer plants in a 22°C greenhouse for 2 days, and then, between 10 am and 4 pm, pollinate the stigmas of the transgenic positive inducer plants with the blooming flowers of Arabidopsis Ler gl1 mutant (female, diploid). After hybridization, place the plants in incubators at 18°C and 22°C for temperature treatment.

[0141] 3. Statistically analyze the haploid induction efficiency

[0142] Haploid induction efficiency = number of haploid offspring / total number of offspring * 100%.

[0143] Screen for transgenic positive inducer plants with a high haploid ratio in the hybrid progeny, that is, an induction efficiency higher than that of the haploid inducer GFP-CENH3, and name the optimized transgenic inducer GN; pRPS5a::MIGS. Table 8 compares the haploid ratios in the progeny of crosses between four transgenic inducer lines (GN; pRPS5a::MIGS#4, GN; pRPS5a::MIGS#6, GN; pRPS5a::MIGS#13, and GN; pRPS5a::MIGS#19) and the haploid inducer GFP-CENH3 (male) with gl1 / Ler (female). It was found that regardless of whether it was 18 °C or 22 °C, the induction efficiency of the transgenic inducer line GN; pRPS5a::MIGS was up to nearly twice as high as that of GFP-CENH3.

[0144] Table 8 Statistics of haploid induction efficiency of transgenic inducer line GN; pRPS5a::MIGS

[0145]

[0146] 4. Pollen viability detection

[0147] Use forceps to take out the anthers of the transgenic inducer plants from the mature flower buds and place them on a glass slide. Drop 50 μL of Alexander Stain solution (Solarbio, G3050) on the glass slide, immerse the anthers in the staining solution, and cover with a coverslip. Place the slide in a 4 °C refrigerator and incubate overnight in the dark. Take pictures with a stereomicroscope (Olympus, SZX16). Figure 6 Results of pollen viability detection for transgenic inducer plants GN; pRPS5a::MIGS and Arabidopsis haploid inducer GFP-CENH3.

[0148] 5. Collection of plant growth phenotypes

[0149] Grow the transgenic inducer plants under the same conditions, and collect their phenotypes with a single-lens reflex camera during the full-bloom period. Judge whether there are growth defects in the plants by observing the leaves, siliques, and flower sizes of the plants. Figure 7 Phenotypes of transgenic inducer plants GN; pRPS5a::MIGS and Arabidopsis haploid inducer GFP-CENH3.

[0150] From the results of pollen viability detection and plant phenotype identification, it can be seen that the transgenic inducer plants (GN; pRPS5a::MIGS) optimized by this system have no obvious growth defects and do not affect the fertility of plants.

[0151] The present invention can construct a haploid inducer that has no growth defect and can effectively obtain haploids by using the MIGS system driven by the RPS5a promoter to inhibit the expression of the CENH3 gene. Transferring this MIGS system into existing inducers can also optimize their induction efficiency without causing growth defects in the inducers. This method can be used to create haploid inducers in various species and can also be used to optimize inducers in various species.

[0152] The method for inhibiting gene expression in the present invention is not only the MIGS gene silencing technology, but also a series of reported technologies that can reduce the expression level of target genes in vivo, such as RNAi, VIGS (virus-induced gene silence), amiRNA (artificial RNA), CRISPR / Cas13, CRISPR interference, etc.; haploid inducers can also be created by inhibiting other inducer genes, such as the reported inducer genes KNL2, MTL, PLD3, PLA, DMP, etc.; the promoter used can be the Arabidopsis RPS5a promoter or other promoters with an expression pattern similar to that of RPS5a but with a higher expression level than RPS5a; the present invention can also optimize haploid inducers generated by any technical means to manipulate CENH3, such as cenh3-1, cenh3-8, GFP-tailswap, etc. The examples of the present invention only demonstrate the construction and optimization of haploid inducers in Arabidopsis wild-type plants, and this method can also be used for any monocotyledonous and dicotyledonous plants.

[0153] As described above, it is only a preferred embodiment of the present invention and does not impose any limitation on the present invention. Any simple modification, change, and equivalent change made to the above embodiments according to the technical essence of the invention still fall within the protection scope of the technical solution of the present invention.

Claims

1. A method for constructing a haploid inducer based on the MIGS system, characterized in that Comprising the following steps: S1. Construct the pRPS5a::MIGS vector Fuse the pRPS10B promoter with the miR173 element and the Nos terminator to obtain the pRPS10B::miR173-Nos fragment. Then insert the pRPS10B::miR173-Nos fragment into the linearized pSSR100 vector by Gibson homologous recombination to form the pSSR pRPS10B::miR173 vector. Subsequently, fuse the miR173_ts element with the 0-337bp of the CENH3 gene sequence to obtain the miR173_ts-CENH3 fragment. Finally, clone the miR173_ts-CENH3 fragment and the RPS5a promoter into the linearized pSSR pRPS10B::miR173 vector by Gibson homologous recombination, and drive the expression of miR173_ts-CENH3 through the RPS5a promoter to obtain the pRPS5a::MIGS vector; The sequence of the RPS10B promoter is as shown in SEQ ID NO.1; The sequence of the miR173 element is as shown in SEQ ID NO.2; The sequence of the Nos terminator is as shown in SEQ ID NO.3; The sequence of the miR173_ts element is as shown in SEQ ID NO.4; The sequence of the CENH3 gene is as shown in SEQ ID NO.5; The RPS5a promoter uses the 1760bp base before the start codon ATG of the RPS5a gene as the RPS5a promoter, and the sequence is as shown in SEQ ID NO.6; S2. Create a haploid inducer Transfer the pRPS5a::MIGS vector obtained in S1 into Agrobacterium tumefaciens GV3101, and then transform the wild-type plants by the floral dip method, and screen out the transgenic positive plants. Then emasculate and hybridize the obtained transgenic positive plants at the full flowering stage to obtain hybrid progeny seedlings, count the haploid ratio in the hybrid progeny, and screen out the plants with induction ability to obtain the MIGS-based haploid inducer pRPS5a::MIGS.

2. The method according to claim 1, characterized in that, The method for identifying the haploid in S2: Screen out candidate haploids through the plant leaf phenotype, and then further confirm the ploidy of the candidate haploid plants by flow cytometry analysis.

3. Use of the method for constructing a haploid inducer based on the MIGS system according to any one of claims 1 to 2, characterized in that, It can be used to construct haploid inducers for any monocotyledonous and dicotyledonous plants, endow wild-type plants with induction ability, and do not cause growth defects in plants.

4. A method for optimizing a haploid inducer with low induction efficiency based on the MIGS system, characterized in that, Comprising the following steps: S1. Construct the pRPS5a::MIGS vector The pRPS10B promoter was fused with the miR173 element and the Nos terminator to obtain the pRPS10B::miR173-Nos fragment. Then, the pRPS10B::miR173-Nos fragment was inserted into the linearized pSSR100 vector by Gibson homologous recombination to form the pSSR pRPS10B::miR173 vector. Subsequently, the miR173_ts element was fused with the 0-337bp of the CENH3 gene sequence to obtain the miR173_ts-CENH3 fragment. Finally, the miR173_ts-CENH3 fragment and the RPS5a promoter were cloned into the linearized pSSR pRPS10B::miR173 vector by Gibson homologous recombination. The expression of miR173_ts-CENH3 was driven by the RPS5a promoter to obtain the pRPS5a::MIGS vector. The RPS10B promoter sequence is shown in SEQ ID NO.1; The miR173 element sequence is shown in SEQ ID NO.2; The Nos terminator sequence is shown in SEQ ID NO.3; The miR173_ts element sequence is shown in SEQ ID NO.4; The CENH3 gene sequence is shown in SEQ ID NO.5; The RPS5a promoter uses the 1760bp base before the start codon ATG of the RPS5a gene as the RPS5a promoter, and the sequence is shown in SEQ ID NO.6; S2. Optimize the haploid inducer with low induction efficiency The pRPS5a::MIGS vector obtained in S1 was transferred into Agrobacterium tumefaciens GV3101, and the existing haploid inducer with low induction efficiency, GFP-CENH3, was transformed by the floral dip method to screen for transgenic positive inducer plants. Then, the obtained transgenic positive inducer plants were emasculated and hybridized at the full flowering stage to obtain hybrid progeny seedlings. The haploid ratio in the hybrid progeny was counted, and the transgenic inducer with an induction efficiency higher than that of the haploid inducer GFP-CENH3 was screened, which is the optimized transgenic inducer GN; pRPS5a::MIGS.

5. Use of the method for optimizing a low induction efficiency haploid inducer based on the MIGS system according to claim 4, characterized in that, It can be used to optimize the existing haploid inducers of any monocotyledonous and dicotyledonous plants, improve the induction efficiency of the haploid inducer, and do not cause growth defects in plants.

Images