Efficient salvia miltiorrhiza single base editing system and application thereof

By constructing a single-base editing system for Salvia miltiorrhiza, optimizing the promoter expression of sgRNA and editors, efficient single-base editing in Salvia miltiorrhiza is achieved, expanding the editing window, and increasing the content of tanshinone and danphenolic acid.

CN120290624AActive Publication Date: 2025-07-11INSTITUTE OF CHINESE MATERIA MEDICA CHINA ACADEMY OF CHINESE MEDICAL SCIENCES
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202510482384.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-17
Publication Date
2025-07-11
Estimated Expiration
2045-04-17

AI Technical Summary

Technical Problem

The base editing efficiency of Salvia miltiorrhiza in the prior art is not high, and it is difficult to achieve accurate modification of single bases.

Method used

A single-base editing system for Salvia miltiorrhiza is constructed, including 35SEN complex promoter, sgRNA, SmRPS5A promoter and fusion protein. The fusion protein is SmABE8e or SmAKBE. By optimizing the promoter expression of sgRNA and editor, the editing efficiency is improved.

Benefits of technology

It realizes efficient single-base editing, with the editing efficiency up to 100.0%, expands the editing window to 3 to 11 positions, and realizes the base conversion of A:T-to-T:A and A:T-to-C:G, which significantly increases the content of tanshinone and danphenol acid in Salvia miltiorrhiza.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290624A_ABST
    Figure CN120290624A_ABST
Patent Text Reader

Abstract

The invention relates to an efficient salvia miltiorrhiza single base editing system and application thereof, and belongs to the technical field of base editing. The invention provides a salvia miltiorrhiza single base editing system. The salvia miltiorrhiza single base editing system comprises a 35SEN composite promoter, sgRNA, a SmRPS5A promoter and a fusion protein, the fusion protein is a SmABE8e fusion protein or an SmAKBE fusion protein. According to the invention, efficient salvia miltiorrhiza single base editing systems SmABE8e-03 and SmAKBE-03 are successfully constructed, and bases of salvia miltiorrhiza can be edited; in addition, the salvia miltiorrhiza single base editing system can edit termination codons of 5 'UTR and SmKSL2 proteins of the SmMYB1 gene, and the content of tanshinone and salvianolic acid in salvia miltiorrhiza can be increased under the condition that growth traits of the salvia miltiorrhiza are not affected by destroying uATG, ORF and protein structures.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of base editing, and particularly relates to an efficient Salvia miltiorrhiza single-base editing system and its application. Background Art

[0002] Salvia miltiorrhiza is an important traditional Chinese medicine for treating coronary heart disease, inflammatory reactions and tumors. By adjusting the nucleotide sequence of Salvia miltiorrhiza, the content of active ingredients in Salvia miltiorrhiza can be increased. Although the CRISPR / Cas-mediated gene knockout technology has achieved random deletion or insertion of small fragments in Salvia miltiorrhiza, the gene knockout technology deletes or inserts genes and cannot achieve precise modification of single bases. The single-base editing technology can achieve base editing and mutation of single base pairs, which is more precise. At present, the single-base editing technology is less applied in Salvia miltiorrhiza and the editing efficiency is not high.

[0003] Based on this, the present invention is proposed. Summary of the Invention

[0004] The purpose of the present invention is to provide an efficient Salvia miltiorrhiza single-base editing system and its application to solve the problem of low base editing efficiency of Salvia miltiorrhiza in the prior art.

[0005] In order to achieve the above invention purpose, the present invention provides the following technical solutions:

[0006] The present invention provides a Salvia miltiorrhiza single-base editing system, which includes a 35SEN composite promoter, sgRNA, a SmRPS5A promoter and a fusion protein;

[0007] The fusion protein is a SmABE8e fusion protein or a SmAKBE fusion protein;

[0008] The nucleotide sequence encoding the SmABE8e fusion protein is as shown in SEQ ID NO.1;

[0009] The nucleotide sequence encoding the SmAKBE fusion protein is as shown in SEQ ID NO.2.

[0010] Preferably, the SmABE8e fusion protein includes an adenine deaminase TadA8e and an nCas9 protein;

[0011] The nucleotide sequence of the adenine deaminase TadA8e is as shown in SEQ ID NO.3;

[0012] The nucleotide sequence of the nCas9 protein is as shown in SEQ ID NO.4.

[0013] Preferably, the SmAKBE fusion protein comprises adenine deaminase TadA8e, nCas9 protein, N-methylpurine DNA glycosylase, Salvia miltiorrhiza TLS polymerase η, and hygromycin phosphotransferase II;

[0014] The nucleotide sequence of the adenine deaminase TadA8e is as shown in SEQ ID NO.3;

[0015] The nucleotide sequence of the nCas9 protein is as shown in SEQ ID NO.4;

[0016] The nucleotide sequence of the N-methylpurine DNA glycosylase is as shown in SEQ ID NO.5;

[0017] The nucleotide sequence of the Salvia miltiorrhiza TLS polymerase η is as shown in SEQ ID NO.6;

[0018] The nucleotide sequence of the hygromycin phosphotransferase II is as shown in SEQ ID NO.7.

[0019] Preferably, the nucleotide sequence of the 35SEN composite promoter is as shown in SEQ ID NO.8.

[0020] Preferably, the 35SEN composite promoter comprises a CaMV 35S enhancer, a CmYLCV promoter, and an AtU6-26 promoter;

[0021] The nucleotide sequence of the CaMV 35S enhancer is as shown in SEQ ID NO.9;

[0022] The nucleotide sequence of the CmYLCV promoter is as shown in SEQ ID NO.10;

[0023] The nucleotide sequence of the AtU6-26 promoter is as shown in SEQ ID NO.11.

[0024] Preferably, the nucleotide sequence of the SmRPS5A promoter is as shown in SEQ ID NO.12.

[0025] Preferably, the sgRNA targets the Salvia miltiorrhiza SmMYB1 gene, SmHMGR1 gene, or SmKSL2 gene.

[0026] Preferably, the nucleotide sequence of the sgRNA targeting the Salvia miltiorrhiza SmMYB1 gene is as shown in SEQ ID NO.13;

[0027] The nucleotide sequence of the sgRNA targeting the Salvia miltiorrhiza SmHMGR1 gene is as shown in SEQ ID NO.14;

[0028] The nucleotide sequence of the sgRNA targeting the Salvia miltiorrhiza SmKSL2 gene is as shown in SEQ ID NO. 15.

[0029] The present invention provides the application of the above-mentioned Salvia miltiorrhiza single-base editing system in base editing of Salvia miltiorrhiza.

[0030] The present invention provides the application of the above-mentioned Salvia miltiorrhiza single-base editing system in cultivating high-quality Salvia miltiorrhiza plants.

[0031] The present invention has the following technical effects and advantages:

[0032] The present invention successfully constructed efficient Salvia miltiorrhiza single-base editing systems SmABE8e-03 and SmAKBE-03. Among them, the Salvia miltiorrhiza single-base editing system SmABE8e-03 can achieve a maximum editing efficiency of 100.0%, and can achieve simultaneous editing of multiple sites; the Salvia miltiorrhiza single-base editing system SmAKBE-03 expands the editing window of ABE to positions 3-11, and realizes the base conversions of A:T-to-T:A and A:T-to-C:G, enabling us to achieve different forms of base editing in Salvia miltiorrhiza.

[0033] The present invention respectively edits the 5' UTR of SmMYB1 and the stop codon of SmKSL2 through the Salvia miltiorrhiza single-base editing systems SmABE8e-03 and SmAKBE-03, and improves the contents of tanshinones and salvianolic acids by destroying uATG, ORF and protein structures respectively. Brief Description of the Drawings

[0034] Figure 1 It is the structural diagram of the Salvia miltiorrhiza single-base editing system SmABE8e-01 editing system;

[0035] Figure 2 It is the structural diagram of the Salvia miltiorrhiza single-base editing system SmABE8e-02 editing system;

[0036] Figure 3 It is the structural diagram of the Salvia miltiorrhiza single-base editing system SmABE8e-03 editing system;

[0037] Figure 4 It is the editing efficiency of the sgRNAs of the Salvia miltiorrhiza single-base editing systems SmABE8e-01 / 02 / 03 targeting the SmMYB1, SmKSL2, and SmHMGR1 genes;

[0038] Figure 5 It is the base substitution efficiency at different positions of the Salvia miltiorrhiza single-base editing system SmABE8e-03;

[0039] Figure 6 It is the result of base editing of Salvia miltiorrhiza plants by the Salvia miltiorrhiza single-base editing system SmABE8e-03;

[0040] Figure 7 Transcription levels of SmMYB1 in plants #1 and #18 of the T0 generation edited lines;

[0041] Figure 8 Contents of related metabolites in base-edited Salvia miltiorrhiza plants and wild-type Salvia miltiorrhiza plants;

[0042] Figure 9 Phenotypes of wild-type Salvia miltiorrhiza plants and plant #1 of the T0 generation edited lines;

[0043] Figure 10 Structure diagram of the Salvia miltiorrhiza base editing system SmABE8e-03-Dual;

[0044] Figure 11 Editing efficiencies of sgRNAs targeting SmKSL2, SmHMGR1, and SmKSL2+SmHMGR1 genes in the Salvia miltiorrhiza base editing system SmABE8e-03-Dual;

[0045] Figure 12 Structure diagram of the Salvia miltiorrhiza single base editing system SmAKBE-03;

[0046] Figure 13 Editing efficiencies of sgRNAs targeting SmMYB1 and SmKSL2 genes respectively in the Salvia miltiorrhiza single base editing system SmAKBE-03;

[0047] Figure 14 Base substitution efficiencies at different positions in the Salvia miltiorrhiza single base editing system SmAKBE-03;

[0048] Figure 15 Results of base editing of Salvia miltiorrhiza plants using the Salvia miltiorrhiza single base editing system SmAKBE-03 targeting the SmKSL2 gene;

[0049] Figure 16 Transcription levels of SmKSL2 in plants #9 and #35 of the T0 generation edited lines;

[0050] Figure 17 Contents of related metabolites in base-edited Salvia miltiorrhiza plants and wild-type Salvia miltiorrhiza plants;

[0051] Figure 18 Phenotypes of wild-type Salvia miltiorrhiza plants and plant #1 of the T0 generation edited lines. Specific implementation manners

[0052] The present invention provides a Salvia miltiorrhiza single base editing system, which includes a 35SEN composite promoter, sgRNA, SmRPS5A promoter, and a fusion protein;

[0053] The fusion protein is SmABE8e fusion protein or SmAKBE fusion protein;

[0054] The nucleotide sequence encoding SmABE8e fusion protein is shown as SEQ ID NO.1;

[0055]

[0056] The nucleotide sequence encoding the SmAKBE fusion protein is shown in SEQ ID NO.2;

[0057]

[0058] In the present invention, the SmABE8e fusion protein comprises an adenine deaminase TadA8e and an nCas9 protein;

[0059] Preferably, the SmABE8e fusion protein is composed of a nuclear localization sequence NLS-1, an adenine deaminase TadA8e(V106W), a Linker-1 sequence, an nCas9(D10A), and a nuclear localization sequence NLS-2 linked in sequence;

[0060] The nucleotide sequence of the nuclear localization sequence NLS-1 is as shown in SEQ ID NO.19;

[0061] The nucleotide sequence of SEQ ID NO.19 is: ATGAAACGGACAGCCGACGGAAGCGAGTTCGAGTCACCAAAGAAGAAGCGGAAAGTC;

[0062] The nucleotide sequence of the adenine deaminase TadA8e(V106W) is as shown in SEQ ID NO.3;

[0063] The nucleotide sequence of SEQ ID NO.3 is: TCTGAGGTGGAGTTCAGCCACGAGTACTGGATGAGGCACGCCCTGACCCTGGCAAAGCGGGCCAGAGACGAGAGAGAGGTGCCCGTGGGAGCCGTGCTGGTGCTGAACAATAGAGTGATCGGCGAGGGCTGGAACAGAGCCATCGGCCTGCACGACCCTACAGCACACGCAGAGATCATGGCACTGAGGCAGGGAGGCCTGGTCATGCAGAATTACCGCCTGATCGATGCCACCCTGTATGTGACATTCGAGCCATGCGTGATGTGCGCAGGAGCAATGATCCACAGCAGGATCGGCCGCGTGGTGTTTGGATGGAGGAACTCCAAGAGGGGAGCAGCAGGCTCTCTGATGAACGTGCTGAATTACCCAGGCATGAATCACCGGGTGGAGATCACCGAGGGCATCCTGGCAGACGAGTGCGCCGCCCTGCTGTGCGATTTCTATCGGATGCCCAGACAGGTGTTTAACGCCCAGAAGAAGGCCCAGAGCAGCATCAAC;

[0064] The nucleotide sequence of the Linker-1 sequence is shown as SEQ ID NO.20;

[0065] The nucleotide sequence of SEQ ID NO.20 is: TCCGGAGGATCTAGCGGAGGCTCCTCTGGCTCTGAGACACCTGGCACAAGCGAGAGCGCAACA CCTGAAAGCAGCGGGGGCAGCAGCGGGGGATCC;

[0066] The nucleotide sequence of the nCas9(D10A) protein is shown as SEQ ID NO.4;

[0067]

[0068] The nucleotide sequence of the nuclear localization sequence NLS-2 is shown in SEQ ID NO.21;

[0069] The nucleotide sequence of SEQ ID NO.21 is: AAAAAGAACCGCCGACGGCAGCGAATTCGAGCCCAAGAAGAAGAGGAAAGTC.

[0070] In the present invention, the SmAKBE fusion protein includes adenine deaminase TadA8e, nCas9 protein, N-methylpurine DNA glycosylase, Salvia miltiorrhiza TLS polymerase η, and hygromycin phosphotransferase II;

[0071] Preferably, the SmAKBE fusion protein is composed of a nuclear localization sequence NLS-1, TadA8e(V106W), Linker-1 sequence, nCas9(D10A), nuclear localization sequence NLS-2, Linker-2 sequence, N-methylpurine DNA glycosylase, nuclear localization sequence biNLS, Salvia miltiorrhiza TLS polymerase η, and hygromycin phosphotransferase II connected in sequence;

[0072] The nucleotide sequence of the nuclear localization sequence NLS-1 is shown in SEQ ID NO.19;

[0073] The nucleotide sequence of the adenine deaminase TadA8e(V106W) is shown in SEQ ID NO.3;

[0074] The nucleotide sequence of the Linker-1 sequence is shown in SEQ ID NO.20;

[0075] The nucleotide sequence of the nCas9(D10A) protein is shown in SEQ ID NO.4;

[0076] The nucleotide sequence of the nuclear localization sequence NLS-2 is shown in SEQ ID NO.21;

[0077] The nucleotide sequence of the Linker-2 sequence is shown in SEQ ID NO.22;

[0078] The nucleotide sequence of SEQ ID NO.22 is: TCAGGGGGAAGTGGTGGTTCTGGTGGATCG;

[0079] The nucleotide sequence of the N-methylpurine DNA glycosylase is shown in SEQ ID NO.5;

[0080] The nucleotide sequence of SEQ ID NO.5 is: GTGACCCCAGCTCTCCAGATGAAGAAGCCGAAGCAATTCTGTAGAAGGATGGGCCAGAAAAAGCAGAGGCCGGCCAGGGCTGGGCAACCTCATTCCTCGTCCGATGCGGCACAAGCCCCAGCAGAACAGCCTCATTCTTCCTCTGACGCCGCCCAAGCGCCCTGTCCACGTGAAAGATGTCTCGGACCTCCTACCACGCCAGGTCCATACCGCAGCATCTACTTTAGCTCGCCCAAGGGCCATTTGACGAGGTTGGGGCTGGAGTTCTTTGATCAACCGGCCGTTCCACTCGCAAGAGCGTTCTTGGGGCAAGTGCTGGTTAGGAGGTTGCCTAACGGAACGGAATTGCGCGGACGCATCGTTGAGACAGAGGCCTACCTGGGTCCTGAGGATGAAGCTGCGCATAGCCGGGGAGGCAGGCAAACACCTAGGAATAGAGGAATGTTCATGAAGCCAGGGACGCTGTACGTCTACATAATATACCGCATGTACTTTTGTATGTCGATCAGCAGTCAGGGCGACGGAGCGTGCGTTCTTCTTAGAGCCCTCGAGCCTCTGGAAGGCCTGGAGACGATGAGACAGCTTAGGGCCACATTGCGGGCTGCTACTGCTGCAAGGGTACTCGCGGACCGTGAACTCTGTTCTGGTCCTTCCAAGCTGTGCCAGGCATTGGCCATAAATAAGAGCTTTGACCAGAGAGACCTCGCTCAGGACGAAGCAGTTTGGCTCGAACGCGGACCCCTGGAACCAAGCGAACCAGCTGTTGTTGCAGCAGCGAGAGTTGGAGTGGGTCATGCGGGAGAATGGGCCAGGAAACCCCTGCGTTTTTATGTACGTGGGTCACCGTGGGTGTCAGTGGTTGATCGCGTCGCCGAACAGGATACTCAAGCG;

[0081] The nucleotide sequence of the nuclear localization sequence biNLS is as shown in SEQ ID NO.23;

[0082] The nucleotide sequence of SEQ ID NO.23 is: AGTGGAGGTTCGAAACGGACAGCAGACGGAAGCGAGTTTGAGCCGAAGAAGAAAAGAAAAGT G;

[0083] The nucleotide sequence of the Salvia miltiorrhiza TLS polymerase η is as shown in SEQ ID NO.6;

[0084]

[0085] The nucleotide sequence of the hygromycin phosphotransferase II is as shown in SEQ ID NO.7;

[0086]

[0087] In the present invention, the nucleotide sequence of the 35SEN composite promoter is as shown in SEQ ID NO.8;

[0088]

[0089] In the present invention, the 35SEN composite promoter includes the CaMV 35S enhancer, the CmYLCV promoter, and the AtU6-26 promoter;

[0090] The nucleotide sequence of the CaMV 35S enhancer is as shown in SEQ ID NO.9;

[0091] The nucleotide sequence of SEQ ID NO.9 is: ATGGAGTCAAAGATTCAAATAGAGGACCTAACAGAACTCGCCGTAAAGACTGGCGAACAGTTCATACAGAGTCTCTTACGACTCAATGACAAGAAGAAAATCTTCGTCAACATGGTGGAGCACGACACACTTGTCTACTCCAAAAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCAATTGAGACTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGTGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGAT;

[0092] The nucleotide sequence of the CmYLCV promoter is as shown in SEQ ID NO.10;

[0093] The nucleotide sequence of SEQ ID NO.10 is: TGGCAGACATACTGTCCCACAAATGAAGATGGAATCTGTAAAAGAAAACGCGTGAAATAATGCGTCTGACAAAGGTTAGGTCGGCTGCCTTTAATCAATACCAAAGTGGTCCCTACCACGATGGAAAAACTGTGCAGTCGGTTTGGCTTTTTCTGACGAACAAATAAGATTCGTGGCCGACAGGTGGGGGTCCACCATGTGAAGGCATCTTCAGACTCCAATAATGGAGCAATGACGTAAGGGCTTACGAAATAAGTAAGGGTAGTTTGGGAAATGTCCACTCACCCGTCAGTCTATAAATACTTAGCCCCTCCCTCATTGTTAAGGGAGCAAAATCTCAGAGAGATAGTCCTAGAGAGAGAAAGAGAGCAAGTAGCCTAGAAGTAGTCAAGGCGGCGAAGTATTCAGGCACGTGGCCAGGAAGAAGAAAAGCCAAGACGACGAAAACAGGTAAGAGCTAAGC;

[0094] The nucleotide sequence of the AtU6-26 promoter is as shown in SEQ ID NO.11;

[0095] The nucleotide sequence of SEQ ID NO.11 is: AAGTTGAAAACAATCTTCAAAAGTCCCACATCGCTTAGATAAGAAAACGAAGCTGAGTTTATATA CAGCTAGAGTCGAAGTAGTGATTG.

[0096] In the present invention, the nucleotide sequence of the SmRPS5A promoter is as shown in SEQ ID NO.12;

[0097]

[0098] In the present invention, the sgRNA targets the Salvia miltiorrhiza SmMYB1 gene, SmHMGR1 gene or SmKSL2 gene.

[0099] In the present invention, the nucleotide sequence of the sgRNA targeting the Salvia miltiorrhiza SmMYB1 gene is as shown in SEQ ID NO.13;

[0100] The nucleotide sequence of SEQ ID NO.13 is: GGTCATGGGCAAAGTGTGTGTGG;

[0101] The nucleotide sequence of the sgRNA targeting the Salvia miltiorrhiza SmHMGR1 gene is as shown in SEQ ID NO.14;

[0102] The nucleotide sequence of SEQ ID NO.14 is: CCTCCTTCATCTATCTCCTCGG;

[0103] The nucleotide sequence of the sgRNA targeting the Salvia miltiorrhiza SmKSL2 gene is as shown in SEQ ID NO.15;

[0104] The nucleotide sequence of SEQ ID NO.15 is: CCTTCCTTGGCTTATGATTGTGA.

[0105] The present invention provides the application of the above-mentioned Salvia miltiorrhiza single-base editing system in base editing of Salvia miltiorrhiza.

[0106] The present invention provides the application of the above-mentioned Salvia miltiorrhiza single-base editing system in cultivating high-quality Salvia miltiorrhiza plants.

[0107] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0108] Example 1: Construction of the Salvia miltiorrhiza single-base editing system

[0109] 1. Construction of the Salvia miltiorrhiza single-base editing system

[0110] To explore whether single-base editing can be performed in Salvia miltiorrhiza, the Arabidopsis thaliana AtU6 (NCBI genbank number: X52528.1) and the CaMV 35S enhancer (35S) were used to drive the expression of sgRNA and the editor (fusion protein). Specifically, the nuclear localization sequence NLS-1 (SEQ ID NO.19), adenine deaminase TadA8e (V106W) (SEQ ID NO.3), Linker-1 sequence (SEQ ID NO.20), nCas9 (D10A) (SEQ ID NO.4), and nuclear localization sequence NLS-2 (SEQ ID NO.21) were linked and synthesized in sequence by Sangon Biotech (Shanghai) Co., Ltd. to obtain the SmABE8e fusion protein. The nucleotide sequence of the SmABE8e fusion protein is as shown in SEQ ID NO.1. Then, the Arabidopsis thaliana AtU6 promoter, sgRNA, 35S promoter, and SmABE8e fusion protein were combined and recombined onto the backbone vector pCambia1300 (Addgene global plasmid sharing platform) through enzymatic digestion ligation and seamless cloning to obtain the Salvia miltiorrhiza single-base editing system, named SmABE8e-01. The structure of the SmABE8e-01 editing system is as Figure 1 shown, and the nucleotide sequence of the 35S promoter is shown in Table 1.

[0111] Table 1 Nucleotide sequences of the Arabidopsis thaliana AtU6 promoter and 35S promoter

[0112] Name Nucleotide sequence CaMV35S enhancer (35S) SEQ ID NO.9

[0113] 2. Verification of the Salvia miltiorrhiza single-base editing system

[0114] To verify whether the Salvia miltiorrhiza single-base editing system can achieve single-base editing of Salvia miltiorrhiza, sgRNA1 targeting 5 genes, namely SmMYB1, SmPAL, SmKSL2, SmHMGR1, and SmCPS2, was designed, and the results are shown in Table 2.

[0115] Table 2 sgRNAs targeting different genes

[0116] Gene name sgRNA sequence SmMYB1 GGTCATGGGCAAAGTGTGTGTGG (SEQ ID NO.13) SmPAL CCTCCTTCATCTATCTCCTCGG (SEQ ID NO.16) SmKSL2 CCTTCCTTGGCTTATGATTGTGA (SEQ ID NO.15) SmHMGR1 CGTCGATGAGATCCAATCAACGG (SEQ ID NO.14) SmCPS2 CCAAGGCCTGCCCTATGATCATC (SEQ ID NO.17)

[0117] Agrobacterium-mediated transformation of Salvia miltiorrhiza plants was used for verification, and the specific method is as follows:

[0118] 1. sgRNA sequences targeting different genes were separately added to the SmABE8e-01 editing system to obtain SmABE8e-01 editing systems targeting different genes. The SmABE8e-01 editing system includes the Arabidopsis thaliana AtU6 promoter (NCBI genbank number: X52528.1), the CaMV 35S enhancer, the sgRNA, and the SmABE8e fusion protein. The nucleotide sequence of the CaMV 35S enhancer is as shown in SEQ ID NO.9, and the nucleotide sequence of the SmABE8e fusion protein is as shown in SEQ ID NO.1. The SmABE8e fusion protein includes the adenine deaminase TadA8e (nucleotide sequence is SEQ ID NO.3) and the nCas9 protein (nucleotide sequence is SEQ ID NO.4). The SmABE8e-01 editing systems targeting different genes were transformed into Agrobacterium tumefaciens GV3101;

[0119] 2. Well-grown Salvia miltiorrhiza seedlings that had grown for 3 weeks in tissue culture flasks were selected. Their apical leaves were cut in a laminar flow hood and placed in a 10 mL liquid MS petri dish (purchased from PhytoTech Labs, catalog number M519). First, the leaf edges were cut off, and then they were trimmed into 1 cm 2 squares; The cut leaves were placed into a GV3101 bacterial solution with an OD600 value of 0.4 (cultured in YEB liquid medium containing Rif), sealed, and placed on a shaker at 28 °C and 160 rpm for 15 min; The leaves were taken out in the laminar flow hood and placed on absorbent paper to dry the bacterial solution; The leaves were clamped into a petri dish with solid MS medium (purchased from PhytoTechnology company, M519 Murashige & Skoog Basal Medium with Vitamins), with the abaxial side facing up, and sealed; They were placed in a constant temperature culture room for dark culture for 36 h; The leaves after dark culture were transferred to a 100 mL conical flask and rinsed 6 times with sterile water until the liquid was clear; Then the leaves were transferred to sterile absorbent paper (four layers at the bottom and three layers on top) to dry the moisture; Finally, they were transferred to a 1 / 2MS differentiation medium containing 25 μg / mL Rif and 400 μg / mL Cef (Cef was balanced with Agrobacterium to prevent the large-scale propagation of Agrobacterium, purchased from Sangon Biotech (Shanghai) Co., Ltd., product number: A601276-0025) (the same as the MS medium, with MS used at half the amount). After culturing for 15 d, callus grew from the wound edges of the leaves; Then they were transferred to an MS differentiation medium containing 5 μg / mL Hyg and 400 μg / mL Cef for screening culture; The concentration of Cef was gradually decreased to obtain hygromycin-positive T0 Salvia miltiorrhiza plants.

[0120] 3. Design primer pairs targeting different sgRNA sequences, perform PCR amplification on the sgRNA sequences of T0 Salvia miltiorrhiza plants, and then conduct Sanger sequencing on the amplification products to determine whether base editing events have occurred in T0 Salvia miltiorrhiza plants. The results are shown in Table 3.

[0121] Table 3 Editing results of different gene SmABE8e-01 editing systems

[0122]

[0123]

[0124] As can be seen from Table 3, a total of 397 hygromycin-positive T0 Salvia miltiorrhiza plants were obtained by Agrobacterium-mediated transformation of Salvia miltiorrhiza. Among them, there were 120 plants with the SmMYB1 gene, 20 plants with the SmPAL gene, 87 plants with the SmKSL2 gene, 120 plants with the SmHMGR1 gene, and 120 plants with the SmCPS2 gene. Sanger sequencing of T0 Salvia miltiorrhiza plants showed that among the 397 transgenic plants at 5 targets of the SmABE8e-01 editing system, only the A5 site of the sgRNA of the SmMYB1 gene showed a low degree of A-to-G editing, and the editing efficiency was 22 / 120 (18.3%). The low editing efficiency may be related to the relatively complex genome of Salvia miltiorrhiza itself.

[0125] In summary, it is known that the single-base editing system SmABE8e-01 of Salvia miltiorrhiza achieved single-base editing of the sgRNA sequence of the SmMYB1 gene of Salvia miltiorrhiza, but the editing efficiency was low.

[0126] Example 2: Optimization of the single-base editing system of Salvia miltiorrhiza

[0127] Studies have shown that the expression levels of sgRNA and editors are bottlenecks restricting editing efficiency. To develop a more efficient A-to-G editor, in this application, the promoters regulating sgRNA and editors were optimized respectively. The expression of sgRNA and the fusion protein was regulated by SmU6, the composite promoter 35SEN (composed of the CaMV 35S enhancer, the CmYLCV promoter, and the truncated AtU6-26 promoter), and the SmRPS5A promoter. SmU6, the composite promoter 35SEN, and the SmRPS5A promoter were combined and bound to the sgRNA and the SmABE8e fusion protein prepared in Example 1. Through digestion-ligation and seamless cloning methods, they were recombined onto the backbone vector pCambia1300 (Addgene's global plasmid sharing platform) to obtain the Salvia miltiorrhiza single-base editing system. The Salvia miltiorrhiza single-base editing system SmABE8e-02 composed of the combination of the SmU6 and SmRPS5A promoters and the Salvia miltiorrhiza single-base editing system SmABE8e-03 composed of the combination of the composite promoter 35SEN and the SmRPS5A promoter were obtained. The structure of the Salvia miltiorrhiza single-base editing system SmABE8e-02 is as shown in Figure 2 shown, and the structure of the Salvia miltiorrhiza single-base editing system SmABE8e-03 is as shown in Figure 3 shown;

[0128] The nucleotide sequence of the SmU6 promoter is: AAGTTGAAAACAATCTTCAAAAGTCCCACATCGCTTAGATAAGAAAACGAAGCTGAGTTTATATA CAGCTAGAGTCGAAGTAGTGATT (SEQ ID NO.18);

[0129] The nucleotide sequence of the composite promoter 35SEN is as shown in SEQ ID NO.8.

[0130] Among them, the nucleotide sequence of the CaMV 35S enhancer is as shown in SEQ ID NO.9;

[0131] The nucleotide sequence of the CmYLCV promoter is as shown in SEQ ID NO.10;

[0132] The nucleotide sequence of the AtU6-26 promoter is as shown in SEQ ID NO.11.

[0133] The nucleotide sequence of the SmRPS5A promoter is as shown in SEQ ID NO.12.

[0134] The sgRNA sequences targeting the SmMYB1, SmKSL2, and SmHMGR1 genes in Example 1 were added to the SmABE8e-02 and SmABE8e-03 base editing systems to obtain the Salvia miltiorrhiza single-base editing system SmABE8e-02 targeting different genes and the Salvia miltiorrhiza single-base editing system SmABE8e-03. Then, the method of Agrobacterium-mediated transformation of Salvia miltiorrhiza plants in Example 1 was used for verification. The results are shown in Table 4. Then, the editing efficiencies of the sgRNAs of the Salvia miltiorrhiza single-base editing systems SmABE8e-01 / 02 / 03 targeting the SmMYB1, SmKSL2, and SmHMGR1 genes were statistically analyzed. The results are as Figure 4 shown.

[0135] Table 4 Editing results of the Salvia miltiorrhiza single-base editing systems SmABE8e-02 and SmABE8e-03 for different genes

[0136]

[0137]

[0138] According to Table 4 and Figure 4 it can be seen that when using Agrobacterium to transform Salvia miltiorrhiza, the Salvia miltiorrhiza single-base editing system SmABE8e-02 obtained 162 hygromycin-positive Salvia miltiorrhiza T0 plants, and the Salvia miltiorrhiza single-base editing system SmABE8e-03 obtained 95 hygromycin-positive Salvia miltiorrhiza T0 plants. By comparing with the Salvia miltiorrhiza single-base editing system SmABE8e-01, the editing efficiencies of the Salvia miltiorrhiza single-base editing systems SmABE8e-02 and SmABE8e-03 have both increased to a certain extent. Among them, the Salvia miltiorrhiza single-base editing system SmABE8e-03 has a higher A:T-to-G:C base substitution efficiency and T0 generation editing efficiency, and even homozygous editing occurred at three sites. For the sgRNA fragments targeting the SmMYB1, SmKSL2, and SmHMGR1 genes, the base editing efficiencies of the Salvia miltiorrhiza single-base editing system SmABE8e-02 were 36.6%, 22.5%, and 26.3% respectively, and the base editing efficiencies of the Salvia miltiorrhiza single-base editing system SmABE8e-03 were 100%, 58.3%, and 81.0% respectively, indicating that the Salvia miltiorrhiza single-base editing system SmABE8e-03 has a higher editing efficiency.

[0139] The base substitution efficiencies at different positions of the Salvia miltiorrhiza single-base editing system SmABE8e-03 were measured. The results are as Figure 5 shown.

[0140] According to Figure 5It can be seen that there are significant differences in the base substitution efficiency of different A sites in the Salvia miltiorrhiza single-base editing system SmABE8e-03. The editing efficiency of the Salvia miltiorrhiza single-base editing system SmABE8e-03 at the A5 position of the sgRNA fragment targeting the SmMYB1 gene reached a maximum of 100.0%. The editing efficiency at the A4 position of the sgRNA fragment targeting the SmHMGR1 gene was 58.3%, and base editing events also occurred at the A9 position. Base editing events existed at both the A5 and A6 positions of the sgRNA fragment targeting the SmKSL2 gene, but the editing efficiency at the A6 position decreased significantly, indicating that when there are two consecutive AAs, the efficiency at the second A site decreases significantly. Overall, when the editing window covers positions A4 to A9 of the protospacer, the A near position 5 shows the highest editing frequency, indicating that the Salvia miltiorrhiza single-base editing system SmABE8e-03 regulated by the combination of the composite promoter 35SEN and the SmRPS5A promoter can perform efficient A:T-G:C base substitution in Salvia miltiorrhiza.

[0141] Example 3: Base editing effect test

[0142] The periderm, phloem, and xylem of the dried roots of Salvia miltiorrhiza contain rich tanshinone and salvianolic acid compounds, which are the key to the medicinal components of Salvia miltiorrhiza. Transcription factors play an important regulatory role in their biosynthesis, and MYB transcription factors can positively regulate the synthesis of related compounds. Studies have shown that knocking out the upstream start codon (uATG) or upstream open reading frame (uORF) in plants can regulate the translation and post-translational modification of related proteins, thereby improving the protein expression stability.

[0143] The inventors found a uORF encoding 9 amino acids (MGKVCVGR*) in the 5'UTR of SmMYB1, and then designed a suitable sgRNA for the uORF, which is sgRNA1 targeting the SmMYB1 gene designed in Example 1. The uATG in the 5'UTR of the SmMYB1 gene was edited into uGTG, thereby disrupting uATG and uORF and improving the translation efficiency of pATG. The Salvia miltiorrhiza single-base editing system SmABE8e-03 targeting the SmMYB1 gene in Example 2 was used to perform base editing on Salvia miltiorrhiza plants. The method was referred to the method of Agrobacterium-mediated transformation of Salvia miltiorrhiza plants in Example 1, and wild-type Salvia miltiorrhiza plants were used as controls. The editing results are shown in Table 5 and Figure 6 as follows.

[0144] Table 5 Editing results of the uORF of the SmMYB1 gene in Salvia miltiorrhiza by the single-base editing system SmABE8e-03

[0145]

[0146] According to Table 5 and Figure 6 it can be seen that the uORF of the Salvia miltiorrhiza SmMYB1 gene was edited using the Salvia miltiorrhiza single-base editing system SmABE8e-03, and 43 hygromycin-positive Salvia miltiorrhiza T0 plants were obtained. Through genotype analysis of the T0 generation plants, it was found that mutant materials with uATG-uGTG were successfully obtained, and the editing efficiency reached 100.0%, of which 4.7% were homozygous edits.

[0147] Then, the transcriptional levels of SmMYB1 in plants #1 and #18 of the T0 generation editing lines were measured by qPCR, and the results are as Figure 7 shown.

[0148] According to Figure 7 it can be seen that there is no significant difference in the expression level between Salvia miltiorrhiza plants subjected to base editing using the Salvia miltiorrhiza single-base editing system SmABE8e-03 and wild-type Salvia miltiorrhiza plants.

[0149] The contents of related metabolites in all base-edited Salvia miltiorrhiza plants and wild-type Salvia miltiorrhiza plants were detected by ultra-high performance liquid chromatography-electrospray triple quadrupole mass spectrometry (UPLC-TQ-MS), and the results are as Figure 8 shown. By comparing the phenotypes of wild-type Salvia miltiorrhiza plants and plant #1 in the T0 generation editing lines, the results are as Figure 9 shown.

[0150] According to Figure 8 it can be seen that the contents of tanshinone compounds in base-edited Salvia miltiorrhiza plants have increased significantly. The overall contents of the four main tanshinone compounds, tanshinone I (Tan I), tanshinone IIA (Tan IIA), dihydrotanshinone I (DHT), and cryptotanshinone (CPT), have increased by 1.6, 2.5, 1.9, and 2.1 times, respectively. Among the salvianolic acid compounds, the contents of salvianolic acid A (DFSA), salvianolic acid B (DFSB), and rosmarinic acid (RA) have increased by 1.4, 1.5, and 3.3 times, respectively. According to Figure 9 it can be seen that after base editing, the increase in the content of active ingredients in Salvia miltiorrhiza plants does not affect the normal growth of Salvia miltiorrhiza plants. Collectively, it shows that the Salvia miltiorrhiza single-base editing system SmABE8e-03 has great potential in improving Salvia miltiorrhiza metabolites.

[0151] Construct a dual-target of 35SEN-gRNA-gRNA-35SEN through the sgRNA bidirectional expression cassette. Combine the 35SEN-gRNA-gRNA-35SEN dual-target with the SmABE8e fusion protein, and recombine it onto the backbone vector pCambia1300 (Addgene global plasmid sharing platform) by means of enzyme digestion ligation and seamless cloning to obtain the Salvia miltiorrhiza single-base editing system SmABE8e-03-Dual. The structural diagram of the Salvia miltiorrhiza base editing system SmABE8e-03-Dual is as shown in Figure 10 shown.

[0152] Select the sgRNA1 targeting the SmKSL2 and SmHMGR1 genes from the sgRNA1 targeting the 5 genes of SmMYB1, SmPAL, SmKSL2, SmHMGR1, and SmCPS2 designed in Example 1, and verify them by the method of Agrobacterium-mediated transformation of Salvia miltiorrhiza plants in Example 1. The results are shown in Table 6. Then, statistically analyze the editing efficiency of the sgRNAs of the Salvia miltiorrhiza base editing system SmABE8e-03-Dual targeting the SmKSL2, SmHMGR1, and SmKSL2+SmHMGR1 genes. The results are as shown in Figure 11 shown.

[0153] Table 6 Results of base editing of Salvia miltiorrhiza plants by the Salvia miltiorrhiza base editing system SmABE8e-03-Dual

[0154]

[0155] According to Table 6 and Figure 11 it can be known that when using the Salvia miltiorrhiza base editing system SmABE8e-03-Dual to perform base editing on Salvia miltiorrhiza plants, 177 hygromycin-positive Salvia miltiorrhiza T0 plants were obtained. Further analysis showed that the editing efficiency of the sgRNA1 targeting the SmKSL2 and SmHMGR1 genes decreased compared with the single-target, which were 19.2% and 3.4% respectively. However, we obtained 6 plants that simultaneously edited the sgRNA1 of the SmKSL2 and SmHMGR1 genes, and the simultaneous editing efficiency was 3.4%. This indicates the feasibility of the Salvia miltiorrhiza base editing system SmABE8e-03 for multi-target editing.

[0156] Example 4: Construction of the AKBE editing system applicable to Salvia miltiorrhiza

[0157] Studies have shown that fusing mutated human N-methylpurine DNA glycosylase (mMPG) to the C-terminus of ABE can, after adenine deamination to produce inosine (I), excise hypoxanthine (Hx) through the fused MPG to generate an apurinic / apyrimidinic (AP) site, resulting in base substitution during DNA repair, thereby generating A-T / C editing. In addition, by co-delivering translesion DNA polymerase η (TLS Polη) that preferentially incorporates opposite AP sites to A, the A-to-T editing result can be improved. The present invention also provides an AKBE editing system suitable for Salvia miltiorrhiza, which links and synthesizes nuclear localization sequence NLS-1 (SEQ ID NO.19), TadA8e (V106W) (SEQ ID NO.3), Linker-1 sequence (SEQ ID NO.20), nCas9 (D10A) (SEQ ID NO.4), nuclear localization sequence NLS-2 (SEQ ID NO.21), Linker-2 sequence (SEQ ID NO.22), N-methylpurine DNA glycosylase (SEQ ID NO.5), nuclear localization sequence biNLS (SEQ ID NO.23), Salvia miltiorrhiza TLS polymerase η (SEQ ID NO.6), hygromycin phosphotransferase II (SEQ ID NO.7) in sequence by Sangon Biotech (Shanghai) Co., Ltd. to obtain the SmAKBE fusion protein. The overall sequence of the SmAKBE fusion protein is as shown in SEQ ID NO.2. Then, the composite promoter 35SEN, SmRPS5A promoter, and SmAKBE fusion protein are recombined onto the backbone vector pCambia1300 (Addgene global plasmid sharing platform) by means of enzymatic digestion ligation and seamless cloning to obtain the Salvia miltiorrhiza base editing system, named SmAKBE-03, whose structure is as Figure 12 shown;

[0158] From the sgRNA1 targeting 5 genes, namely SmMYB1, SmPAL, SmKSL2, SmHMGR1, and SmCPS2, designed in Example 1, select the sgRNA1 targeting SmMYB1 and SmKSL2 genes to construct the Salvia miltiorrhiza base editing system SmAKBE-03 targeting SmMYB1 and SmKSL2 genes. Then, use the method of Agrobacterium-mediated transformation of Salvia miltiorrhiza plants in Example 1 for verification. The results are shown in Table 7. Then, count the editing efficiency of the sgRNA of the Salvia miltiorrhiza base editing system SmAKBE-03 targeting SmMYB1 and SmKSL2 genes. The results are as Figure 13 shown, and measure the base substitution efficiency at different positions of the Salvia miltiorrhiza base editing system SmAKBE-03. The results are as Figure 14 shown.

[0159] Table 7 Base editing results of Salvia miltiorrhiza plants by the Salvia miltiorrhiza single-base editing system SmAKBE-03 targeting SmMYB1 and SmKSL2 genes

[0160]

[0161] According to Table 7, Figure 13 and Figure 14 it can be seen that by using the Salvia miltiorrhiza base editing system SmAKBE-03 to perform base editing on Salvia miltiorrhiza plants, 39 hygromycin-positive Salvia miltiorrhiza T0 plants targeting the SmMYB1 gene were obtained, and 53 hygromycin-positive Salvia miltiorrhiza T0 plants targeting the SmKSL2 gene were obtained. Among the T0 plants targeting the SmKSL2 gene, 71.7% had A-to-G editing, and A-to-Y editing products were also produced. Among them, A-to-T and A-to-C editing accounted for 7.5% and 3.8% respectively. Base conversion mainly occurred within A3 - A11 (PAM positions were 21 - 23).

[0162] Example 5: Base editing effect test

[0163] The SmKSL1 gene encodes ent-kaurene synthase (SmKSL), which can cyclize copalyl diphosphate (CPP) into miltiradiene, and is a key gene involved in tanshinone synthesis. In addition, it can also bind to a variety of transcription factors to regulate the synthesis of other key compounds in Salvia miltiorrhiza. As a homologous gene of SmKSL1, SmKSL2 can competitively consume the precursor GGPP of CPP, resulting in the metabolic flux flowing into the non-tanshinone synthesis pathway. The purpose of the sgRNA designed to target the SmKSL2 gene in Example 1 was to introduce a base substitution at the A9 position of the SmKSL2 gene editing fragment, so that *252 (stop codon, TGA) mutated to R (CGA), thereby disrupting the normal protein structure of this gene and making it unable to function properly.

[0164] Using the Salvia miltiorrhiza single-base editing system SmAKBE-03 targeting the SmKSL2 gene in Example 4 to perform base editing on Salvia miltiorrhiza plants, the method was referred to the method of Agrobacterium tumefaciens transforming Salvia miltiorrhiza plants in Example 1, and wild-type Salvia miltiorrhiza plants were used as a control. The editing results are as Figure 15 shown.

[0165] According to Figure 15 it can be seen that base substitutions occurred in #9 and #35 in the T0 generation editing lines, so that *252 (stop codon, TGA) mutated to R (CGA), disrupting the normal protein structure of this gene.

[0166] Then, the transcription levels of SmKSL2 in plants #9 and #35 of the T0 generation editing lines were measured by qPCR, and the results are as Figure 16 shown.

[0167] According to Figure 16 it can be seen that there is no significant difference in the expression levels between the Salvia miltiorrhiza plants #9 and #35 edited with the Salvia miltiorrhiza single-base editing system SmAKBE-03 and the wild-type Salvia miltiorrhiza plants.

[0168] The contents of related metabolites of all base-edited Salvia miltiorrhiza plants and wild-type Salvia miltiorrhiza plants were detected by ultra-high performance liquid chromatography-electrospray triple quadrupole mass spectrometry (UPLC-TQ-MS), and the results are as Figure 17 shown. By comparing the phenotypes of the wild-type Salvia miltiorrhiza plants and #1 in the T0 generation edited lines, the results are as Figure 18 shown.

[0169] According to Figure 17 and Figure 18 it can be seen that the contents of Tan I, Tan IIA and DFSA in the Salvia miltiorrhiza plant #9 edited with the Salvia miltiorrhiza single-base editing system SmAKBE-03 are significantly increased, which are 1.4, 2.3 and 1.1 times that of the wild-type Salvia miltiorrhiza plants respectively. The contents of Tan I, CPT and RA in the Salvia miltiorrhiza plant #9 are significantly increased, which are 1.6, 3.2 and 1.1 times that of the wild-type Salvia miltiorrhiza plants respectively. Compared with the wild-type, its growth and development have no obvious deformities, and there are certain differences in the metabolite contents among different edited plants. This may be because there are three bases of TGA(*254) immediately following the disrupted stop codon, resulting in that the structure of the SmKSL2 protein is not very strongly damaged. Although the A-T / C efficiency of the Salvia miltiorrhiza single-base editing system SmAKBE-03 is still relatively low, and the A-Y editing cannot be achieved at some sites, and the overall efficiency still needs to be further improved, the relatively wide editing window of the Salvia miltiorrhiza single-base editing system SmAKBE-03 and its ability in A:T-to-T:A and A:T-to-C:G base conversions highlight its great potential in promoting the Salvia miltiorrhiza base editing technology.

[0170] It can be seen from the above examples that the present invention provides an efficient Salvia miltiorrhiza single-base editing system and its application. The present invention successfully constructs efficient Salvia miltiorrhiza single-base editing systems SmABE8e-03 and SmAKBE-03. Among them, the Salvia miltiorrhiza single-base editing system SmABE8e-03 can achieve a maximum editing efficiency of 100.0%, and can achieve simultaneous editing of multiple sites; the Salvia miltiorrhiza single-base editing system SmAKBE-03 expands the editing window of ABE to positions 3-11, and realizes A:T-to-T:A and A:T-to-C:G base conversions, enabling us to achieve different forms of base editing in Salvia miltiorrhiza.

[0171] In the present invention, the single-base editing systems SmABE8e-03 and SmAKBE-03 of Salvia miltiorrhiza are used to edit the 5’UTR of SmMYB1 and the stop codon of SmKSL2 respectively. By disrupting the uATG and ORF of the SmMYB1 gene and the protein structure of SmKSL2, the contents of tanshinones and salvianolic acids are significantly increased, and there is no impact on its growth.

[0172] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A single-base editing system for Salvia miltiorrhiza, characterized in that, The Salvia miltiorrhiza single-base editing system includes a 35SEN composite promoter, sgRNA, SmRPS5A promoter, and a fusion protein; The fusion protein is a SmABE8e fusion protein or a SmAKBE fusion protein; The nucleotide sequence encoding the SmABE8e fusion protein is as shown in SEQ ID NO.1; The nucleotide sequence encoding the SmAKBE fusion protein is as shown in SEQ ID NO.

2.

2. The Salvia miltiorrhiza single-base editing system according to claim 1, wherein The SmABE8e fusion protein includes the adenine deaminase TadA8e and the nCas9 protein; The nucleotide sequence of the adenine deaminase TadA8e is as shown in SEQ ID NO.3; The nucleotide sequence of the nCas9 protein is as shown in SEQ ID NO.

4.

3. The Salvia miltiorrhiza single-base editing system according to claim 1, wherein The SmAKBE fusion protein includes the adenine deaminase TadA8e, the nCas9 protein, N-methylpurine DNA glycosylase, Salvia miltiorrhiza TLS polymerase η, and hygromycin phosphotransferase II; The nucleotide sequence of the adenine deaminase TadA8e is as shown in SEQ ID NO.3; The nucleotide sequence of the nCas9 protein is as shown in SEQ ID NO.4; The nucleotide sequence of the N-methylpurine DNA glycosylase is as shown in SEQ ID NO.5; The nucleotide sequence of the Salvia miltiorrhiza TLS polymerase η is as shown in SEQ ID NO.6; The nucleotide sequence of the hygromycin phosphotransferase II is as shown in SEQ ID NO.

7.

4. The Salvia miltiorrhiza single-base editing system according to claim 1, wherein The nucleotide sequence of the 35SEN composite promoter is as shown in SEQ ID NO.

8.

5. The Salvia miltiorrhiza single-base editing system according to claim 1, characterized in that, The 35SEN composite promoter includes the CaMV 35S enhancer, the CmYLCV promoter, and the AtU6-26 promoter; The nucleotide sequence of the CaMV 35S enhancer is as shown in SEQ ID NO.9; The nucleotide sequence of the CmYLCV promoter is as shown in SEQ ID NO.10; The nucleotide sequence of the AtU6-26 promoter is as shown in SEQ ID NO.

11.

6. The Salvia miltiorrhiza single-base editing system according to claim 1, wherein The nucleotide sequence of the SmRPS5A promoter is as shown in SEQ ID NO.

12.

7. The Salvia miltiorrhiza single-base editing system according to claim 1, wherein The sgRNA targets the Salvia miltiorrhiza SmMYB1 gene, SmHMGR1 gene, or SmKSL2 gene.

8. The Salvia miltiorrhiza single-base editing system according to claim 7, wherein The nucleotide sequence of the sgRNA targeting the Salvia miltiorrhiza SmMYB1 gene is as shown in SEQ ID NO.13; The nucleotide sequence of the sgRNA targeting the Salvia miltiorrhiza SmHMGR1 gene is as shown in SEQ ID NO.14; The nucleotide sequence of the sgRNA targeting the Salvia miltiorrhiza SmKSL2 gene is as shown in SEQ ID NO.

15.

9. Use of the Salvia miltiorrhiza single-base editing system according to any one of claims 1 to 8 in Salvia miltiorrhiza base editing.

10. Use of the Salvia miltiorrhiza single-base editing system according to any one of claims 1 to 8 in cultivating high-quality Salvia miltiorrhiza plants.

Citation Information

Patent Citations

  • Cytosine base editing system from adenosine deaminase

    CN118185908A

  • Fusion protein with tribasic group editing function and application thereof

    CN119286803A

  • Fusion protein and application thereof

    CN119431603A

  • Programmable adenine base editor and application thereof

    CN119630788A

  • Plant cytosine single-base editor and construction method and application thereof

    CN119639719A