Visualization method for rapidly detecting cattle theileria annulata and application thereof

Abstract

The invention discloses a visualization method for rapidly detecting cattle theileria annulata and application of the visualization method, and relates to the technical field of parasitic disease detection, the key points of the technical scheme are as follows: a pair of specific ERA primers is designed based on a gene of an enolase highly conserved region, an ERA technology is combined with CRISPR / Cas12a to establish an ERA-CRISPR / Cas12a detection method, and a result is judged by observing fluorescence under blue light. The method has no cross reaction on various common bovine pathogenic microorganisms such as bovine babesia, trypanosoma evansi, rickettsia and anaplasma, has good specificity and high sensitivity, can detect samples with small parasitic load, and has the lowest detection limit of 101 copies / [mu] L.

Description

Technical Field

[0001] The present invention relates to the technical field of parasitic disease detection, and more specifically, to a visualization method for rapid detection of bovine theileriosis annulata and its application. Background Art

[0002] Theileria annulata is a tick-borne blood protozoan belonging to the phylum Apicomplexa, class Piroplasmea, family Theileriidae, and genus Theileria. Bovine Theileria annulata is one of the pathogens of bovine piroplasmosis. The disease it causes is called bovine theileriosis annulata, which is transmitted by arthropods - ticks as vectors and parasitizes in the red blood cells of cattle. In acute infections, it can cause symptoms such as high fever, anemia, jaundice, and enlargement of body surface lymph nodes in the host, and is a type of blood protozoan parasitic disease. The Office International Des Epizooties (OIE) lists it as a category B disease. China lists it as a category II disease. It is mainly prevalent in the northwest, northeast, and north China regions in China, causing the greatest harm to cattle. The high incidence and high mortality of bovine theileriosis annulata lead to a reduction in milk and meat production of cattle, bringing serious economic losses to the cattle industry, and it is one of the main diseases restricting the development of the cattle breeding industry in developing countries.

[0003] Currently, the diagnosis of bovine theileriosis annulata mainly has the following means: (1) Blood smear staining microscopy, lymph node puncture test, in vitro culture, clinical diagnosis, and animal inoculation test, etc. (2) Serological methods, such as: complement fixation test (CFT), indirect fluorescent antibody test (IFAT), enzyme-linked immunosorbent assay (ELISA), and competitive enzyme-linked immunosorbent assay (C-ELISA), etc. However, these methods are all relatively complex, time-consuming and laborious, and their sensitivity and specificity are not high. Molecular detection techniques, such as PCR, nested PCR technology, multiplex PCR, and reverse line blot hybridization technology (RLB), etc. These methods are becoming increasingly mature with their high specificity and sensitivity. However, the disadvantage is that they all require the support of expensive equipment, have relatively high requirements for the operation environment and experimental personnel, and the reaction time is relatively long (about 2h). Therefore, it is necessary to develop a simple, convenient and practical method for differential diagnosis of bovine theileriosis annulata, which has important special significance in clinical diagnosis, treatment and research.

[0004] Therefore, the present invention aims to provide a visualization method for rapid detection of Theileria annulata in cattle and its application. By adopting the enzymatic recombinase amplification (ERA) technology, a new isothermal amplification technology is simulated and established based on the principle of rapid self-replication of the DNA of T4 phage after invading bacteria. It can achieve the amplification of target gene fragments under isothermal conditions (generally 37 - 42 °C, 5 - 20 min), with the advantages of simple operation, rapid amplification, and real-time monitoring of the results. This enables the design of specific primers for the conserved region of the gene, and the establishment of an ERA isothermal detection method suitable for the field, which can rapidly, effectively, and visually detect Theileria annulata in cattle, providing a new and reliable technical support for the grass-roots prevention and control and on-site diagnosis of Theileria annulata in cattle. Summary of the Invention

[0005] The object of the present invention is to provide a visualization method for rapid detection of Theileria annulata in cattle and its application. The present invention has no cross-reaction with various common pathogenic microorganisms in cattle such as Babesia bovis, Rickettsia, Trypanosoma evansi, and Anaplasma, has good specificity and high sensitivity, can detect samples with a small parasite load, and the lowest detection limit is 10 1 copies / μL.

[0006] The above technical object of the present invention is achieved through the following technical solutions: A visualization method for rapid detection of Theileria annulata in cattle. According to the ERA primer design principle, a pair of ERA specific primers are designed based on the highly conserved region of the enolase gene of Theileria annulata, and the result is judged by observing fluorescence under blue light.

[0007] The present invention is further provided as: The specific ERA primers include T.AENO-F and T.AENO-R. The sequence of T.A ENO-F is shown as SEQ ID NO.1, and the sequence of T.AENO-R is shown as SEQ ID NO.2.

[0008] The present invention is further provided as: The lowest detection limit of Theileria annulata is 5 copies / μL.

[0009] The present invention also provides an application of the visualization method for rapid detection of Theileria annulata in cattle in Theileria annulata.

[0010] The present invention also provides an application of the visualization method for rapid detection of Theileria annulata in cattle in the preparation of a kit for detecting Theileria annulata.

[0011] The following are the sequences involved in the solution of the present invention:

[0012] SEQ ID NO: 1:

[0013] T.AENO-F: 5'-AAATTGGACGGCACGCAGAATGAATGG-3'.

[0014] SEQ ID NO: 2:

[0015] T.AENO-R: 5'-TTGGCAGAATCATAAACTCTTGCATAGCC-3'.

[0016] In summary, the present invention has the following beneficial effects:

[0017] The visualization method provided by the present invention has no cross-reaction with various common bovine pathogenic microorganisms such as Babesia bovis, Rickettsia, Trypanosoma evansi, and Anaplasma, and has good specificity, high sensitivity, and high accuracy. It can detect samples with a small parasite load, and the lowest detection limit is 10 1 copies / μL. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 is a schematic diagram of the results of the optimal reaction temperature in the embodiment of the present invention;

[0019] Figure 2 is a schematic diagram of the results of the optimal reaction time in the embodiment of the present invention;

[0020] Figure 3 is a schematic diagram of the screening of the optimal crRNA sequence in the embodiment of the present invention;

[0021] Figure 4 is a schematic diagram of the optimization of the crRNA and Cas12a concentrations in the embodiment of the present invention;

[0022] Figure 5 is a schematic diagram of the optimization of the ssDNA concentration in the embodiment of the present invention;

[0023] Figure 6 is a schematic diagram of the optimization of the T.A ERA-CRISPR / Cas12a reaction time in the embodiment of the present invention.

[0024] Figure 7 is a schematic diagram of the specific detection results in the embodiment of the present invention;

[0025] Figure 8 is a schematic diagram of the sensitivity detection results in the embodiment of the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0026] The following is a further detailed description of the present invention with reference to the attached Figure 1-8 to further illustrate the present invention in detail.

[0027] Example: A visualization experiment for rapid detection of bovine Theileria annulata disease, including the following:

[0028] 1) Construction of positive standard plasmid

[0029] The PCR product was detected by 1.2% agarose gel electrophoresis and then recovered and purified using a gel recovery kit. The recovered and purified PCR product was ligated to pMD19-T Vector and then transferred into Escherichia coli DH5α competent cells. After amplification culture in Amp+ / LB medium, the plasmid was identified by PCR. The recombinant plasmid and the cloned bacteria identified as positive by PCR were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The sequencing results were compared with the sequence of enolase gene (GenBank No. HQ646253.1). Using the Tiangen Fast Plasmid Mini Kit, referring to the instruction manual, the plasmid was extracted from the positive bacterial solution with correct sequencing, and then the concentration was measured with a single-drop spectrophotometer.

[0030] The copy number of the standard plasmid was calculated according to formula ①:

[0031] Copy number = [6.02×10 23 × plasmid concentration (g / mL)] / plasmid relative molecular mass (g / mol) ①.

[0032] 2) ERA primer design

[0033] According to the conserved gene sequence (accession number: HQ646253.1) registered in GenBank, using primer design software and in accordance with the ERA primer design requirements, primers suitable for detection were selected from it. The primer sequences are shown in Table 1, and the primers were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0034] Table 1 ERA primer sequences

[0035]

[0036] 3) crRNA and ssDNA design

[0037] Based on the obtained conserved sequence of T.A-enolase, the PAM site was located, and 2 crRNAs (shown in Table 2) were designed around different PAM sites. The ssDNA reporter molecule sequence is 6-FAM-TTATT-BHQI, and the crRNA and ssDNA were synthesized by Sangon Biotech Co., Ltd.

[0038] Table 2 crRNA sequences

[0039] Name Sequence (5'-3') crRNA1 UAAUUUCUACUAAGUGUAGAUCUGCCAGUUGAGCUAGAUGAACA crRNA2 UAAUUUCUACUAAGUGUAGAUUGUUGCCAGUCCCAUGCUUGAAC ssDNA 6-FAM-TTATT-BHQ1

[0040] 4) ERA reaction condition optimization

[0041] Optimal reaction temperature:

[0042] Since the reaction temperature range of the ERA system is between 37°C and 42°C, to determine the optimal reaction temperature for amplification, plasmid standard products with a copy number of 10 6 copies / μL① were amplified for 30 min at 35°C, 37°C, 39°C, and 41°C according to the system (Table 3). After the reaction, the products were analyzed by electrophoresis to select the optimal reaction temperature.

[0043] Table 3 ERA detection system

[0044] Reagent Volume / μL Solvent 20 Forward primer 2.5 Reverse primer 2.5 Template DNA 2 <![CDATA[ddH2O]]> 21 Activator 2

[0045] The results are as Figure 1 shown. When the T.annulata ERA reaction temperature was between 35°C and 37°C, the bands gradually became brighter with the increase in temperature; when the temperature was between 37°C and 41°C, the amplified bands gradually became lighter. Therefore, the optimal reaction temperature for T.annulata was 37°C.

[0046] Optimal reaction time:

[0047] Plasmid standard products with a copy number of 10 6 copies / μL were incubated at a constant temperature for 10 min, 15 min, 20 min, and 30 min respectively. After that, the products were analyzed by electrophoresis to select the optimal reaction time.

[0048] The results are as Figure 2 shown. When the reaction time was 10 min, a specific band could be obtained, and the band became clearer after 15 min. Gray-scale analysis of the electrophoresis result graph showed that the fluorescence value was obvious when the T.AERA reaction time was 20 min, which was significantly different from the product amount at 15 min, but not significantly different from the product amount after 30 min ( Figure 2 ). To shorten the ERA reaction time, therefore, its optimal reaction time was determined to be 20 min.

[0049] 5) Optimization of ERA-CRISPR / Cas12a reaction conditions

[0050] The T.A standard positive plasmid was amplified using primers T.AENO-F and T.AENO-R, and the amplified product was used as the target DNA. Cas12a, crRNA, ERA amplification product, buffer, ssDNA, and ddH2O were added to the system. The reaction system conditions were optimized by using different crRNAs to configure the reaction system with the ERA product, different concentrations of Cas12a protein and crRNA reaction systems, and different concentrations of ssDNA reaction systems.

[0051] (1) Select the best crRNA

[0052] The results showed that obvious fluorescence was visible to the naked eye under blue light. Then, the ImageJ software was used to perform grayscale analysis on the fluorescence intensity. The fluorescence intensity of crRNA1 was strong, and there was an obvious difference from the negative control ( Figure 3 ), indicating that the designed crRNA1 had a good effect.

[0053] (2) Optimization of the concentrations of crRNA and Cas12a

[0054] The results were as Figure 4 shown. When the concentration of Cas12a protein was 250 nM and the concentration of crRNA was 250 nM, the fluorescence intensity was the strongest. Therefore, the optimal concentrations of Cas12a protein and crRNA for T.A were 250 nM and 250 nM, respectively. The specific reaction system is as follows (Table):

[0055] Table 4 ERA-CRISPR / Cas12a detection system

[0056] Reagent Volume / μL NEBuffer 2 <![CDATA[ddH2O]]> 10 ssDNA 2 crRNA 2 Cas12a 2 dsDNA 2

[0057] (3) Optimization of the ssDNA concentration

[0058] The results were as Figure 5 shown. When it was 1000 nM, the fluorescence intensity was the strongest. Therefore, the optimal concentration of ssDNA for T.A was 1000 nM.

[0059] 6) Optimization of the reaction time of T.A ERA-CRISPR / Cas12a

[0060] We optimized the reaction time in the experiment. Using no ddH2O as the negative control and the positive plasmid containing 10 6 copies / μL as the positive sample. The ERA amplification product was mixed with Cas12a and incubated at 37 °C for different times. The fluorescence values were observed and collected at each time point. After incubation for 5 min, fluorescence intensity and signals could be observed, and the fluorescence intensity continued to increase with time ( Figure 6 ). No fluorescence phenomenon was seen in the negative control group. The Image J software was used to perform grayscale analysis on the fluorescence intensity result graph. The results showed that very strong fluorescence could be observed with the naked eye at both 20 min and 30 min. Therefore, we determined that 20 min was the optimal reaction time for T.A ERA-CRISPR / Cas12a detection.

[0061] 7) Specificity test of T.A ERA-CRISPR / Cas12a

[0062] The DNA of Theileria annulata, Babesia bovis, Rickettsia, Anaplasma, and Trypanosoma evansi was amplified by ERA isothermal amplification using primers T.AENO-F and T.A ENO-R. 2 μL of each ERA product was taken as the target dsDNA, and ddH2O was set as the negative control. The ERA reaction was carried out at a reaction time of 20 min and a reaction temperature of 37 °C, and then the CRISPR / Cas12a specific detection was carried out at 37 °C. The results are as Figure 7 shown. Only T.A showed fluorescence under blue light, and the others did not fluoresce. The fluorescence intensity results were analyzed by gray scale using ImageJ software. The results showed that the fluorescence value of T.A was obvious and significantly different from the other five control groups, indicating that the method had good specificity for T.A.

[0063] 8) Sensitivity test of T.A ERA-CRISPR / Cas12a

[0064] The concentration of the T.A plasmid was measured, and the copy number was calculated according to formula ①. The T.A recombinant plasmid was diluted to 10 6 -10 0 copies / μL in 7 gradients using a 10-fold dilution method. Each of these was used as a template, and ERA isothermal amplification was carried out using primers T.AENO-F and T.AENO-R. 2 μL of each ERA product was taken as the target dsDNA, and ddH2O was set as the negative control. According to the determined optimal reaction system, a detection system was configured using a fluorescent reporter molecule, and the experiment was repeated 3 times. After completion, the fluorescence status was observed under a blue light gel imager to judge the sensitivity.

[0065] The results are as Figure 8 shown. The lowest concentration that the established ERA-CRISPR / Cas12a method could detect was 10 1 copies / μL.

[0066] 9) Repeatability test of T.A ERA-CRISPR / Cas12a

[0067] To determine the within-batch repeatability of the T.A ERA-CRISPR / Cas12a method, the optimized method was used with plasmid standards of 10 6 copies / μL, 10 5 copies / μL, and 10 4 copies / μL as templates, and each concentration was repeated 3 times for the ERA-CRISPR / Cas12a reaction.

[0068] To determine the between-batch repeatability of the T.A ERA-CRISPR / Cas12a method, the above conditions were used, and the experiment was repeated three times at intervals. The coefficient of variation (CV) of the fluorescence intensity in the within-batch and between-batch repeat tests was calculated by formula ②, and the repeatability was reflected by the coefficient of variation.

[0069] CV = standard deviation / mean ②.

[0070] The results are shown in Table 5. The within-batch coefficient of variation was less than 5%, and the between-batch coefficient of variation was less than 3%. No fluorescence was observed in the negative controls, indicating that the detection method had good repeatability and stability.

[0071] Table 5 Detection of T.A repeatability

[0072]

[0073] (9) Detection of clinical samples

[0074] Total DNA was extracted from 32 collected bovine Theileria annulata blood samples and stored at -20°C. The established ERA detection method and PCR method were used to detect Theileria annulata in the 32 collected bovine blood samples.

[0075] The results showed that 13 positive samples were detected by PCR for T.A, with a positive rate of 26%; 16 positive samples were detected by the ERA method, with a positive rate of 50%, and the sensitivity was 1.92 times that of PCR. Comparing the two methods for detecting T.A, the ERA detection had a higher positive detection rate, which further indicated that the ERA method was more sensitive and reliable than the PCR method.

[0076] Table 6 Detection of clinical samples

[0077]

[0078] In summary, a visualization method and its application for bovine Theileria annulata adopted in the present invention have no cross-reaction with various common bovine blood protozoa such as Babesia bovis, Rickettsia, Trypanosoma evansi, and Anaplasma, have good specificity and high sensitivity, can detect samples with a small parasite load, and the lowest detection limit is 10 1 copies / μL, and the total detection time only requires 40 min.

[0079] This specific embodiment is only an explanation of the present invention and does not limit the present invention. Those skilled in the art can make modifications without creative contributions to this embodiment after reading this specification, but as long as they are within the scope of the claims of the present invention, they are protected by the patent law.

Claims

1. A visualization method for rapid detection of bovine Theileria annulata disease, characterized in that: According to the ERA primer design principle, a pair of ERA-specific primers was designed based on the highly conserved region of the enolase gene of Theileria annulata, and the results were judged by observing fluorescence under blue light.

2. The visual method for rapid detection of bovine anaplasmosis according to claim 1, characterized in that: The specific ERA primers include T.AENO-F and T.AENO-R. The sequence of T.AENO-F is shown as SEQ ID NO.1, and the sequence of T.AENO-R is shown as SEQ ID NO.

2.

3. A visualization method for rapid detection of bovine anaplasmosis according to claim 1, characterized in that: The minimum detection limit of *Theileria annulata* is 10 1 copies / μL.

4. Application of a visual method for rapid detection of Theileria annulata disease according to any one of claims 1-3 in Theileria annulata.

5. Application of a visual method for rapid detection of Theileria annulata disease according to any one of claims 1-3 in the preparation of a kit for detecting Theileria annulata.

Images