Ewing sarcoma detection primer group, kit and application thereof

Through multiple fluorescence PCR and high-resolution capillary electrophoresis platform, a specific primer group was designed to detect 24 gene fusion variants of Ewing sarcoma, solving the sensitivity and efficiency of Ewing sarcoma diagnosis and achieving efficient and rapid gene identification.

CN120290729AActive Publication Date: 2025-07-11BEIJING CHILDRENS HOSPITAL AFFILIATED TO CAPITAL MEDICAL UNIV

Patent Information

Application Number
CN202510576205.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-06
Publication Date
2025-07-11
Estimated Expiration
2045-05-06

AI Technical Summary

Technical Problem

The prior art is difficult to efficiently and sensitively identify characteristic gene variants of Ewing sarcoma, especially multiple gene fusion types, which leads to difficulty in diagnosis. Existing methods such as fluorescence in situ hybridization and second-generation sequencing are costly, complex and difficult to implement.

Method used

The multi-fluorescent PCR method was designed to combine a high-resolution capillary electrophoresis platform, and the 7 gene fusions of Ewing sarcoma were detected using specific primer group A and primer group B, with a total of 24 variant types, combining fluorophore labeling, and rapid identification was achieved through PCR amplification and electrophoresis analysis.

Benefits of technology

Efficient and sensitive detection of 24 gene fusion variant types of Euwen sarcoma was achieved, with a minimum detection limit of 10 copies and a minimum detection time of 240 minutes. The results are 100% consistent with Sanger sequencing verification.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290729A_ABST
    Figure CN120290729A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of biological detection, and particularly relates to an ewing sarcoma detection primer group, a kit and application thereof. The Ewing sarcoma detection primer group comprises a primer group A and a primer group B, and totally has 17 primer sequences. The primer group is designed, Ewing sarcoma characteristic variation genes are detected through multiple fluorescent PCR and a high-resolution capillary electrophoresis apparatus, 24 variation types fused by 7 types of genes can be detected at a time, the lowest detection limit is 10 copies, and the shortest detection time is 240 minutes. The detection result of the primer group disclosed by the invention can pass Sanger sequencing verification and is completely consistent with the morphological diagnosis result, the methodological consistency reaches 100%, and a sensitive and efficient Ewing sarcoma genetic variation detection method is provided.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biological detection, and particularly relates to a primer set for detecting Ewing sarcoma, a kit and its application. Background Art

[0002] Ewing sarcoma is a malignant tumor that occurs frequently in children and adolescents, accounting for 10%-15% of all osteosarcomas, including Ewing sarcoma family tumors, peripheral primitive neuroectodermal tumors, peripheral neuroepitheliomas, and small cell tumors of the chest wall. These sarcomas are similar in histological and immunohistochemical characteristics and are considered to originate from unique mesenchymal stem cells. Ewing sarcoma has characteristic chromosomal translocations that form fusion genes encoding abnormal transcription factors. 85% of tumors have translocations such as t(11;22)(q24;q12), resulting in fusions such as EWSR1::FLI1, EWSR1::ETV1, EWSR1::ETV4, EWSR1::FEV, FUS::ERG, FUS::FEV, etc.

[0003] Ewing sarcoma can occur in almost any bone or soft tissue. The affected area is usually accompanied by pain and swelling, and the clinical manifestations lack specificity. Pathology is the gold standard for diagnosis. However, the histological morphological characteristics and immunohistochemical expressions of Ewing sarcoma overlap with those of other small round blue cell tumors, including lymphoma, small cell osteosarcoma, mesenchymal chondrosarcoma, undifferentiated neuroblastoma, poorly differentiated synovial sarcoma, desmoplastic small round cell tumor, rhabdomyosarcoma, and sarcomas with CIC-DUX4 or BCOR gene alterations. It is difficult to make a differential diagnosis solely based on histological morphology and immunohistochemical expression, and there is an urgent need for sensitive and efficient genetic variation detection methods.

[0004] Clinical detection methods for such gene variations mainly include fluorescence in situ hybridization (FISH), polymerase chain reaction (PCR), next-generation sequencing, etc. Fluorescence in situ hybridization is suitable for the detection of single fusion genes and is not suitable for screening multiple variations. Next-generation sequencing based on RNA / DNA is costly, has complex procedures, and a long detection cycle, making it difficult to be applied clinically. PCR is a method for amplifying specific nucleotide sequences based on target primers and detecting specific genes using fluorescence signals or gel electrophoresis. It has the advantages of being simple, easy to perform, highly sensitive, and highly specific, and has been widely used in the fields of tumor markers, molecular typing, and individualized treatment. Summary of the Invention

[0005] In order to solve the above technical problems, the present invention provides a method of multiplex fluorescence PCR to develop an auxiliary diagnostic product for Ewing sarcoma, and uses a high-resolution capillary electrophoresis platform for qualitative analysis of the target product.

[0006] The purpose of the present invention is to provide a primer set for detecting Ewing sarcoma.

[0007] Another object of the present invention is to provide a kit containing the above primer sets.

[0008] Another object of the present invention is to provide the application of the above kit.

[0009] According to the primer set for detecting Ewing's sarcoma in the specific embodiment of the present invention, the primer set includes at least one of primer set A and primer set B, wherein, Primer set A: includes upstream primers SEQ ID NO.1-2 and downstream primers SEQ ID NO.3-11, SEQ ID NO.1: 5’- CCAAGTCAATATAGCCAACAG -3’; SEQ ID NO.2: 5’- GCGAGGTGGCTTCAATAAG -3’; SEQ ID NO.3: 5’- TACACAGTTCCTTGCCATC -3’; SEQ ID NO.4: 5’- GCCGTTGCTCTGTATTCT -3’; SEQ ID NO.5: 5’- CAGGAGGAATTGCCACAG -3’; SEQ ID NO.6: 5’- TGGTCCAAGAATCTGATAAGG -3’; SEQ ID NO.7: 5’- GTTTGCTCTTCCGCTCTC -3’; SEQ ID NO.8: 5’- CGACCAGTCCAGGCAATA -3’; SEQ ID NO.9: 5’- GGACAACGCAGACATCAT -3’; SEQ ID NO.10: 5’- TGAGCTTGAACTCCATTCC -3’; SEQ ID NO.11: 5’- GTCCGTGAGCTTGAACTC -3’; Primer set B: includes upstream primers SEQ ID NO.12-14 and downstream primers SEQ ID NO.15-17, SEQ ID NO.12: 5’- TACAACAGCAGCAGTGGT -3’; SEQ ID NO.13: 5’- ACCGTGGTGGCTTCAATA -3’; SEQ ID NO.14: 5’- TTTGATGACCCACCTTCAG -3’; SEQ ID NO.15: 5’- ACTGTGGAAGGAGATGGT - 3’; SEQ ID NO.16: 5’- ATCCGTCATCTTGAACTCC - 3’; SEQ ID NO.17: 5’- GTCCGTGAGCTTGAACTC - 3’.

[0010] Among them, primer set A can detect 16 mutation types of 5 types of gene fusions: EWSR1::FLI1 gene fusion (including 7 types: Exon10::Exon5, Exon10::Exon6, Exon10::Exon8, Exon7::Exon4, Exon7::Exon5, Exon7::Exon6, Exon7::Exon7); EWSR1::ERG gene fusion (including 5 types: Exon10::Exon9, Exon7::Exon9, Exon7::Exon10, Exon7::Exon11, Exon7::Exon12); EWSR1::ETV1 gene fusion (including 1 type: Exon7::Exon11); EWSR1::ETV4 gene fusion (including 2 types: Exon7::Exon9, Exon7::Exon11); EWSR1::FEV gene fusion (including 1 type: Exon7::Exon2).

[0011] Primer set B can detect 8 mutation types of 2 types of gene fusions: FUS::ERG gene fusion (including 5 types: Exon5::Exon8, Exon5::Exon9, Exon7::Exon7, Exon7::Exon11, Exon7::Exon12); FUS::FEV gene fusion (including 3 types: Exon5::Exon2, Exon7::Exon2, Exon10::Exon2).

[0012] Thus, the combined use of primer sets A and B can detect 24 mutation types of the above 7 types of gene fusions at one time.

[0013] Preferably, the Ewing's sarcoma detection primer set of the present invention includes primer set A and primer set B.

[0014] According to the detection primer set for Ewing's sarcoma of the specific embodiment of the present invention, the downstream primer is also labeled with a fluorescent group.

[0015] Preferably, the fluorescent group is selected from FAM, VIC, TAMRA or ROX.

[0016] Preferably, the present invention provides the following combination forms of the fluorescent group and the downstream primer: Downstream primer 3: 5’- TACACAGTTCCTTGCCATC - FAM-3’; Downstream primer 4: 5’- GCCGTTGCTCTGTATTCT - FAM-3’; Downstream primer 5: 5’- CAGGAGGAATTGCCACAG - FAM-3’; Downstream primer 6: 5’- TGGTCCAAGAATCTGATAAGG - VIC-3’; Downstream primer 7: 5’- GTTTGCTCTTCCGCTCTC - VIC-3’; Downstream primer 8: 5’- CGACCAGTCCAGGCAATA - TAMRA-3’; Downstream primer 9: 5’- GGACAACGCAGACATCAT - TAMRA-3’; Downstream primer 10: 5’- TGAGCTTGAACTCCATTCC - TAMRA-3’; Downstream primer 11: 5’- GTCCGTGAGCTTGAACTC - TAMRA-3’; Downstream primer 15: 5’- ACTGTGGAAGGAGATGGT - VIC-3’; Downstream primer 16: 5’- ATCCGTCATCTTGAACTCC - VIC-3’; Downstream primer 17: 5’- GTCCGTGAGCTTGAACTC - TAMRA-3’.

[0017] According to the detection kit for Ewing's sarcoma of the specific embodiment of the present invention, it includes the above-mentioned detection primer set for Ewing's sarcoma.

[0018] According to the detection kit for Ewing's sarcoma of the specific embodiment of the present invention, the kit further includes a positive control, a negative control, a PCR reaction buffer, a nucleic acid template and ddH2O.

[0019] Preferably, the negative control is pure water.

[0020] Preferably, the positive control is a plasmid containing a fusion gene, and the sequence of the fusion gene is SEQ ID NO.20 or SEQ ID NO.21.

[0021] The gene sequence of EWSR1::FLI1 (Exon7::Exon6) fusion is SEQ ID NO.20: 5’-ctattcctctacacagccgactagttatgatcagagcagttactctcagcagaacacctatgggcaaccgagcagctatggacagcagagtagctatggtcaacaaagcagctatgggcagcagcctcccactagttacccaccccaaactggatcctacagccaagctccaagtcaatatagccaacagagcagcagctacgggcagcagaacccttcttatgactcagtcagaagaggagcttggggcaataacatgaattctggcctcaacaaaagtcctccccttggaggggcacaaacgatcagtaagaatacagagcaacggccccagccagatccgtatcagatcctgggcccgaccagcagtcgcctagccaaccctggaagcgggcagatccagctgtggcaattcctcctggagctgctctccgacagcgccaacgccagctgtatcacctgggaggggaccaacggggagttcaaaatgacggaccccgatgaggtggccaggcgctggggcgagcggaaaagcaagcccaacatgaattacgacaagctgagccgggccctccgttattactatgataaaa-3’。

[0022] The gene sequence of FUS::ERG (Exon7::Exon12) fusion is SEQ ID NO.21: 5’-gtaactatggccaagatcaatcctccatgagtagtggtggtggcagtggtggcggttatggcaatcaagaccagagtggtggaggtggcagcggtggctatggacagcaggaccgtggaggccgcggcaggggtggcagtggtggcggcggcggcggcggcggtggtggttacaaccgcagcagtggtggctatgaacccagaggtcgtggaggtggccgtggaggcagaggtggcatgggcggaagtgaccgtggtggcttcaataaatttggtggcagtggccagatccagctttggcagttcctcctggagctcctgtcggacagctccaactccagctgcatcacctgggaaggcaccaacggggagttcaagatgacggatcccgacgaggtggcccggcgctggggagagcggaagagcaaacccaacatgaactacgataagctcagccgcgccctccgttactactatgacaagaacatcatgaccaaggtccatgggaagcgctacgcctacaagttcgacttccacgggatcgcccaggccc-3’。

[0023] The detection kit for Ewing's sarcoma according to the specific embodiment of the present invention, the kit further comprises primers for the internal reference gene HPRT1.

[0024] Preferably, the primer sequences of the internal reference gene HPRT1 are as follows: SEQ ID NO.18: 5’-CCCTGGCGTCGTGATTAGTG-3; SEQ ID NO.19: 5’-GAGCACACAGAGGGCTACAA-3’.

[0025] Advantages of the present invention: The present invention designs a primer set, and detects characteristic variant genes of Ewing's sarcoma by the combined application of multiplex fluorescence PCR and high-resolution capillary, which can detect 24 variant types of 7 types of gene fusions at one time, with the lowest detection limit of 10 copies and the shortest detection time of 240 minutes.

[0026] The primer set of the present invention was used to test 16 formalin-fixed paraffin-embedded tumor samples, and the detection results were verified by Sanger sequencing and were all consistent with the morphological diagnosis results, and the methodological consistency reached 100%. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0028] Figure 1 It shows that the EWSR1::FLI1 fusion gene has good detection effect in the range of 10 - 1000 copies, and the lowest detection limit is 10 copies.

[0029] Figure 2 It shows the EWSR1::ERG fusion situation in sample E6 detected by the kit (A) and the Sanger sequencing verification result (B).

[0030] Figure 3 It shows the EWSR1::FLI1 fusion situation in sample E7 detected by the kit (A) and the Sanger sequencing verification result (B).

[0031] Figure 4 It shows the EWSR1::FEV fusion situation in sample E12 detected by the kit (A) and the Sanger sequencing verification result (B). DETAILED DESCRIPTION OF THE EMBODIMENTS

[0032] To make the purpose, technical solutions and advantages of the present invention clearer, the technical solutions of the present invention will be described in detail below. Obviously, the described embodiments are only some embodiments of the present invention, rather than all embodiments. All other embodiments obtained by those of ordinary skill in the art without creative efforts based on the embodiments of the present invention belong to the scope protected by the present invention.

[0033] Example 1 Detection Kit of the Present Invention The present invention sorted out the fusion gene data of 391 cases of Ewing sarcoma reported in the literature and detected in the local laboratory, unified the reference gene transcripts, and summarized 24 variant combination types of 7 common gene fusions in Ewing sarcoma (EWSR1::FLI1, EWSR1::ERG, EWSR1::ETV1, EWSR1::ETV4, EWSR1::FEV, FUS::ERG and FUS::FEV) (see Table 1).

[0034] According to the above mutation types, the genes were grouped into EWSR1-related fusion gene sets and FUS-related fusion gene sets, and primer set A and primer set B were set separately, where primer set A was used to detect EWSR1-related fusion genes, and primer set B was used to detect FUS-related fusion genes. Specific upstream and downstream primers of each primer set were further designed, combined and tested, and the primer sets must meet the following requirements: ① In each primer set, the primer sequence can amplify all target fragments in the set; ② The total number of primers should be as small as possible to reduce unnecessary cross-reactions; ③ The difference in the amplified products of each primer pair is greater than or equal to 2 bp to meet the resolution requirements of high-resolution capillary electrophoresis; ④ Each amplified fragment should be greater than 100 bp to avoid primer dimer interference and as small as possible to be less than or equal to 250 bp to be suitable for the most common clinical paraffin tumor specimens with highly degraded nucleic acids; ⑤ The primer combination of each tube has no non-specific amplification with genomic DNA.

[0035] According to the above principles, the present invention designed and optimized multiple sets of Ewing sarcoma primer combinations and tested them. Finally, the multiple primer combinations of Ewing sarcoma characteristic variant fusion genes were combined with specific fluorescent groups, which can detect 24 variant types of 7 types of gene fusions at one time (see Table 1). Primer group A detects EWSR1::FLI1, EWSR1::ERG, EWSR1::ETV1, EWSR1::ETV4 and EWSR1::FEV fusions; primer group B detects FUS::ERG and FUS::FEV; primer group C detects the expression of the internal reference gene HPRT1 for quality control of nucleic acid quality.

[0036]

[0037] In combination with the above primer set, the present invention provides a specific PCR detection system, as shown in Table 2. Table 2 Reaction system for each tube (26 μL as an example)

[0038] Note: The 2×PCR reaction buffer contains Taq enzyme, Mg 2+ , PCR buffer, dNTPs, etc.

[0039] Primer sets A, B, and C are placed in different tubes, respectively. Primer set A is placed in tube A, primer set B is placed in tube B, and primer set C is placed in tube C.

[0040] The kit also includes positive control tubes and negative control tubes. The negative control is pure water, and the positive control is a fusion gene plasmid (1000 copies / μl). The gene variants and nucleotide sequences corresponding to the positive controls in each tube are as follows: Tube A contains the EWSR1::FLI1 (Exon7::Exon6) fusion gene: 5’-ctattcctctacacagccgactagttatgatcagagcagttactctcagcagaacacctatgggcaaccgagcagctatggacagcagagtagctatggtcaacaaagcagctatgggcagcagcctcccactagttacccaccccaaactggatcctacagccaagctccaagtcaatatagccaacagagcagcagctacgggcagcagaacccttcttatgactcagtcagaagaggagcttggggcaataacatgaattctggcctcaacaaaagtcctccccttggaggggcacaaacgatcagtaagaatacagagcaacggccccagccagatccgtatcagatcctgggcccgaccagcagtcgcctagccaaccctggaagcgggcagatccagctgtggcaattcctcctggagctgctctccgacagcgccaacgccagctgtatcacctgggaggggaccaacggggagttcaaaatgacggaccccgatgaggtggccaggcgctggggcgagcggaaaagcaagcccaacatgaattacgacaagctgagccgggccctccgttattactatgataaaa-3’。

[0041] Tube B contains the FUS::ERG (Exon7::Exon12) fusion gene: 5’-gtaactatggccaagatcaatcctccatgagtagtggtggtggcagtggtggcggttatggcaatcaagaccagagtggtggaggtggcagcggtggctatggacagcaggaccgtggaggccgcggcaggggtggcagtggtggcggcggcggcggcggcggtggtggttacaaccgcagcagtggtggctatgaacccagaggtcgtggaggtggccgtggaggcagaggtggcatgggcggaagtgaccgtggtggcttcaataaatttggtggcagtggccagatccagctttggcagttcctcctggagctcctgtcggacagctccaactccagctgcatcacctgggaaggcaccaacggggagttcaagatgacggatcccgacgaggtggcccggcgctggggagagcggaagagcaaacccaacatgaactacgataagctcagccgcgccctccgttactactatgacaagaacatcatgaccaaggtccatgggaagcgctacgcctacaagttcgacttccacgggatcgcccaggccc-3’。

[0042] The PCR amplification program used is shown in Table 3 below: Table 3 Amplification Program

[0043] Take 1 μL of the obtained PCR amplification product, add 10 μL of HiDi and 0.5 μL of Liz600 internal standard, mix well, perform electrophoresis on a high-resolution capillary electrophoresis instrument (ABI 3500), and analyze using Gene Mapper software. Determine the fusion gene type based on the fluorescence color and molecular weight of the product peaks, and then assist in judging whether it is Ewing's sarcoma.

[0044] Table 4 Result Interpretation Criteria

[0045] The result interpretation criteria are shown in Table 4. First, check if there is a 190 bp ROX amplification peak in tube C. If not, it is judged that the nucleic acid quality control fails and the nucleic acid needs to be re-extracted for the experiment; if so, the nucleic acid quality control is passed.

[0046] Secondly, check whether there are amplification peaks of corresponding fluorescence colors and sizes in Tube A or Tube B: In Tube A, the product peaks of 240 / 173 / 138 / 160 / 225 / 158 / 184 bp with FAM fluorescence respectively correspond to EWSR1::FLI1 fusions of T1 / T2 / T3 / T4 / T5 / T6 / T7 types. The product peaks of 206 / 191 / 121 / 241 / 194 bp with VIC fluorescence correspond to EWSR1::ERG fusions of T8 / T9 / T10 / T11 / T12 types. The product peaks of 180 / 171 / 200 / 226 bp with TAMRA fluorescence correspond to EWSR1::ETV1, EWSR1::ETV4 or EWSR1::FEV fusions of T13 / T14 / T15 / T16 types; In Tube B, the product peaks of 207 / 135 / 273 / 182 / 134 bp with VIC fluorescence correspond to FUS::ERG fusions of T17 / T18 / T19 / T20 / T21 types. The product peaks of 225 / 209 / 228 bp with TAMRA fluorescence correspond to FUS::FEV fusions of T22 / T23 / T24 types.

[0047] If there are no such product peaks in both Tube A and Tube B, it is judged as negative, and no relevant gene fusion is detected.

[0048] Example 2 Perform performance detection on the kit provided in Example 1. Taking EWSR1::FLI1 (Exon7::Exon6) as an example, use the plasmid inserted with the corresponding fragment as the detection standard for the fusion gene, and prepare the standard solution with corresponding concentrations (1, 10, 100, 1000 copies / μl) as the amplification template, and use the kit and its detection procedure of Example 1 of the present invention.

[0049] The detection results are as Figure 1 shown. The EWSR1::FLI1 fusion gene has good detection effects in the range of 10 - 1000 copies, and the lowest detection limit is 10 copies. The detection ranges and lowest detection limits for detecting other types of fusion genes all meet the requirements.

[0050] Example 3 Use 16 real formalin-fixed paraffin-embedded tumor samples (8 cases of Ewing's sarcoma, 8 cases of Ewing-like sarcoma including 4 cases of CIC rearrangement sarcoma and 4 cases of sarcoma with BCOR genetic abnormalities). Cut 5 wax sections of 5 μm for each case, extract the nucleic acid of the sample and reverse transcribe it into cDNA, and use the method described in Example 1 to detect and test the detection performance of the kit.

[0051] All samples passed nucleic acid quality control. A total of 6 cases of EWSR1::FLI1 fusion, 1 case of EWSR1::ERG fusion, and 1 case of EWSR1::FEV fusion were detected. The PCR amplification products of the positive samples were subjected to agarose gel electrophoresis and gel purification. The corresponding upstream and downstream primers were used directly as sequencing primers, and Sanger sequencing was performed using an ABI 3500 genetic analyzer. The product sequences were compared with the human genome to determine the fusion gene type and the breakage-fusion sites.

[0052] The Sanger sequencing results were completely consistent with the detection results of this kit. As Figures 2 - 4 shown.

[0053] Analyzing the histological types of the samples, the histological diagnoses of all 8 cases with detected fusion genes were consistent with Ewing sarcoma (see Table 5). The detection results of CIC rearrangement sarcoma and sarcoma with BCOR genetic abnormalities were all negative. In summary, the detection results of the kit for 16 tumor patient samples were all consistent with the morphological diagnosis results, and the methodological consistency reached 100%.

[0054]

[0055] As described above, the above are only specific embodiments of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art within the technical scope disclosed by the present invention can easily think of changes or substitutions, which should all be covered within the protection scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the protection scope of the claims described.

Claims

1. A primer set for detecting Ewing's sarcoma, characterized in that, The primer set includes at least one of primer set A and primer set B, where Primer set A: includes upstream primers SEQ ID NO.1-2 and downstream primers SEQ ID NO.3-11, SEQ ID NO.1: 5’- CCAAGTCAATATAGCCAACAG -3’; SEQ ID NO.2: 5’- GCGAGGTGGCTTCAATAAG -3’; SEQ ID NO.3: 5’- TACACAGTTCCTTGCCATC -3’; SEQ ID NO.4: 5’- GCCGTTGCTCTGTATTCT -3’; SEQ ID NO.5: 5’- CAGGAGGAATTGCCACAG -3’; SEQ ID NO.6: 5’- TGGTCCAAGAATCTGATAAGG -3’; SEQ ID NO.7: 5’- GTTTGCTCTTCCGCTCTC -3’; SEQ ID NO.8: 5’- CGACCAGTCCAGGCAATA -3’; SEQ ID NO.9: 5’- GGACAACGCAGACATCAT -3’; SEQ ID NO.10: 5’- TGAGCTTGAACTCCATTCC -3’; SEQ ID NO.11: 5’- GTCCGTGAGCTTGAACTC -3’; Primer set B: includes upstream primers SEQ ID NO.12-14 and downstream primers SEQ ID NO.15-17, SEQ ID NO.12: 5’- TACAACAGCAGCAGTGGT -3’; SEQ ID NO.13: 5’- ACCGTGGTGGCTTCAATA -3’; SEQ ID NO.14: 5’- TTTGATGACCCACCTTCAG -3’; SEQ ID NO.15: 5’- ACTGTGGAAGGAGATGGT - 3’; SEQ ID NO.16: 5’- ATCCGTCATCTTGAACTCC - 3’; SEQ ID NO.17: 5’- GTCCGTGAGCTTGAACTC - 3’.

2. The detection primer set for Ewing's sarcoma according to claim 1, characterized in that, The downstream primer is also labeled with a fluorescent group.

3. The primer set for detecting Ewing's sarcoma according to claim 2, characterized in that, The fluorescent group is selected from FAM, VIC, TAMRA or ROX.

4. Detection kit for Ewing's sarcoma, characterized in that, The kit includes the Ewing's sarcoma detection primer set according to any one of claims 1-3.

5. The detection kit for Ewing's sarcoma according to claim 4, wherein The kit further includes a positive control, a negative control, a PCR reaction buffer, a nucleic acid template and ddH2O.

6. The detection kit for Ewings sarcoma according to claim 5, characterized in that, The negative control is pure water.

7. The detection kit for Ewing's sarcoma according to claim 5, wherein The positive control is a plasmid containing a fusion gene, and the sequence of the fusion gene is SEQ ID NO.20 or SEQ ID NO.

21.

8. The detection kit for Ewings sarcoma according to claim 5, characterized in that, The kit further includes primers for the internal reference gene HPRT1.

9. The detection kit for Ewing's sarcoma according to claim 8, wherein, The primer sequences of the internal reference gene HPRT1 are as follows: SEQ ID NO.18: 5’-CCCTGGCGTCGTGATTAGTG-3; SEQ ID NO.19: 5’-GAGCACACAGAGGGCTACAA-3’.

Citation Information

Patent Citations

  • Sarcoma fusion gene detection kit and system

    CN109811055A

  • Sarcoma fusion gene and / or mutation joint detection primer group and kit

    CN112094915A

  • Primer composition for detecting sarcoma fusion gene mutation, kit and application

    CN113005200A

  • Design kit for targeted detection of small round cell tumor fusion gene panel of soft tissue tumor

    CN113462763A

  • Rhabdomyosarcoma detection primer probe set, kit and application of rhabdomyosarcoma detection primer probe set

    CN117402976A

Cited By

  • CIC rearrangement sarcoma detection primer group, kit and application of CIC rearrangement sarcoma detection primer group

    CN121065340A

  • Peripheral neuroblastoma ATRX gene deletion detection primer group, kit and application of peripheral neuroblastoma ATRX gene deletion detection primer group

    CN121182957A

  • Peripheral nerve mother cell tumor ATRX gene deletion detection primer group, kit and application thereof

    CN121182957B