Snps of fine wool body of large cashmere goat and application thereof

By selecting for breeding through SNP mutations at specific locations in the cashmere goat genome, the contradiction between cashmere quality and body weight has been resolved, achieving the breeding goal of large cashmere goats with fine cashmere and enhancing the economic value of cashmere goats.

CN120290733BActive Publication Date: 2026-01-27INNER MONGOLIA AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311565524.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-11-22
Publication Date
2026-01-27
Estimated Expiration
2043-11-22

AI Technical Summary

Technical Problem

Existing technologies have failed to simultaneously improve the fineness of the cashmere and the weight of Inner Mongolian cashmere goats, resulting in a decline in cashmere quality and reduced economic income.

Method used

Using SNP markers, particularly the G-to-A mutation at chromosome 48854986 and the T-to-C mutation at chromosome 76025546 of the cashmere goat genome, individuals with AA and CC genotypes were selected as parents to breed cashmere goats with fine downy bodies.

Benefits of technology

This method simultaneously reduces the fineness of the cashmere and increases the weight of the cashmere goats, thereby improving their economic benefits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290733B_ABST
    Figure CN120290733B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of genetic breeding, and particularly relates to a SNP marker affecting fine-bundle large cashmere goats and application thereof. The SNP marker comprises marker one and / or marker two. The marker one and / or the marker two affect the fine-bundle large of cashmere goats. The marker one is located at 48854986 of chromosome 6 of a cashmere goat genome, and a G to A mutation occurs. The marker two is located at 76025546 of chromosome 14 of the cashmere goat genome, and a T to C mutation occurs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic breeding technology, specifically to an SNP marker that affects fine-textured large cashmere goats and its application. Background Technology

[0002] The Inner Mongolian cashmere goat is a superior local livestock breed developed through long-term natural selection and systematic artificial breeding. It was included in the "National List of Protected Livestock and Poultry Breeds" in 2000 and the "National List of Protected Livestock and Poultry Genetic Resources" in 2006. In 2008, the conservation area for the Inner Mongolian cashmere goat was designated as a national-level conservation farm and protected area. It is a livestock breed whose export is strictly prohibited by the state. The cashmere produced by the Inner Mongolian cashmere goat is prized for its fineness, softness, and good luster, making it highly sought after by consumers both domestically and internationally. However, with changes in feeding methods and the environment, the cashmere produced by the Inner Mongolian cashmere goat is showing a trend towards coarser texture, which does not meet the initial desire for high-quality cashmere. Therefore, reducing the fineness of the cashmere has become one of the urgent problems to be solved. Weight is equally important for the dual-purpose (cashmere and meat) Inner Mongolian cashmere goat; breeding larger cashmere goats means greater economic income for farmers and herders. Current technology does not simultaneously consider both "fine cashmere" and "large size." Summary of the Invention

[0003] To address the aforementioned technical problems, this invention provides an SNP marker that affects fine-textured large cashmere goats and its application.

[0004] A SNP marker affecting fine-down large cashmere goats, the SNP marker comprising marker one and / or marker two;

[0005] The marker is located at position 48854986 on chromosome 6 of the cashmere goat genome, and a mutation from G to A has occurred.

[0006] The marker 2 is located at position 76025546 on chromosome 14 of the cashmere goat genome and has undergone a T-to-C mutation.

[0007] The marker one and / or the marker two affect the size of the fine down body of cashmere goats.

[0008] Molecular markers, wherein the molecular markers include marker one and / or marker two;

[0009] The nucleotide sequence of the molecular marker containing marker one is shown in SEQ ID NO.1, specifically: CATTTTCAGAATGATAATTCTATCTTCAATTCTTTTTAAGCACTTTTCTAAATTACTGACTTTTTATTTGGAATATTTTCATGTGTTGTAGAAAAGGTCAATTGTGGTCAGTCTCCTTAATATGACAGAAACTATGCTCTTTATTTAATATGATATTTTAAGAAAATAATTTTATAAATAGTGAAACATTTTTTAATTGTC, showing the sequence 100 bp upstream and downstream of the mutation marker, with the mutation marker in bold;

[0010] The nucleotide sequence of the molecular marker containing marker two is shown in SEQ ID NO.2, specifically: TATTCAAATTACCACTTGTATAATTTTCTATTCACTTGAAGAACTGTGTTTATTATTTCTAATAGTTCAATTTGGCTGATTAATTTGATCAGCTTCTTTACACTGATATATTTTTTATCTTGCTTCATTTTTTTTAAAATGATTATTTGGCTGGATAGAGAATTATAGTTAATAATTGTTTCTTTGGTTTACATGCTAGTT, showing the sequence 100 bp upstream and downstream of the mutation marker, with the mutation marker in bold.

[0011] The application of the SNP markers in identifying the fineness and weight of cashmere cashmere, wherein the SNP markers include marker one and / or marker two.

[0012] Preferably, the method for identifying cashmere fineness and weight using SNP markers includes the following steps:

[0013] The marker 1 on chromosome 6 of cashmere goats was detected, and the cashmere goats that underwent a G-to-A mutation in marker 1 were fine-down cashmere goats;

[0014] The marker 2 was detected on chromosome 14 of fine-down cashmere goats, and the marker 2 underwent a T-to-C mutation, resulting in fine-down large-body cashmere goats.

[0015] The application of the SNP markers in goat genetic breeding, wherein the SNP markers include marker one and marker two.

[0016] Preferably, the mutation of marker one from G to A and marker two from T to C results in fine cashmere goats with large body weight.

[0017] Preferably, the cashmere goat includes the Inner Mongolian cashmere goat.

[0018] A genetic method for producing fine-haired, large-bodied cashmere goats involves selecting individuals with the AA genotype as parents to reduce the fineness of the cashmere in offspring and increase their body weight.

[0019] Preferably, the cashmere goat includes the Inner Mongolian cashmere goat.

[0020] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0021] This invention provides an SNP marker that simultaneously affects fine-down large cashmere goats. By selecting individuals with the AA genotype as the father or mother, the fineness of the down in the offspring can be reduced, and the weight of the offspring can be increased. Attached Figure Description

[0022] Figure 1 The variation characteristics of the Inner Mongolia cashmere goat population are shown in the following: (a) shows the whole genome distribution of the variation detected on the 29 chromosomes of the Inner Mongolia cashmere goat, with the X-axis representing the 29 autosomes and the Y-axis representing the number of variations; (b) shows the whole genome annotation of the genetic variation of the Inner Mongolia cashmere goat, with the X-axis representing various functional regions and the Y-axis representing the number of genetic variations in different functional regions; and (c) shows the statistical results of variant functional annotation of the CDS region, with the X-axis representing various functions and the Y-axis representing the number of genetic variations in various functions.

[0023] Figure 2 The principal component analysis plot is used, with the first three percentages of explained variance (PC1, PC2, and PC3) as the X, Y, and Z axes;

[0024] Figure 3 This is a distribution diagram of SNPs in a 1Mb window of a chromosome after quality control. The left Y-axis represents the chromosome name, and the upper X-axis represents the window size.

[0025] Figure 4 GWAS results for Inner Mongolia cashmere goat fines are shown in Manhattan Plots and QQ-plots, with significant genome-wide SNPs highlighted in red.

[0026] Figure 5 GWAS results for body weight of Inner Mongolian cashmere goats are shown in Manhattan Plots and QQ-plots, with significant genome-wide SNPs highlighted in red. Detailed Implementation

[0027] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods.

[0028] Example 1

[0029] Test animals and phenotypic sources:

[0030] All sheep used in this study were from Erlangshan Ranch (a national-level conservation farm for Erlangshan white cashmere goats) of Inner Mongolia Beiping Textile Co., Ltd. The cashmere goats raised were all of the Erlangshan white cashmere goat breed. The ranch has seven areas, each managed by a separate herder. Phenotypic records of cashmere diameter (CD) and weight were measured in 2022 (Table 1). Ear tissue samples were collected from 404 individual Erlangshan white cashmere goats. All samples were immediately preserved in liquid nitrogen after collection and then transported to the laboratory for long-term storage at -80℃.

[0031] Table 1. Description of traits of Inner Mongolian cashmere goats

[0032]

[0033] Adjustment of fixed effects

[0034] Fixed effects, also known as non-genetic factors, refer to all known and observable levels or grades that are possible in breeding. The non-genetic factors of Inner Mongolian cashmere goats mainly include nutritional level, year and season of performance measurement, flock, age, birth type, and sex. Since the nutritional level, measurement year, season, and birth type of the traits studied in this study are consistent, they are not considered. One-way ANOVA was conducted on the other three non-genetic factors (sex, age, and farm location) to test the significance of the explanatory variables. Because the Erlangshan white cashmere goats are raised in a group setting, the interaction effect between sex and farm location is zero. Therefore, this study only considers farm location and age as non-genetic factors, and age is divided into three categories: growing goats, one-year-old adult goats, and two-year-old adult goats.

[0035] Using SPSS (V25) software, the effects of age and field location on villous fineness and weight traits were tested by incorporating both factors into a multivariate linear model using type III sum of squares in analysis of variance (Table 2).

[0036] Table 2. Effects of age and farm location on cashmere fineness and weight traits in Inner Mongolia cashmere goats in a multifactorial linear model.

[0037]

[0038] Table 2 shows that age and field location have a significant impact on cellulite and body weight traits (P < 0.05). Therefore, age and field location are considered as fixed effects on cellulite and body weight traits in the GWAS model.

[0039] III. Genomic DNA Extraction and Quality Inspection

[0040] DNA was extracted from ear tissue samples using the phenol-chloroform method. The concentration of DNA, the ratio of the absorption wavelengths of the highest absorption peaks of nucleic acids, proteins, and phenolic substances (260 nm / 280 nm), and the ratio of the absorption wavelengths of the highest absorption peaks of carbohydrates (260 nm / 230 nm) were measured using a spectrophotometer (NanoDrop2000). The DNA quality was assessed using 1% agarose gel electrophoresis.

[0041] IV. Library Construction and Sequencing

[0042] After processing qualified genomic DNA samples, the genomic DNA was randomly fragmented into 350 bp fragments using a Covaris ultrasonic disruptor. The DNA fragments underwent end repair, poly(A) addition, sequencing adapter addition, purification, and PCR amplification to complete the entire library preparation process. After library construction, preliminary quantification was performed using Qubit 2.0, and qPCR was used to accurately quantify the effective concentration of the library to ensure library quality. After passing quality checks, sequencing was performed using the BGI MGI-T7 sequencing platform in PE150 mode.

[0043] V. Identification, screening, and annotation of variant markers

[0044] Raw reads were filtered into clean reads using FastP software (V0.20.0), and a genomic index was built on the reference genome. The quality-controlled clean reads were aligned with the goat reference genome (ARS1, GCF_001704415.1) using Burrows-Wheeler Aligner (BWA) software (V0.7.17). The aligned SAM files were converted into BAM files and sorted using SAMtools software (V1.8-20). The MarkDuplicates program in Genome Analysis Toolkit (GATK) software (V3.8) was used to remove duplicate data from the sorted BAM files to obtain the final BAM files. The final BAM files were indexed, and SNP variant detection was performed using the HaplotypeCaller module in GATK software. After obtaining the VCF files, the VariantFiltration module was used for filtering. The ANNOVAR software package is used to perform functional annotation on detected gene variations. Based on the location of the variation marker on the reference genome and the gene location information on the reference genome, the region in which the variation marker occurs in the genome (intergenic region, intronic region, or CDS region, etc.) and the impact of the variation (synonymous and non-synonymous mutations, etc.) can be obtained.

[0045] Whole-genome resequencing was performed on 404 individuals of the Erlangshan white cashmere goat, generating a total of 26835.11 Gb of raw reads. After variant detection and strict quality control, a total of 39,509,854 variants were identified in the Inner Mongolia cashmere goat population, such as... Figure 1 As shown in a. Then, all detected variations in Inner Mongolian cashmere goats were annotated using gene annotation files downloaded from the Ensembl database. The most frequent variations were found in intergenic regions (59.09%) and intronic regions (34.34%), such as... Figure 1 As shown in b, only 0.79% of them are located in the coding region, including 141,732 synonymous mutations and 120,751 non-synonymous mutations, such as... Figure 1 As shown in c. These potential functional variations provide valuable genetic resources for exploring the genetic structure and functional genes of Inner Mongolian cashmere goats.

[0046] VI. Data quality control and group stratification correction

[0047] The obtained genotyping data underwent quality control using Plink (V1.90) software, removing individuals with a genotype call rate <98%, SNPs with a call rate <98%, SNPs with a minimum allele frequency (MAF) <5%, and SNPs with a Hardy-Weinberg equilibrium (HWE) p-value <10⁻⁶. The first three principal components were calculated using the "--pca 3" parameter in Plink (V1.90) software and used as covariates to correct for population stratification in Inner Mongolian cashmere goats. PCA plots were generated using R (V3.6.0), and the results are shown below. Figure 2 As shown, the experimental sample exhibits population stratification and a high degree of genetic correlation among individuals. Therefore, the first three principal components need to be used as covariates to correct for the population stratification phenomenon in Inner Mongolian cashmere goats.

[0048] A total of 34,248,064 SNPs were used for quality control. 695,497 SNPs with a detection rate less than 98% (--geno 0.02) were removed. The remaining markers were then subjected to Hardy-Weinberg balance filtering, minimum allele frequency filtering, and individual detection rate filtering (--maf 0.05, --hwe 1e-6, --mind 0.02), resulting in 17,135,082 SNPs for subsequent analysis. These markers were evenly distributed across the 29 pairs of autosomes in goats. Figure 3 ).

[0049] VII. Genome-wide association analysis

[0050] Association analysis between SNPs and celluloid and body weight traits was performed using the fastGWA-mlm model in GCTA (V1.94.0beta) software.

[0051] y=X snp β snp +X c β c +g+e

[0052] Where y is an n×1 phenotypic vector; X snp It is a genotype vector, and its effect is β. snp ;X c It is the correlation matrix with fixed covariates (age, field location, and the first 3 PCA events), and its corresponding coefficient is β. c ;g is a vector of total genetic effects captured by the genetic relation matrix (GRM) derived from SNPs, g ~ N(0, ); π is a GRM vector derived from SNP, where all off-diagonal elements are set to 0; e is the residual vector, e ~ N(0, ).

[0053] Because the Bonferroni correction method is too stringent in determining the significance threshold for GWAS, this study adjusted the threshold for genome-wide significant association to P = 1 × 10⁻⁶. -6 The genomic expansion factor (λ) for the test statistics was calculated using the slope of a linear regression between the observed quantiles and the theoretical quantiles in R (V3.6.0). The calculated λ value was 1.023 for the fineness of the cashmere trait and 1.032 for the weight trait, indicating no genomic expansion. Based on resequencing data from 404 Erlangshan white cashmere goats, 35 significant SNP markers associated with the fineness of the cashmere trait were detected. These markers were located on chromosomes 3, 6, 10, 14, and 29, as shown in Table 3. Figure 4 As shown in Table 4, 44 significant SNP markers associated with body weight were detected. These markers are located on chromosomes 5, 8, 9, 10, 11, 14, 15, and 18, respectively. Figure 5 As shown.

[0054] Table 3 Significant SNP markers associated with fineness traits

[0055]

[0056] Table 4 Significant SNP markers associated with body weight trait

[0057]

[0058] 8. SNPs affecting cellulite and body weight traits

[0059] Further research on SNPs that reached genome-wide significance revealed that the G→A mutation at position 48854986 on chromosome 6 of the goat genome can significantly affect the fineness of cashmere in cashmere goats.

[0060] The association analysis between the SNP marker at position 48854986 on chromosome 6 of the goat genome and the fineness of the down is as follows:

[0061] Table 5. Polymorphism at position 48854986 on chromosome 6 of the goat genome.

[0062]

[0063] Note: Different letters indicate significant differences (p < 0.05), while the same letter indicates no significant differences (p > 0.05).

[0064] As shown in Table 5, individuals with the AA genotype have the finest downy hairs, while individuals with the GG genotype have the coarsest downy hairs.

[0065] In a genome-wide association analysis using a mixed linear model, the SNP molecular marker at position 48,854,986 on chromosome 6 of the goat genome reached a genome-wide significance level, indicating that this marker is significantly associated with the fineness of the cashmere hair in cashmere goats, and that when this marker is mutated to A, it is beneficial for cashmere goats to have finer cashmere hair.

[0066] Table 6. SNP gene frequency and genotype frequency at position 48854986 on chromosome 6 of the goat genome.

[0067]

[0068] As can be seen from Table 6, the gene frequency of A is greater than that of G, indicating that A is the dominant allele; the genotype frequencies of AA and AG are both higher than those of GG, indicating that AA is the dominant allele.

[0069] Further research on SNPs that reached genome-wide significance revealed that the T→C mutation at position 76025546 on chromosome 14 of the goat genome can significantly affect the weight trait of cashmere goats.

[0070] The association analysis between the SNP marker at position 76025546 on chromosome 14 of the goat genome and the body weight trait is as follows:

[0071] Table 7. Polymorphism at position 76025546 on chromosome 14 of the goat genome.

[0072]

[0073] Note: Different letters indicate significant differences (p < 0.05), while the same letter indicates no significant differences (p > 0.05).

[0074] Table 7 shows that individuals with the CC genotype have a larger body weight than those with the TT genotype. In the genome-wide association analysis using a mixed linear model, the SNP molecular marker at position 76025546 on chromosome 14 of the goat genome reached a genome-wide significance level, indicating that this marker is significantly associated with the body weight trait in cashmere goats, and that a mutation to C in this marker is beneficial for cashmere goats to have a larger body weight.

[0075] Table 8. SNP gene frequency and genotype frequency at position 48854986 on chromosome 6 of the goat genome.

[0076]

[0077] As can be seen from Table 8, the gene frequency of C is greater than that of T, indicating that C is the dominant allele; the genotype frequencies of CC and CT are both higher than those of TT, indicating that CC is the dominant allele.

[0078] Therefore, it can be seen that fine-wool cashmere goat breeds can be bred by the G→A mutation at position 48854986 on chromosome 6 of the goat genome, and large-sized cashmere goat breeds can be bred by the T→C mutation at position 76025546 on chromosome 14 of the goat genome. By selecting individuals with AA and CC genotypes as the father or mother, the fineness of the cashmere in the offspring can be reduced and the weight of the offspring can be increased.

[0079] It should be noted that when numerical ranges are mentioned in the claims of this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.

[0080] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0081] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. The application of reagents for detecting molecular markers in identifying the fineness and weight of cashmere cashmere, characterized in that, The molecular markers include marker one and marker two; The nucleotide sequence of the molecular marker containing marker one is shown in SEQ ID NO.1; The nucleotide sequence of the molecular marker containing marker two is shown in SEQ ID NO.2; The marker is located at position 48854986 on chromosome 6 of the cashmere goat genome, and a mutation from G to A has occurred. The marker 2 is located at position 76025546 on chromosome 14 of the cashmere goat genome and has undergone a T-to-C mutation. In marker one, individuals with genotype AA have finer villi compared to individuals with genotypes AG and GG. In marker two, individuals with genotypes CC and CT had a larger body weight than individuals with genotype TT. The cashmere goat mentioned is the Erlangshan White Cashmere Goat; The sequence version of the markers 1 and 2 is GCF_001704415.

1.

2. A method for selecting cashmere goats with fine cashmere and large body size, characterized in that, Individuals with marker AA and marker CC genotypes were selected as fine-haired and large-weight cashmere goats; The nucleotide sequence containing the molecular marker described in marker one is shown in SEQ ID NO.1; The nucleotide sequence containing the molecular marker described above is shown in SEQ ID NO.2; The marker is located at position 48854986 on chromosome 6 of the cashmere goat genome, and a mutation from G to A has occurred. The marker 2 is located at position 76025546 on chromosome 14 of the cashmere goat genome and has undergone a T-to-C mutation. The sequence version of the markers one and two is GCF_001704415.1; The cashmere goat in question is the Erlangshan White Cashmere Goat.