Primer combination and application thereof, and method for qualitatively and quantitatively detecting target fish based on eDNA
Through the combination of specific primer of crucian carp and PCR amplification, a standard plasmid curve was constructed, which solved the problems of time-consuming and labor-intensive and pollution error of traditional methods and achieved low-cost and high-sensitivity monitoring of aquatic organisms, especially suitable for population distribution of endangered species.
Patent Information
- Application Number
- CN202510150432.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-11
- Publication Date
- 2025-07-11
AI Technical Summary
Traditional methods are time-consuming and labor-intensive to detect rare, invasive or endangered species and are susceptible to environmental pollution. The eDNA technology has cross-contamination and man-made errors, making it difficult to meet the needs of aquatic biodiversity monitoring.
The combination of specific primers of crucian carp, combined with conventional DNA extraction and PCR amplification, a standard plasmid curve was constructed to achieve quantitative analysis of the presence and number of target species in water.
Low-cost and high-sensitivity aquatic biological monitoring is achieved, reducing environmental impacts, and suitable for population distribution monitoring of endangered species, reducing false positive and false negative results.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and particularly to primer combinations and their applications, and a method for qualitatively and quantitatively detecting target fish based on eDNA. Background Art
[0002] The eDNA technology refers to a technology for monitoring multi-biological communities in environmental samples by extracting DNA from environmental media (such as water, soil, sediment, etc.), performing PCR (polymerase chain reaction technology) amplification and high-throughput sequencing on specific DNA fragments of the genome. The basic operation process of this technology mainly includes links such as environmental sample collection, DNA extraction, DNA high-throughput sequencing, bioinformatics, and diversity analysis. Compared with traditional morphological biological monitoring methods, eDNA biological monitoring has core advantages such as simple sampling, high efficiency, small damage to organisms and the environment, high sample detection sensitivity, and low cost. It has been widely used in biodiversity surveys and ecological risk assessments such as biological invasions in various ecosystems such as rivers, lakes, estuaries, wetlands, and oceans.
[0003] The eDNA barcode technology and the PCR technology can be used to detect the presence of species, while the quantitative PCR (qPCR) technology can reflect the relative abundance of species or improve the sensitivity of species detection by detecting the DNA concentration of species. The eDNA barcode technology is particularly effective for detecting invasive and rare species. Even in habitats that are difficult to access, this method can be used to detect and map the distribution of species resources, so as to formulate effective management strategies.
[0004] Detecting and monitoring rare, invasive, or endangered species using traditional technical methods is a difficult task, often requiring a lot of time and effort. Moreover, repeated sampling using traditional survey methods is expensive and may cause irreparable damage to target biological species or habitats. The eDNA analysis technology provides an economical and effective non-invasive monitoring method for such species. In determining the distribution and damage degree of invasive species, the monitoring efficiency of using the eDNA technology is often very high and has been used for the invasion monitoring of agricultural alien harmful insects in recent years. It is relatively superior to traditional survey methods or equivalent to traditional survey methods in terms of the accuracy and reliability of target species. However, the eDNA technology also has some problems compared with traditional methods, such as being unable to directly obtain information such as the developmental stage and sex ratio of species, and being unable to distinguish dead individuals of species. Moreover, due to the sensitivity of eDNA, it is easily contaminated by external environmental pollution or cross-contamination between samples during sampling. In addition, human errors are likely to occur in the sample collection, extraction, and detection of eDNA.
[0005] It can be seen that the biodiversity of aquatic organisms is facing serious threats. Mastering the dynamic changes in the biodiversity of aquatic organisms is a prerequisite for achieving biodiversity conservation. Traditional research methods are difficult to meet the requirements due to reasons such as time-consuming, laborious, and huge investment. Summary of the Invention
[0006] In view of this, the present invention provides a method for accurately detecting the presence and biomass of target fish, the screening of primer combinations and their applications, taking crucian carp as an example. The present invention provides primer combinations and their applications, and a method for qualitatively and quantitatively detecting target fish based on eDNA. The present invention takes the target species (crucian carp) as the detection object, extracts environmental DNA from water samples using a conventional DNA extraction method, performs PCR amplification using universal primers and specific primers, and conducts sequencing analysis on the amplification products to determine whether the target species is contained in the water body. On this basis, a plasmid corresponding to the target fragment of the target species is constructed, and a standard curve of the copy number of the target species versus the cycle number is successfully drawn for quantitative analysis of the target species fish in unknown waters.
[0007] In order to achieve the above invention purposes, the present invention provides the following technical solutions:
[0008] The present invention provides the application of mitochondrial genomes Cytb, COI, and 12sRNA in screening fish-specific primers;
[0009] The present invention also provides a primer combination, including:
[0010] (I), the upstream primer has the nucleotide sequence shown in SEQ ID NO.9; and
[0011] the downstream primer has the nucleotide sequence shown in SEQ ID NO.10; or
[0012] (II), having a nucleotide sequence that encodes the same protein as the nucleotide sequence shown in (I), but is different from the nucleotide sequence shown in (I) due to the degeneracy of the genetic code; or
[0013] (III), having a nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (I) or (II), and having the same or similar function as the nucleotide sequence shown in (I) or (II); or
[0014] (IV), having a nucleotide sequence with at least 90% sequence homology to the nucleotide sequence described in (I), (II), or (III).
[0015] The present invention also provides the application of the primer combination in detecting fish species.
[0016] The present invention also provides the application of the primer combination in quantitatively detecting the number of fish.
[0017] In some specific embodiments of the present invention, the fish includes crucian carp.
[0018] The present invention also provides a kit, comprising the primer combination and PCR reaction reagents.
[0019] In some specific embodiments of the present invention, the PCR reaction system comprises:
[0020]
[0021] In some specific embodiments of the present invention, the annealing temperature of the PCR reaction includes 50 °C.
[0022] In some specific embodiments of the present invention, the PCR reaction program comprises:
[0023]
[0024] The present invention also provides the application of the kit in fish species detection and / or fish quantity detection.
[0025] The present invention also provides a method for qualitatively and quantitatively detecting target fish based on eDNA, detecting fish species and / or detecting fish quantity based on any of the following:
[0026] (I), the primer combination; and / or
[0027] (II), the kit.
[0028] In some specific embodiments of the present invention, the detection of fish species includes: taking a sample to be tested, extracting genomic DNA, performing PCR amplification, and sequencing to obtain fish species information;
[0029] The reaction system of the PCR amplification comprises:
[0030]
[0031] The reaction program of the PCR amplification comprises:
[0032]
[0033] In some specific embodiments of the present invention, the detection of fish quantity includes the following steps:
[0034] Step 1, constructing a plasmid, and establishing a standard curve according to the plasmid copy number and Ct value;
[0035] Step 2: Take the sample to be tested, extract genomic DNA as template DNA, obtain the Ct value of the sample to be tested through PCR reaction, and obtain the DNA concentration in the sample to be tested according to the standard curve and the Ct value of the sample to be tested;
[0036] The reaction system of the PCR reaction includes:
[0037]
[0038] The reaction procedure of the PCR reaction includes:
[0039]
[0040] The present invention includes, but is not limited to, providing the following beneficial effects:
[0041] Compared with the traditional fish monitoring and investigation methods, the environmental DNA analysis adopted in the present invention has low cost and high sensitivity. The sampling process will not damage the samples and is less affected by natural factors such as the environment, and is particularly suitable for the population distribution monitoring of endangered aquatic species. The present invention extracts genomic DNA in water through a conventional DNA extraction method, uses the screened specific primer crucian carp Cytb-2 for PCR verification, and performs sequencing analysis on its amplification product. The results show that the obtained product is the target species in the laboratory aquarium, establishes a qualitative analysis process for wild crucian carp in the water environment, and draws a standard curve of the copy number of crucian carp and the cycle number, and can realize the quantitative analysis of crucian carp in unknown waters. Description of the Drawings
[0042] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art.
[0043] Figure 1 Show the gel electrophoresis diagram for verification after PCR amplification and transformation;
[0044] Figure 2 Show the gel electrophoresis diagram of the common PCR amplification products of 9 pairs of primers;
[0045] Figure 3 Show the gel electrophoresis diagram of the common PCR amplification products after setting the temperature gradient;
[0046] Figure 4 Show the common PCR gel electrophoresis diagram of the aquarium water sample;
[0047] Figure 5 Show the standard curve of the copy number of crucian carp and the cycle number. Detailed Embodiments
[0048] The present invention discloses a primer combination and its applications, as well as a method for qualitatively and quantitatively detecting target fish based on eDNA. Those skilled in the art can draw on the content of this article and appropriately improve the process parameters to achieve it. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments. Relevant personnel can obviously make changes, or make appropriate changes and combinations to the methods and applications described herein without departing from the content, spirit, and scope of the present invention to implement and apply the technology of the present invention.
[0049] The present invention has established a reliable eDNA detection technical process and a quantitative detection method.
[0050] A large number of studies have shown that each organism will leave its own DNA molecules in the environment where it lives or moves in the following forms, such as tissue and organ shedding, cell lysis, secretions, and excretions, to form environmental DNA. These remaining substances will serve as evidence of the existence of these species in a certain environment. Currently, a large number of researchers have conducted species identification and monitoring by analyzing the DNA in these environments.
[0051] In this study, a conventional DNA extraction method was selected to extract genomic DNA from water samples, and specific primers were used to qualitatively detect target species. At the same time, a standard curve of the copy number of the target species versus the cycle number was plotted, which can be used for the quantitative analysis of target fish species in unknown waters and is of great significance for the monitoring and protection of aquatic organisms.
[0052] Compared with traditional fish monitoring and investigation methods, environmental DNA analysis has low cost and high sensitivity. The sampling process will not damage the samples and is less affected by natural factors such as the environment, and is particularly suitable for monitoring the population distribution of endangered aquatic species. However, the latest research results show that different methods can directly affect the detection rate of target species, and sometimes completely opposite results may occur. Therefore, the optimization of the experimental protocol is particularly important, and reducing false positive and false negative detection results is particularly important for the research of endangered species.
[0053] How to extract high-quality water body DNA is a key step in analyzing species in environmental DNA water samples. To obtain high-quality environmental DNA, this experiment adopted a conventional DNA extraction method to extract DNA that met the experimental requirements, and at the same time detected the target species in the aquarium.
[0054] In this experiment, only qualitative detection was performed on the target species in the water body, and a conclusion of whether it exists or not was finally given. In the subsequent research, a plasmid can be constructed using the target fragment to draw a standard curve of the target species, and through real-time fluorescence quantitative analysis, the yield of the target species in the water body can be detected.
[0055] Method for Monitoring Fishes in Unknown Waters Based on eDNA
[0056] 1. Collection of environmental DNA samples
[0057] At each sampling point, 1 L of surface water (20 cm below the water surface) and 1 L of bottom water (gently pull the water sampler when it touches the bottom to avoid stirring up silt) were collected using a 2.5 L water sampler, and then mixed and stored in a sterilized 2 L wide-mouth bottle. All samples were vacuum filtered within 24 h using a 0.45 μm mixed cellulose ester filter membrane (MCE; Whatman). The glass suction filtration funnel was soaked in 10% sodium hypochlorite disinfectant for 30 minutes and rinsed with pure water before each filtration to prevent cross-contamination between samples. To evaluate whether there was exogenous DNA contamination, 1 negative control was set for each filtration. After sample filtration, the filter membranes enriched with environmental DNA were respectively placed into 5 μL centrifuge tubes, stored at -20 °C and sent to the laboratory for DNA extraction as soon as possible.
[0058] 2. DNA extraction
[0059] In the current latest research, commercial kits are basically used for eDNA extraction. Among them, DNeasy Blood & Tissue Kit (QIAGEN) and Mo Bio Power Water DNA Extraction Kit are two kits that are commonly used for extracting eDNA from water samples. In this study, the DNeasy® PowerWater® Kit from QIAGEN was used to extract DNA samples from filter membranes. The specific process was as follows: The filter membranes obtained by filtering 2 L of water samples were cut, lysate was added, and then shaken on a vortex oscillator. After centrifugation, the supernatant was taken and added to subsequent solutions for treatment, and then transferred to a centrifugation column. After the centrifugation column was washed with various buffers, 100 μL of eluent was added for elution to obtain eDNA samples. The extracted eDNA samples were stored frozen at -80 °C. Samples at different detection points were stored separately to avoid cross-contamination. The quality of DNA was detected by 1% agarose gel electrophoresis to check the electrophoresis bands. In addition, 2 μL of DNA was taken and measured for DNA concentration using a Qubit® 3.0 fluorometer. The quality of the extracted DNA was detected by checking the DNA electrophoresis bands and measuring the DNA concentration.
[0060] 3. PCR amplification
[0061] The selection of PCR primers and DNA barcode regions plays a decisive role in the accuracy of subsequent experimental results in the application of eDNA technology. In the monitoring of fish diversity in unknown waters, universal primers designed for fish taxa are usually used. For fish, mitochondrial genes such as Cyt b, 12S rRNA, or 16S rRNA have been studied, but 12S rRNA has been proven to be superior to other genes. In this study, a universal fish primer designed by previous researchers for a hypervariable region (163 - 185 bp) of the 12S rRNA gene was selected. This primer has sufficient information to classify fish at the family, genus, and species levels. The primer sequences are MiFish-U-F (SEQ ID NO.23): 5’-GTCGGTAAAACTCGTGCCAGC-3’; MiFish-U-R (SEQ ID NO.24): 5’-CATAGTGGGGTATCTAATCCCAGTTTG-3’. PCR was performed in 2 rounds, and the amplification system was 30 μL each time. The specific process is as follows:
[0062]
[0063] PCR samples included collected samples and negative control samples (pure water). The primer amplification results were detected using 2% agarose gel, and the amplification products were sent to a sequencing company (Sangon Biotech Co., Ltd., Shanghai) for sequencing.
[0064] 4. DNA High-throughput Sequencing
[0065] When monitoring species diversity using metabarcoding, high-throughput sequencing (NGS) is often more appropriate, mainly because high-throughput sequencing is fast, has a large amount of data, and high accuracy. In this study, the successfully amplified fragments were sent to Sangon Biotech (Shanghai) Co., Ltd. After ligating sequencing adapters to construct a library, the library size was detected by 2% agarose gel electrophoresis. All samples were mixed in equal volumes at a ratio of 1:1 using a Qubit 3.0 fluorescence quantifier to determine the library concentration. High-throughput sequencing was performed using the Illumina Miseq™ platform (USA). The raw sequencing data files were analyzed by base calling to convert them into raw sequencing sequences (Sequenced Reads). After removing the primer adapter sequences during sequencing, the obtained PE reads were assembled according to the overlap relationship. The paired reads were assembled into one sequence. According to the barcode sequences of each sample and the primer sequences, the data of each sample were segmented from the assembled data, and the sequence direction was corrected. After distinguishing the samples, quality control and filtering were performed on the sequence quality, and finally the sequencing results of each sample were obtained.
[0066] 5. Bioinformatics Analysis
[0067] Bioinformatics analysis, which is also the monitoring of target species, mainly includes the following processes: data splitting, sequence screening, splicing, OTU clustering, sequence alignment, and species annotation. Among them, OTU is the clustering of target sequences of species DNA information, and the clustering is an operational taxonomic unit, that is, OTUs (Operational Taxonomic Units). The species are annotated with the representative sequences formed after clustering to obtain the fish classification list information. Non-redundant sequences are extracted from the sequencing results of each sample, and non-repetitive single sequences are removed after merging the de-redundant sequences of all samples; the non-redundant sequences are clustered into OTUs according to 97% similarity, and chimeras are removed during the clustering process to finally obtain the representative sequences of OTUs. All optimized sequences are aligned to the representative sequences of OTUs, and sequences with a similarity of more than 97% to the representative sequences are selected to complete the OTU clustering. The sequences are aligned with the NCBI (National Center for Biotechnology Information, ncbi.nlm.nih.gov) database using BLAST (Basic Local Alignment Search Tool), the best alignment results of the sequences are selected, and the alignment results are filtered. The OTUs are annotated with sequences with a similarity > 97% for subsequent classification.
[0068] 6. Fish diversity analysis
[0069] In recent years, the eDNA technology has gradually been used to solve specific scientific problems, such as the dynamic changes in the spatial and temporal distribution of fish communities (the relevant diversity indices are calculated using the vegan package in R language, such as the Shannon-Wiener diversity index (H’) and the Pielou evenness index (D), and ANOSIM is used for differential analysis), the relative abundances of various species in the fish community (the number of reads obtained by high-throughput sequencing represents the relative abundances of each fish in the environmental DNA), the phylogenetic diversity and functional diversity of the fish community, etc.
[0070] Unless otherwise specified, the primer combinations and their applications provided by the present invention, and the raw materials and reagents used in the method for qualitatively and quantitatively detecting target fish based on eDNA can be purchased from the market.
[0071] The present invention will be further described below in conjunction with embodiments:
[0072] Embodiment
[0073] 1. Collection of environmental DNA samples
[0074] Surface water and bottom water (1 L each) were collected at various sampling points using a 2.5-L water sampler, and then mixed and stored in a sterilized 2-L wide-mouth bottle. All samples were vacuum filtered within 24 h using a commercially available 0.45-μm mixed cellulose filter membrane. The glass suction filtration funnel was soaked in 10% sodium hypochlorite disinfectant for 30 minutes and rinsed thoroughly with pure water before each suction filtration to prevent cross-contamination between samples. To evaluate the presence of exogenous DNA contamination, avoid false positives caused by contamination at the water sample and quantitative PCR sample levels, and false negatives caused by failure to capture eDNA in on-site samples or the sensitivity of laboratory tests, one positive and one negative control were set up for each filtration. After sample filtration, the filters enriched with environmental DNA were placed into 5-μL centrifuge tubes, stored at -20 °C, and sent to the laboratory for DNA extraction as soon as possible.
[0075] 2. Detection of Extracted DNA
[0076] The extracted genomic DNA (using the DNeasy® PowerWater® Kit from QIAGEN) was detected for its concentration and purity using an ultraviolet spectrophotometer. The concentration and purity of the extracted DNA met the requirements, with the OD260 / OD280 of the DNA between 1.80 and 2.00, and the gel electrophoresis test was qualified. After the concentration and purity of the extracted tissue DNA met the requirements, the next experiment was carried out.
[0077] 3. Primer Design, Primer Sequence, and Annealing Temperature Screening
[0078] To obtain specific primers for crucian carp and be able to distinguish them from other fish species, based on the relevant information of the mitochondrial genomes of crucian carp COⅠ (accession number: MZ870702.1), Cytb (accession number: EF055472.1), 12sRNA (accession number: KM657134.1) and its closely related fish species in the NCBI database, the Primerpremier5.0 software was used to design the corresponding primers, and the corresponding primer sequence information is shown in Table 1. Using the genomic DNA of wild crucian carp as a template, the primers in Table 1 below were used for amplification, and the appropriate primer sequences and corresponding annealing temperatures were screened from these primers.
[0079] Table 1 Crucian Carp Amplification Primers
[0080]
[0081] 4. PCR Reaction System and Amplification Program
[0082] According to the sequences of the primers screened in Table 1 and the corresponding annealing temperatures, set up the PCR reaction system and amplification program for environmental DNA in water. The reaction system is as follows: 10×PCR Buffer 4.0 μL, 2.5 mM dNTPs 0.5 μL, 10 μM Forward Primer 1 μL, 10 μM Reverse Primer 1 μL, rTaq 0.2 μL, double-distilled water 16.3 μL, template DNA 2 μL, and the total system is 25 μL per tube.
[0083] The amplification program is set according to the annealing temperature screened in 3: The first step is 95 °C for 5 min; the second step is 95 °C for 30 s, 50 °C for 30 s, 72 °C for 30 s, for 35 cycles; the third step is 72 °C for 10 min; the fourth step is to store at 4 °C.
[0084] 5. Detection and sequencing of ordinary PCR products
[0085] Use 2% agarose gel electrophoresis to detect the PCR amplification products, and send the amplification products to a qualified sequencing company for sequencing.
[0086] 6. Detection of wild crucian carp in the aquarium
[0087] Extract the genomic DNA in the laboratory aquarium according to the method of the kit in 2, set up the corresponding detection process according to the reaction system and conditions in 3, detect the corresponding amplification products by gel electrophoresis, and send them to a qualified sequencing company for sequencing.
[0088] 7. Drawing of the standard curve for the copy number and cycle number of crucian carp
[0089] Use the verified primers and use the extracted fish genomic (crucian carp) DNA as a template for PCR amplification. The amplification reaction system is a 25 μL system: 12.5 μL Mix (containing buffer), 9.5 μL ddH2O, 1 μL template DNA, 1 μL each of the upstream and downstream primers. The amplification conditions are: pre-denaturation at 94 °C for 1 min, denaturation at 94 °C for 30 s, annealing at 56 °C for 30 s, extension at 72 °C for 30 s, for 30 cycles, and final extension at 72 °C for 3 min. After the amplification products are subjected to 1.2% gel electrophoresis ( Figure 1 ), the target fragment is ligated to the plasmid vector through TA cloning, and after blue-white screening, it is identified by sequencing to complete the construction of the plasmid standard product, measure the concentration of the plasmid standard product, and calculate the copy number. Dilute the plasmid standard product 10-fold, 100-fold, 1000-fold, 10 4 times, 10 5 times, 10 6 times, and set 3 replicates for each gradient. Select the appropriate standard product interval through qPCR pre-experiment and obtain the amplification efficiency, and draw the standard curve according to the amplification efficiency.
[0090] The qPCR reaction system is as follows: 12.5 μL of 2×Fast Start Universal Probe Master (ROX), 0.2 μL of 10 μM Probe, 0.4 μL of 10 μM Forward Primer, 0.4 μL of 10 μM Reverse Primer, 2 μL of template DNA, and 9.5 μL of PCR-grade water, with a total volume of 25 μL. The reaction conditions for real-time fluorescence PCR of crucian carp plasmid are: 2 min at 50 °C, 10 min at 95 °C; 15 s at 95 °C, 1 min at 50 °C, for 40 cycles for amplification reaction.
[0091] Effect Example 1: Detection of eDNA in Unknown Waters
[0092] Using the eDNA from the unknown waters collected in the examples as the positive sample, and the silver carp and bitterling tissues as the negative samples, ordinary PCR amplification was performed with the corresponding primers in Table 1 respectively. The gel electrophoresis diagram of the PCR products is as Figure 2 shown. According to the results of ordinary PCR agarose gel electrophoresis of 9 pairs of primers, the primer sequences that can amplify the target fragment among the above 9 pairs of primers were further optimized.
[0093] Optimizing the ordinary PCR reaction conditions: Experiments were carried out at four different temperature gradients of 50 °C, 55 °C, 60 °C, and 65 °C. The reaction system was the same as before. Agarose gel electrophoresis was performed on the PCR products of different temperature gradients after optimization. The gel electrophoresis diagram is as Figure 3 shown.
[0094] It can be seen from the results of ordinary PCR agarose gel electrophoresis that under the condition of an annealing temperature of 50 °C, the primer specificity and amplification efficiency of the crucian carp Cytb-2 are more single and the amplification efficiency is higher than those of other primers.
[0095] Effect Example 2: Verification of Ordinary PCR for Wild Crucian Carp in Aquarium
[0096] Genomic DNA was extracted from the water sample in the aquarium, and at the same time, ordinary PCR verification was carried out. The gel electrophoresis of its amplification products is as Figure 4 shown. The amplification results show obvious amplification bands, and the size of the target band is consistent with the expected size.
[0097] Effect Example 3: Sequencing Results
[0098] To further verify the amplification products, the amplification products were sent to a qualified sequencing company for sequencing. The sequence is:
[0099] Water sample from the first-floor aquarium 3:
[0100] SEQ ID NO.19: GTAAGGGCTAGGAGTATAATTACGAACCCAAGGAGGTCTTTGTATAAAAAGTATGGGTGGAAAGAAATTTTGTCTGCGTCTGAGTTCAGTCCGATGGGGTTATTTGATCCTGTTTCGTGGAGAAACAGTAGGTGAATGACAGTAGCGGCGGCAATAACAAATGGTAGTAG
[0101] Water sample 4 from the first-floor aquarium:
[0102] SEQ ID NO.20: GTAAGGGCTAGGAGTATAATTACGAACCCAAGGAGGTCTTTGTATGAAAAGTATGGGTGGAAAGAAATTTTGTCTGCGTCTGAGTTCAGTCCGATGGGGTTATTTGATCCTGCTTCGTGGAGAAACAGTAGGTGAATGACAGTAGCGGCGGCAATAACAAATGGTAGTAGG
[0103] Water sample 5 from the first-floor aquarium:
[0104] SEQ ID NO.21: CCTACTACCATTTGTTATTGCCGCCGCTACTGTCATTCACCTACTGTTTCTCCACGAAACAGGATCAAATAACCCCATCGGACTGAACTCAGACGCAGACAAAATTTCTTTCCACCCATACTTTTCATACAAAGACCTCCTTGGGTTCGTAATTATACTCCTAGCCCTTAC
[0105] Water sample 6 from the first-floor aquarium:
[0106] SEQ ID NO.22: GTAAGGGCTAGGAGTATAATTACGAACCCAAGGAGGTCTTTGTATGAAAAGTATGGGTGGAAAGAAATTTTGTCTGCGTCTGAGTTCAGTCCGATGGGGTTATTTGATCCCGTTTCGTGGAGAAACAGTAGGTGAATGACAGTAGCGGCGGCAATAACAAATGGTAGTAGG
[0107] Homology alignment was performed with reference to the NCBI database, and the alignment result was consistent with the target sequence designed initially, indicating that the DNA remaining in the water sample when the crucian carp was moving in the laboratory aquarium was successfully extracted in this experiment.
[0108] Effect Example 4 Standard Curve of Copy Number and Cycle Number of Crucian Carp
[0109] The standard curve of the copy number and cycle number of crucian carp is as Figure 5 shown, and the corresponding equation is: Y = -3.721X + 45.78 (where R 2 = 0.999). In the later experiment, the DNA concentration in the unknown water body can be measured according to the Ct value during the real-time fluorescence PCR reaction process.
[0110] The above is only the preferred embodiment of the present invention. It should be pointed out that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.
Claims
1. A primer combination, characterized in that, Comprising: (I), the upstream primer has a nucleotide sequence as shown in SEQ ID NO.9; and the downstream primer has a nucleotide sequence as shown in SEQ ID NO.10; or (II), having a nucleotide sequence encoding the same protein as that shown in (I), but different from the nucleotide sequence shown in (I) due to the degeneracy of the genetic code; or (III), having a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in (I) or (II), and having the same or similar function as the nucleotide sequence shown in (I) or (II); or (IV), having a nucleotide sequence with at least 90% sequence homology to the nucleotide sequence described in (I), (II) or (III).
2. Use of the primer combination according to claim 1 in detecting fish species.
3. Use of the primer combination according to claim 1 in quantitatively detecting the number of fish.
4. The application according to claim 2 or 3, characterized in that, The fish includes crucian carp.
5. Kit, characterized in that, Comprising the primer combination according to claim 1 and PCR reaction reagents.
6. The kit according to claim 5, characterized in that, The PCR reaction system includes:
7. The kit according to claim 5 or 6, characterized in that, The annealing temperature of the PCR reaction includes 50°C.
8. The kit according to any one of claims 5 to 7, characterized in that The PCR reaction procedure includes:
9. Use of the kit according to any one of claims 5 to 8 in detecting fish species and / or detecting the number of fish.
10. A method for qualitatively and quantitatively detecting target fish based on eDNA, characterized in that, Detecting fish species and / or detecting the number of fish based on any of the following: (I), the primer combination according to claim 1; and / or (II), the kit according to any one of claims 5 to 8.
Citation Information
Cited By
Fish eDNA macro bar code PCGs primer group and application thereof
CN122060877A