Method for distinguishing black-spot pike and white-spot pike
Through molecular biology methods, specific DNA sequence primers and sequencing and alignment techniques are used to solve the problem that traditional morphological methods are difficult to distinguish between pikes and white pikes in the embryonic and larval stages, and achieve rapid and accurate germplasm identification, supporting germplasm resource management and protection.
Patent Information
- Application Number
- CN202510474152.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-16
- Publication Date
- 2025-07-11
AI Technical Summary
Traditional morphological methods are difficult to accurately distinguish between pikes and white pikes in the embryonic and larval stages, especially when there is hybridization or gene penetration between populations, which leads to difficulties in identifying germplasm resources, affecting the construction of germplasm resource databases, supervision of proliferation and release, and protection of endangered populations.
Using molecular biology methods, the PCR amplification, agarose gel electrophoresis and sequencing were used to distinguish pikes from white pikes by designing specific DNA sequence primers for PCR amplification, agarose gel electrophoresis and sequencing.
Fast and accurate germplasm identification have been achieved, and the identification accuracy has been improved, and germplasm identification, fishery resource investigation and seedling purity verification have been supported.
Smart Images

Figure CN120290741A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a method for distinguishing fish species. Background Art
[0002] In freshwater ecosystems, the Amur pike (Esox reichertii) and the northern pike (Esox lucius), as predatory fish with important ecological and economic value, often pose difficulties in taxonomic identification due to their similar morphological characteristics. The Amur pike is mainly distributed in cold water areas in East Asia, while the northern pike, as a widespread species, is found throughout Eurasia and North America. This geographical isolation has led to the formation of unique genetic structures, physiological characteristics, and significant differences in adaptive evolution during their long-term evolution. Traditional morphological identification methods mainly rely on phenotypic indicators such as body surface markings, but this method is limited to sub-adult and adult stages and cannot be effectively applied in embryonic and larval stages. Especially when there is natural hybridization or gene introgression caused by artificial introduction among populations, it is more difficult to meet the needs of accurate identification of germplasm resources solely relying on morphological characteristics, which poses severe challenges to the construction of germplasm resource banks, the supervision of stock enhancement, and the protection of endangered populations.
[0003] Therefore, by screening the germplasm-specific DNA sequence differences between the Amur pike and the northern pike, developing germplasm identification markers based on molecular genetics, and constructing a rapid and accurate identification method with this, it becomes an effective way to solve the above problems. Summary of the Invention
[0004] The present invention provides a method for distinguishing the Amur pike from the northern pike to solve the shortage in the germplasm identification technology of the Amur pike and the northern pike. The present invention is a discrimination method based on molecular biology, aiming to rapidly and accurately identify the germplasm of the Amur pike and the northern pike.
[0005] The method for distinguishing the Amur pike from the northern pike according to the present invention is carried out according to the following steps:
[0006] I. Extract genomic DNA of the sample to be identified;
[0007] II. Perform PCR amplification using the genomic DNA in step I as a template. In the PCR amplification system, the upstream primer of the molecular marker is 5’-AGGCTTGGTCCTGACCTTAC-3’, and the downstream primer of the molecular marker is 5’-TGGCTGGCACGAGTTTTACC-3’;
[0008] III. Perform 1% concentration agarose gel electrophoresis on the PCR product, and then perform gel extraction to purify the target band;
[0009] Fourth, the purified PCR product was sequenced and the sequencing results were compared with the identification sequence of black-spotted dogfish 5'-CTCCGCACCCCTGTGAGGATGCCCTTAATCCCCTGCCCGGGGCTGAGGAGCTGGC ATCAGGCACACATTGTAGCCCAAGACGCCTTGCTAAGCCACACCCCTATGGGTATTC AGCAGTGATAAATATTAAGTGATAAGCGAAAGCTTGACTTAGTTATTGTTAAAAGGG CCGGTAAAACTC-3' was compared with the identification sequence of northern pike 5'-CTCCGCACCCCTGTGAGGATGCCCTTAATCCCCTGCCCGGGGCTGAGGAGCTGGCATCAGGCACACATTGTAGCCCAAGACGCCTTGCTAAGCCACACCCCTACGGGTACTCAGCAGTGATAAATATTAAGTGATAAGCGAAAGCTTGACTTAGTTATTGTTAAAAGGGCCGGTAAAACTC-3', and the resulting 181 bp homologous sequence was counted from the 5' end to the 3' end. The samples with the two bases C and C at the 104th and 110th bp that were exactly the same as the identification sequence of northern pike could be identified as northern pike, and the samples with the two bases T and T at the 104th and 110th bp that were exactly the same as the identification sequence of black-spotted pike could be identified as black-spotted pike. Based on this, the distinction between black-spotted pike and northern pike was achieved.
[0010] The present invention uses molecular markers to identify black-spotted pike and white-spotted pike, which has the characteristics of high efficiency, rapidity, stable results and high accuracy. It will provide core technical support for germplasm identification, fishery resource investigation, seedling purity verification and reproduction and release supervision of black-spotted pike and white-spotted pike. BRIEF DESCRIPTION OF THE DRAWINGS
[0011] Figure 1 The results of identification of white pike and black-spotted pike in Example 1 are shown in FIG. DETAILED DESCRIPTION
[0012] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.
[0013] It should be noted that, in the absence of conflict, the embodiments of the present invention and the features in the embodiments may be combined with each other.
[0014] Embodiment 1: The method for distinguishing Esox reichertii from Esox lucius is carried out according to the following steps:
[0015] 1. Extract genomic DNA of the sample to be identified;
[0016] 2. Use the genomic DNA in step 1 as a template for PCR amplification. In the PCR amplification system, the upstream primer of the molecular marker is 5’-AGGCTTGGTCCTGACCTTAC-3’, and the downstream primer of the molecular marker is 5’-TGGCTGGCACGAGTTTTACC-3’;
[0017] 3. Perform agarose gel electrophoresis on the PCR product at a concentration of 1%, and then perform gel extraction to purify the target band;
[0018] 4. Sequence the purified PCR product, and compare the sequencing result with the identification sequence of Esox reichertii 5’-CTCCGCACCCCTGTGAGGATGCCCTTAATCCCCTGCCCGGGGCTGAGGAGCTGGC ATCAGGCACACATTGTAGCCCAAGACGCCTTGCTAAGCCACACCCCTATGGGTATTC AGCAGTGATAAATATTAAGTGATAAGCGAAAGCTTGACTTAGTTATTGTTAAAAGGG CCGGTAAAACTC-3’ and the identification sequence of Esox lucius 5’-CTCCGCACCCCTGTGAGGATGCCCTTAATCCCCTGCCCGGGGCTGAGGAGCTGGCATCAGGCACACATTGTAGCCCAAGACGCCTTGCTAAGCCACACCCCTACGGGTACTCAGCAGTGATAAATATTAAGTGATAAGCGAAAGCTTGACTTAGTTATTGTTAAAAGGGCCGGTAAAACTC-3’. For the obtained 181bp homologous sequence, count from the 5’ end to the 3’ end. A sample with two bases at positions 104 and 110 that are completely identical to the identification sequence of Esox lucius and are C and C respectively can be identified as Esox lucius, and a sample with two bases at positions 104 and 110 that are completely identical to the identification sequence of Esox reichertii and are T and T respectively can be identified as Esox reichertii. Based on this, the distinction between Esox reichertii and Esox lucius is achieved.
[0019] Specific Embodiment 2: The difference between this embodiment and Specific Embodiment 1 is as follows: In Step 2, the PCR amplification reaction system is 50 μL: 25 μL of 2× Taq PCR mix, 3 μL of genomic DNA of the sample to be identified, 2 μL each of the upstream and downstream primers of the molecular marker, and the rest is made up with ddH2O; The PCR reaction is as follows: pre-denaturation at 95 °C for 3 min, and then 30 cycles of denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s, and extension at 72 °C for 30 s. After 30 cycles of reaction, a final extension reaction is carried out at 72 °C for 2 min, and finally long-term incubation is carried out at 12 °C. Other steps and parameters are the same as those in Specific Embodiment 1.
[0020] Specific Embodiment 3: The difference between this embodiment and Specific Embodiment 1 is as follows: In Step 3, agarose gel electrophoresis: Add 5 μL of 10× loading buffer to each PCR product, vortex and mix well, then briefly centrifuge. Load the PCR product onto a 1% agarose gel for electrophoresis for 40 min, with the voltage controlled at 180 V. Finally, cut the gel containing the target band under the ultraviolet light of the gel imaging system. Other steps and parameters are the same as those in Specific Embodiment 1.
[0021] Specific Embodiment 4: The difference between this embodiment and Specific Embodiment 1 is as follows: The method of splicing in Step 4 is to automatically align the sequencing results using UGENE software. The specific method is as follows: Open the UGENE software, select "Multiple sequence alignment" in the toolbox, then select the "Align with ClustalW" method, then integrate the sequencing results in FASTA format and the identification sequences of Esox reichertii and Esox lucius, then import them into the software and set the file name of the output file, and finally click "Align" to automatically splice out the homologous sequences. Other steps and parameters are the same as those in Specific Embodiment 1.
[0022] Example 1 Identification of Esox reichertii and Esox lucius using the method of the present invention
[0023] 1. Sample collection
[0024] Select 30 adult fish of known Esox reichertii and Esox lucius respectively, cut 1 cm 2 caudal fin and store it in absolute ethanol;
[0025] 2. Extraction of genomic DNA of the sample
[0026] Take the fin samples obtained in Step 1 and use a tissue genomic DNA extraction kit to extract the genomic DNA of the samples respectively;
[0027] 3. PCR amplification
[0028] Perform a PCR reaction using the genomic DNA obtained in step 2. In the PCR amplification system, the upstream primer of the molecular marker is 5’-AGGCTTGGTCCTGACCTTAC-3’, and the downstream primer of the molecular marker is 5’-TGGCTGGCACGAGTTTTACC-3’. The PCR amplification reaction system is 50 μL: 25 μL of 2× Taq PCR mix, 3 μL of genomic DNA of the sample to be identified, 2 μL of each of the upstream and downstream primers of the molecular marker, and the rest is supplemented with ddH2O. The PCR reaction is: pre-denature at 95 °C for 3 min, then perform 30 cycles of denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s, and extension at 72 °C for 30 s. After completing 30 cycles of reaction, perform a final extension reaction at 72 °C for 2 min, and finally keep it at 12 °C for long-term incubation.
[0029] 4. Gel electrophoresis of PCR products
[0030] Add 5 μL of 10× loading buffer to each PCR product, vortex and mix well, then centrifuge briefly. Load the PCR products onto a 1% agarose gel for 40 min of electrophoresis, control the voltage at 180 V, and finally cut the gel containing the target band under the ultraviolet light of the gel imaging system.
[0031] 5. Purification, sequencing and splicing of PCR products
[0032] Use an agarose gel purification kit to purify the PCR products, and then perform single-direction sequencing on the purified PCR products. Finally, use the UGENE software to automatically align the sequencing results. The specific method is as follows: Open the UGENE software, select "Multiple sequence alignment" in the toolbox, then select the "Align with ClustalW" method, then integrate the sequencing results in FASTA format and the identification sequences of Esox reichertii and Esox lucius, then import them into the software and set the file name of the output file, and finally click "Align" to automatically splice out the homologous sequences.
[0033] Figure 1 This is the identification result of Esox lucius and Esox reichertii in this example. From Figure 1 It can be seen that for the 181 bp homologous sequence obtained in this example, counting from the 5' end to the 3' end, the two bases at positions 104 and 110 of the 30 Esox lucius samples are C and C respectively, which are completely consistent with the Esox lucius identification sequence. The two bases at positions 104 and 110 of the 30 Esox reichertii samples are T and T respectively, which are completely consistent with the Esox reichertii identification sequence. The identification conclusion of the method of the present invention is completely consistent with the actual situation, proving that the method of the present invention is accurate.
Claims
1. A method for distinguishing Esox reichertii from Esox lucius, characterized in that, The method for differentiating Esox reichertii from Esox lucius is carried out according to the following steps:
1. Extract the genomic DNA of the sample to be identified; 2. Using the genomic DNA in step 1 as a template for PCR amplification. In the PCR amplification system, the upstream primer of the molecular marker is 5’-AGGCTTGGTCCTGACCTTAC-3’, and the downstream primer of the molecular marker is 5’-TGGCTGGCACGAGTTTTACC-3’; 3. Perform 1% agarose gel electrophoresis on the PCR product, and then perform gel extraction to purify the target band; 4. Sequence the purified PCR product, and compare the sequencing results with the identification sequence of Esox reichertii 5’-CTCCGCACCCCTGTGAGGATGCCCTTAATCCCCTGCCCGGGGCTGAGG AGCTGGCATCAGGCACACATTGTAGCCCAAGACGCCTTGCTAAGCCACACCCCTATGG GTATTCAGCAGTGATAAATATTAAGTGATAAGCGAAAGCTTGACTTAGTTATTGTTAAA AGGGCCGGTAAAACTC-3’ and the identification sequence of Esox lucius 5’-CTCCGCACCCCTGTGAGGATGCCCTTAATCCCCTGCCCGGGGCTGAGG AGCTGGCATCAGGCACACATTGTAGCCCAAGACGCCTTGCTAAGCCACACCCCTACGGGTACTCAGCAGTGATAAATATTAAGTGATAAGCGAAAGCTTGACTTAGTTATTGTTAAAAGGGCCGGTAAAACTC-3’. Assemble the obtained 181bp homologous sequence, count from the 5’ end to the 3’ end. Samples with two bases at positions 104 and 110 which are C and C respectively and are completely consistent with the identification sequence of Esox lucius can be identified as Esox lucius. Samples with two bases at positions 104 and 110 which are T and T respectively and are completely consistent with the identification sequence of Esox reichertii can be identified as Esox reichertii. Based on this, the differentiation between Esox reichertii and Esox lucius is achieved.
2. The method for distinguishing Esox reichertii from Esox lucius according to claim 1, wherein In step 2, the PCR amplification reaction system is 50 μL: 2×Taq PCR mix 25 μL, genomic DNA of the sample to be identified 3 μL, 2 μL each of the upstream and downstream primers of the molecular marker, and the rest is made up with ddH2O; The PCR reaction is: pre-denaturation at 95°C for 3 min, and then 30 cycles of denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s. After completing 30 cycles of reaction, a final extension reaction is carried out at 72°C for 2 min, and finally long-term incubation is carried out at 12°C.
3. A method for distinguishing Esox reichertii from Esox lucius according to claim 1, characterized in that, Agarose gel electrophoresis in Step 3: Add 5 μL of 10× loading buffer to each PCR product, vortex and mix well, then centrifuge briefly. Load the PCR products onto a 1% agarose gel and perform electrophoresis for 40 min at a voltage of 180 V. Finally, cut out the gel containing the target band under the ultraviolet light of the gel imaging system.
4. The germplasm identification marker and identification method of Salmo trutta fario as described in claim 1, characterized in that, The method of splicing in Step 4 is to automatically align the sequencing results using UGENE software. The specific method is as follows: Open the UGENE software, select "Multiple sequence alignment" in the toolbox, then select the "Align with ClustalW" method. Then integrate the sequencing results in FASTA format and the identification sequences of Esox reichertii and Esox lucius, import them into the software and set the file name of the output file. Finally, click "Align" to automatically splice out the homologous sequences.
Citation Information
Patent Citations
Special growth promoting formula feed for northern pike
CN106036011A
Identification method of Bletilla ochracea
CN107523644A
Molecular technology-based sex determination method for pike vibrio molitor
CN114164262A