Marker and method for identifying germplasm of Salmonella salmon
By developing a germplasm identification and marking method based on molecular genetics, and using specific PCR primers and sequencing and comparison technology, the problem of identification of Asian East salmon and foreign salmon family fish was solved, and the rapid and accurate identification and protection of Asian East salmon germplasm was achieved.
Patent Information
- Application Number
- CN202510474154.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-16
- Publication Date
- 2025-07-11
AI Technical Summary
The prior art is difficult to accurately distinguish between the Asian East salmon and the alien salmon family during the hatching and larval stages, resulting in the germplasm of the Asian East salmon and the loss of genetic resources. The hybrid offspring of alien species and Asian East salmon may threaten their unique gene pool.
By screening the specific DNA sequence differences between the Asian East salmon and American char, mountain girl trout and rainbow trout, we developed a germplasm identification marker method based on molecular genetics, and used specific PCR primers and sequencing comparison technology to quickly and accurately identify germplasm.
It has achieved efficient, fast and accurate identification of germplasms of Asian East Salmon, with high stability, effectively preventing germplasm mixing and genetic pollution, and protecting the unique gene bank of Asian East Salmon.
Smart Images

Figure CN120290742A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a method for identifying Salmo trutta. Background Art
[0002] Salmo trutta belongs to the family Salmonidae of the order Salmoniformes, and is a rare cold-water fish unique to the Yadong River Basin in the southeastern part of the Qinghai-Tibet Plateau. As a Class II protected wild animal in Tibet Autonomous Region, it is not only a key indicator species of the water ecosystem in the Tibetan Plateau, but also a precious genetic resource for studying the adaptive evolution of high-altitude fish. However, with the expansion of aquaculture, exotic salmonid fish such as Oncorhynchus mykiss, Salvelinus fontinalis, and Oncorhynchus masou masou have been widely introduced into cold-water waters across China. These exotic species have become the main varieties in aquaculture due to their rapid growth and delicious meat, but their escape or artificial release will pose a serious threat to the native waters of Salmo trutta, because they can cause habitat fragmentation, sharp reduction in population numbers, and even irreversible gene pollution of Salmo trutta in Tibet through resource competition, disease transmission, and hybridization with native Salmo trutta.
[0003] Currently, the main method for distinguishing Salmo trutta from the above-mentioned exotic species is to identify them through morphological characteristics, but it is only limited to adults and sub-adults. Since the breeding period of Salmo trutta highly coincides with that of the above-mentioned exotic species, their specifications, body color, etc. are very similar during the hatching period and larval stage, and it is very difficult to accurately identify them using traditional morphological classification methods. This technical bottleneck has severely hindered the formulation of targeted protection measures for Salmo trutta. The misjudgment of species will not only lead to the failure of monitoring exotic species invasion, resulting in the silent loss of the genetic resources of Salmo trutta during the breeding process of germplasm mixing, but more seriously, the natural hybrid offspring of exotic species and Salmo trutta may have the phenomenon of "cryptic genetic erosion", that is, the phenotype of hybrid individuals is close to that of the native species, but the mixing of their genomes will gradually disintegrate the unique adaptive gene pool of Salmo trutta, ultimately threatening the survival of the entire species in the plateau environment.
[0004] Under this background, by screening the specific DNA sequence differences between Salmo trutta and Salvelinus fontinalis, Oncorhynchus masou masou, and Oncorhynchus mykiss, developing germplasm identification markers based on molecular genetics, and constructing a rapid and accurate species identification method with this, it has become the core breakthrough point for breaking the protection dilemma. Summary of the Invention
[0005] The present invention provides a germplasm identification marker and identification method for Salmo trutta to solve the shortage of existing germplasm identification technology for Salmo trutta, especially applicable to the germplasm identification markers and identification methods among Salmo trutta, Salvelinus fontinalis, Oncorhynchus masou masou, and Oncorhynchus mykiss, aiming to quickly and accurately identify the germplasm of Salmo trutta.
[0006] The germplasm identification markers and identification method of the present invention are carried out according to the following steps:
[0007] 1. Extract the genomic DNA of the sample to be identified;
[0008] 2. Use the genomic DNA in step 1 as a template for PCR amplification. In the PCR amplification system, the upstream primer of the molecular marker is 5’-TTACACATGCAAGTCTCCGCA-3’, and the downstream primer of the molecular marker is 5’-CGTATAACCGCGGTGGCTG-3’;
[0009] 3. Perform 1% agarose gel electrophoresis on the PCR product, and then perform gel recovery to purify the target band;
[0010] IV. Sequence the purified PCR products, and align the sequencing results with the discrimination sequences of **Oncorhynchus mantschuricus**: 5’-GGACGAGGAGCCGGCATCAGGCACGCCCCGGCAGCCCAAGACGCCTTGCTAAGCCACACCCCCAAGGAAACTCAGCAGTGATAAATATTAAGCCATAAGCGAAAGCTTGACTTA-3’, **Salvelinus fontinalis**: 5’-GGACGAGGAGCCGGCATCAGGCGCGCCCAGGCAGCCCAAGACGCCTTGCTAAGCCACACCCCCAAGGAAACTCAGCAGTGATAGATATTAAGCCATAAGCGAAAGCTTGACTTA-3’, **Salmo masou ishikawae**: 5’-GGACGAGGAGCCGGTATCAGGCACGCCCAGGCAGCCCACGACGCCTTGCTAAGCCACACCCCCAAGGAAACTCAGCAGTGATAAATATTAAGCCATAAGCGAAAGCTTGACTTA-3’, and **Oncorhynchus mykiss**: 5’-GGACGAGGAGCCGGCATCAGGCACGCCCAGGCAGCCCACGACGCCTTGCTAAGCCACACCCCCAAGGAAACTCAGCAGTGATAAATATTAAGCCATAAGCGAAAGCTTGACTTA-3’. Assemble the obtained 114bp homologous sequence. Samples with the five bases at positions 15, 23, 29, 39, and 84bp from the 5’ end to the 3’ end being C, A, C, A, A respectively, which are completely consistent with the discrimination sequence of **Oncorhynchus mantschuricus**, can be identified as **Oncorhynchus mantschuricus**; samples with the five bases at positions 15, 23, 29, 39, and 84bp from the 5’ end to the 3’ end being C, G, A, A, G respectively, which are completely consistent with the discrimination sequence of **Salvelinus fontinalis**, can be identified as **Salvelinus fontinalis**; samples with the five bases at positions 15, 23, 29, 39, and 84bp from the 5’ end to the 3’ end being T, A, A, C, A respectively, which are completely consistent with the discrimination sequence of **Salmo masou ishikawae**, can be identified as **Salmo masou ishikawae**; samples with the five bases at positions 15, 23, 29, 39, and 84bp from the 5’ end to the 3’ end being C, A, A, C, A respectively, which are completely consistent with the discrimination sequence of **Oncorhynchus mykiss**, can be identified as **Oncorhynchus mykiss**. Based on this, the labeling and discrimination of the germplasm of **Oncorhynchus mantschuricus** are completed.
[0011] The present invention uses molecular markers to identify **Oncorhynchus mantschuricus**, **Salvelinus fontinalis**, **Salmo masou ishikawae**, and **Oncorhynchus mykiss**, which are efficient, fast, stable in results, and high in accuracy, and have important application value in the identification of the germplasm of **Oncorhynchus mantschuricus**. BRIEF DESCRIPTION OF THE DRAWINGS
[0012] Figure 1 Results of germplasm identification of Salmo trutta fario, Salvelinus fontinalis, Oncorhynchus masou masou and Oncorhynchus mykiss.
[0013] Figure 2 Results of identification of 5 randomly selected individuals from Salmo trutta fario, Salvelinus fontinalis, Oncorhynchus masou masou and Oncorhynchus mykiss. Specific implementation manners
[0014] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.
[0015] It should be noted that, without conflict, the embodiments in the present invention and the features in the embodiments may be combined with each other.
[0016] Specific implementation manner 1: The germplasm identification markers and identification method of Salmo trutta fario in this implementation manner are carried out according to the following steps:
[0017] 1. Extract genomic DNA of the sample to be identified;
[0018] 2. Perform PCR amplification using the genomic DNA in step 1 as a template. In the PCR amplification system, the upstream primer of the molecular marker is 5’-TTACACATGCAAGTCTCCGCA-3’, and the downstream primer of the molecular marker is 5’-CGTATAACCGCGGTGGCTG-3’.
[0019] 3. Perform agarose gel electrophoresis on the PCR product at a concentration of 1%, and then perform gel recovery to purify the target band.
[0020] IV. Sequence the purified PCR products, and compare the sequencing results with the discrimination sequences of Oncorhynchus maculates: 5'-GGACGAGGAGCCGGCATCAGGCACGCCCCGGCAGCCCAAGACGCCTTGCTAAGCCACACCCCCAAGGAAACTCAGCAGTGATAAATATTAAGCCATAAGCGAAAGCTTGACTTA-3', the discrimination sequence of Salvelinus fontinalis: 5'-GGACGAGGAGCCGGCATCAGGCGCGCCCAGGCAGCCCAAGACGCCTTGCTAAGCCACACCCCCAAGGAAACTCAGCAGTGATAGATATTAAGCCATAAGCGAAAGCTTGACTTA-3', the discrimination sequence of Salmo masou ishikawae: 5'-GGACGAGGAGCCGGTATCAGGCACGCCCAGGCAGCCCACGACGCCTTGCTAAGCCACACCCCCAAGGAAACTCAGCAGTGATAAATATTAAGCCATAAGCGAAAGCTTGACTTA-3', and the discrimination sequence of Oncorhynchus mykiss: 5'-GGACGAGGAGCCGGCATCAGGCACGCCCAGGCAGCCCACGACGCCTTGCTAAGCCACACCCCCAAGGAAACTCAGCAGTGATAAATATTAAGCCATAAGCGAAAGCTTGACTTA-3'. Align the obtained 114bp homologous sequence. Samples that are completely identical to the discrimination sequence of Oncorhynchus maculates and have the five bases at positions 15, 23, 29, 39, and 84bp from the 5' end to the 3' end being C, A, C, A, A respectively can be identified as Oncorhynchus maculates; samples that are completely identical to the discrimination sequence of Salvelinus fontinalis and have the five bases at positions 15, 23, 29, 39, and 84bp from the 5' end to the 3' end being C, G, A, A, G respectively can be identified as Salvelinus fontinalis; samples that are completely identical to the discrimination sequence of Salmo masou ishikawae and have the five bases at positions 15, 23, 29, 39, and 84bp from the 5' end to the 3' end being T, A, A, C, A respectively can be identified as Salmo masou ishikawae; samples that are completely identical to the discrimination sequence of Oncorhynchus mykiss and have the five bases at positions 15, 23, 29, 39, and 84bp from the 5' end to the 3' end being C, A, A, C, A respectively can be identified as Oncorhynchus mykiss. Based on this, the labeling and discrimination of the germplasm of Oncorhynchus maculates are completed.
[0021] Specific Embodiment 2: The difference between this embodiment and Specific Embodiment 1 is as follows: In Step 2, the PCR amplification reaction system is 50 μL: 25 μL of 2× Taq PCR mix, 3 μL of genomic DNA of the sample to be identified, 2 μL each of the upstream and downstream primers of the molecular marker, and the rest is made up with ddH2O; The PCR reaction is: pre-denaturation at 95 °C for 3 min, and then 30 cycles of denaturation at 95 °C for 30 s, annealing at 59 °C for 30 s, and extension at 72 °C for 30 s. After 30 cycles of reaction, a final extension reaction is carried out at 72 °C for 2 min, and finally long-term incubation is carried out at 12 °C. Other steps and parameters are the same as those in Specific Embodiment 1.
[0022] Specific Embodiment 3: The difference between this embodiment and Specific Embodiment 1 is as follows: In Step 3, agarose gel electrophoresis: Add 5 μL of 10× loading buffer to each PCR product, vortex and mix well, then briefly centrifuge. Load the PCR product onto a 1% agarose gel for electrophoresis for 40 min, with the voltage controlled at 180 V. Finally, cut the gel containing the target band under the ultraviolet lamp of the gel imaging system. Other steps and parameters are the same as those in Specific Embodiment 1.
[0023] Specific Embodiment 4: The difference between this embodiment and Specific Embodiment 1 is as follows: In Step 4, the method of splicing is to automatically align the sequencing results using UGENE software. The specific method is: Open the UGENE software, select "Multiple sequence alignment" in the toolbox, then select the "Align with ClustalW" method, then integrate the sequencing results in FASTA format and the identification sequences of Oncorhynchus mantschuricus, Salvelinus fontinalis, Salmo pallasii, and Oncorhynchus mykiss, then import them into the software and set the file name of the output file, and finally click "Align" to automatically splice out the homologous sequences. Other steps and parameters are the same as those in Specific Embodiment 1.
[0024] Example 1 Identification of Oncorhynchus mantschuricus using the method of the present invention
[0025] 1. Sample collection
[0026] Select 30 adult fish each of known Oncorhynchus mantschuricus, Salvelinus fontinalis, Salmo pallasii, and Oncorhynchus mykiss, and cut 1 cm of the 2 caudal fin and store it in absolute ethanol;
[0027] 2. Extraction of genomic DNA from the sample
[0028] Take the fin samples obtained in Step 1 and use a tissue genomic DNA extraction kit to extract the genomic DNA of the samples respectively;
[0029] 3. PCR amplification
[0030] Using the genomic DNA obtained in step 2 as a template, perform a PCR reaction. In the PCR amplification system, the upstream primer of the molecular marker is 5’-TTACACATGCAAGTCTCCGCA-3’, and the downstream primer of the molecular marker is 5’-CGTATAACCGCGGTGGCTG-3’; the PCR amplification reaction system is 50 μL: 25 μL of 2×Taq PCR mix, 3 μL of the genomic DNA of the sample to be identified, 2 μL each of the upstream and downstream primers of the molecular marker, and the rest is made up with ddH2O; the PCR reaction is: pre-denaturation at 95 °C for 3 min, then 30 cycles of denaturation at 95 °C for 30 s, annealing at 59 °C for 30 s, extension at 72 °C for 30 s. After 30 cycles of reaction, a final extension reaction is carried out at 72 °C for 2 min, and finally long-term incubation is carried out at 12 °C.
[0031] 4. Gel electrophoresis of PCR products
[0032] Add 5 μL of 10× loading buffer to each PCR product, vortex and mix well, then centrifuge briefly. Load the PCR products onto a 1% agarose gel for electrophoresis for 40 min, with the voltage controlled at 180 V. Finally, cut the gel containing the target band under the ultraviolet light of the gel imaging system.
[0033] 5. Purification, sequencing and splicing of PCR products
[0034] Use an agarose gel purification kit to purify the PCR products, and then perform single-direction sequencing on the purified PCR products. Finally, use the UGENE software to automatically align the sequencing results. The specific method is as follows: Open the UGENE software, select "Multiple sequence alignment" in the toolbox, then select the "Align with ClustalW" method, then integrate the sequencing results in FASTA format and the identification sequences of Oncorhynchus masou, Salvelinus fontinalis, Salmo pallasii and Oncorhynchus mykiss, then import them into the software and set the file name of the output file, and finally click "Align" to automatically splice out the homologous sequences.
[0035] For the 114-bp homologous sequence obtained by splicing, when counting from the 5'-end to the 3'-end, a sample with the five bases at positions 15, 23, 29, 39, and 84 bp that are exactly the same as those in the identification sequence of *Salmo trutta fario* being C, A, C, A, A respectively can be identified as *Salmo trutta fario*; a sample with the five bases at positions 15, 23, 29, 39, and 84 bp that are exactly the same as those in the identification sequence of *Oncorhynchus mykiss* being C, G, A, A, G respectively can be identified as *Oncorhynchus mykiss*; a sample with the five bases at positions 15, 23, 29, 39, and 84 bp that are exactly the same as those in the identification sequence of *Salvelinus malma* being T, A, A, C, A respectively can be identified as *Salvelinus malma*; a sample with the five bases at positions 15, 23, 29, 39, and 84 bp that are exactly the same as those in the identification sequence of *Oncorhynchus mykiss* being C, A, A, C, A respectively can be identified as *Oncorhynchus mykiss*.
[0036] Figure 1 are the germplasm identification results of *Salmo trutta fario*, *Oncorhynchus mykiss*, *Salvelinus malma*, and *Oncorhynchus mykiss* in this example. Figure 2 are the identification results of randomly selecting 5 individuals each from *Salmo trutta fario*, *Oncorhynchus mykiss*, *Salvelinus malma*, and *Oncorhynchus mykiss*. Figure 2 are prominently displayed to more clearly show the base differences between each species. From Figure 1 and Figure 2 it can be seen that the identification conclusion of the method of the present invention is completely consistent with the actual situation, proving that the method of the present invention is accurate.
Claims
1. A germplasm identification marker and identification method for Himalayan snowtrout, characterized in that, The germplasm identification markers and identification method of *Salmo trutta fario* are carried out according to the following steps:
1. Extract genomic DNA of the sample to be identified; 2. Use the genomic DNA in step 1 as a template for PCR amplification. In the PCR amplification system, the upstream primer of the molecular marker is 5’-TTACACATGCAAGTCTCCGCA-3’, and the downstream primer of the molecular marker is 5’-CGTATAACCGCGGTGGCTG-3’; 3. Perform 1% agarose gel electrophoresis on the PCR product, and then perform gel recovery to purify the target band; IV. Sequence the purified PCR products, and compare the sequencing results with the identification sequences of Oncorhynchus mantschuricus: 5’-GGACGAGGAGCCGGCATCAGGCACGCCCCGGCAGCCCAAGACGCCTTGCTAAGCCA CACCCCCAAGGAAACTCAGCAGTGATAAATATTAAGCCATAAGCGAAAGCTTGACTTA-3’, Oncorhynchus mykiss: 5’-GGACGAGGAGCCGGCATCAGGCGCGCCCAGGCAGCCCAAGACGCCTTGCTAAGCCA CACCCCCAAGGAAACTCAGCAGTGATAGATATTAAGCCATAAGCGAAAGCTTGACTTA-3’, Salvelinus leucomaenis: 5’-GGACGAGGAGCCGGTATCAGGCACGCCCAGGCAGCCCACGACGCCTTGCTAAGCCAC ACCCCCAAGGAAACTCAGCAGTGATAAATATTAAGCCATAAGCGAAAGCTTGACTTA-3’, and Oncorhynchus kisutch: 5’-GGACGAGGAGCCGGCATCAGGCACGCCCAGGCAGCCCACGACGCCTTGCTAAGCCA CACCCCCAAGGAAACTCAGCAGTGATAAATATTAAGCCATAAGCGAAAGCTTGACTTA-3’. Assemble the obtained 114bp homologous sequence. Samples that are completely identical to the Oncorhynchus mantschuricus identification sequence and have the five bases at positions 15, 23, 29, 39, and 84bp from the 5’ end to the 3’ end being C, A, C, A, A respectively can be identified as Oncorhynchus mantschuricus. Samples that are completely identical to the Oncorhynchus mykiss identification sequence and have the five bases at positions 15, 23, 29, 39, and 84bp from the 5’ end to the 3’ end being C, G, A, A, G respectively can be identified as Oncorhynchus mykiss. Samples that are completely identical to the Salvelinus leucomaenis identification sequence and have the five bases at positions 15, 23, 29, 39, and 84bp from the 5’ end to the 3’ end being T, A, A, C, A respectively can be identified as Salvelinus leucomaenis. Samples that are completely identical to the Oncorhynchus kisutch identification sequence and have the five bases at positions 15, 23, 29, 39, and 84bp from the 5’ end to the 3’ end being C, A, A, C, A respectively can be identified as Oncorhynchus kisutch. Based on this, the labeling and identification of the germplasm of Oncorhynchus mantschuricus are completed.
2. The germplasm identification marker and identification method of the salmon trutta fario according to claim 1, characterized in that In Step 2, the PCR amplification reaction system is 50 μL: 25 μL of 2× Taq PCRmix, 3 μL of genomic DNA of the sample to be identified, 2 μL each of the upstream and downstream primers of the molecular marker, and the rest is made up with ddH2O; the PCR reaction is: pre-denaturation at 95 °C for 3 min, then 30 cycles of denaturation at 95 °C for 30 s, annealing at 59 °C for 30 s, extension at 72 °C for 30 s. After 30 cycles of reaction, a final extension reaction is carried out at 72 °C for 2 min, and finally long-term incubation is carried out at 12 °C.
3. The germplasm identification marker and identification method of salmon trutta fario as described in claim 1, characterized in that In Step 3, agarose gel electrophoresis: Add 5 μL of 10× loading buffer to each PCR product, vortex and mix well, then briefly centrifuge. Load the PCR product onto a 1% agarose gel and perform electrophoresis for 40 min with the voltage controlled at 180 V. Finally, cut the gel containing the target band under the ultraviolet light of the gel imaging system.
4. The germplasm identification marker and identification method of Salmo trutta fario as described in claim 1, characterized in that, In Step 4, the method of splicing is to use the UGENE software to automatically align the sequencing results. The specific method is as follows: Open the UGENE software, select "Multiple sequence alignment" in the toolbox, then select the "Align with ClustalW" method. Then integrate the sequencing results in FASTA format and the identification sequences of Oncorhynchus masou, Salvelinus fontinalis, Oncorhynchus masou ishikawae, and Oncorhynchus mykiss, import them into the software and set the file name of the output file, and finally click "Align" to automatically splice out the homologous sequences.
Citation Information
Patent Citations
Molecular marker for identification of sashimi and smoked meat products made from salvelinus leucomaenis and salvelinus fominalis and application of molecular marker
CN104293972A