Identification primer and identification method of streptococcus bovis strain

Abstract

The invention belongs to the technical field of streptococcus bovis identification. The invention provides an identification primer of a streptococcus bovis strain. A primer pair sequence is designed according to a conservative interval of a deoD gene and an rfbD gene. The sequences of the primer pair are as follows: deoD-F1 and rfbD-R1; the sequence information of the deoD-F1 is 5 '-TTCACAGAACTTACAAGGTCACCG-3', and the sequence information of the rfbD-R1 is 5 '-ATTTTTCACAACTGCTTTCTCACAA-3'. By adopting the primer pair disclosed by the invention, a polysaccharide synthesis gene cluster can be obtained and is used for identifying a streptococcus bovis strain, a specific probe can also be used for identifying the streptococcus bovis strain, and compared with a method for analyzing and identifying the strain by using whole genome sequencing, the method is simpler, quicker, low in cost and easy to popularize.

Description

Technical Field

[0001] The present invention belongs to the technical field of Streptococcus bovis identification. Background Art

[0002] Streptococcus bovis was first isolated from the sera of cattle and horses, named Streptococcus bovis and Streptococcus equinus respectively, and later was also isolated from other animals including humans. Such bacteria are collectively referred to as the Streptococcus bovis / Streptococcus equinus complex (SBSEC).

[0003] Phenotypic analysis identifies SBSEC as a group D streptococcus that is not an enterococcus, with non-purulent and non-β-hemolytic characteristics, and is a symbiotic bacterium in the human and animal bodies.

[0004] SBSEC mainly exists in the rumen and cloaca of animals and the colon of humans. Compared with other streptococci, Streptococcus bovis shows relatively high antibiotic resistance, mainly resistant to tetracycline, clindamycin, erythromycin, and levofloxacin.

[0005] SBSEC is an opportunistic pathogen. They have strong degradation ability for proteins and plant polysaccharides, can convert starch into lactic acid, can grow under low pH conditions, causing a sharp drop in the pH of the gastric sac and resulting in ruminal acidosis in ruminants. In addition, Streptococcus bovis also causes hoof inflammation and mastitis in animals. More importantly, certain Streptococcus bovis can cause serious human diseases such as endocarditis, bacteremia, and meningitis, mainly targeting the elderly. In addition, it has also been found that Streptococcus bovis is related to the occurrence of human colorectal cancer and hepatobiliary diseases. Currently, Streptococcus bovis-related bacteremia is considered to be one of the early indicators of colon cancer.

[0006] According to modern taxonomy, Streptococcus bovis of the genus Streptococcus is divided into 7 species and subspecies, namely Streptococcus equinus, Streptococcus lutetiensi, Streptococcus alactolyticus, Streptococcus infantarius subsp. infantarius (Sii), Streptococcus gallolyticus subsp. gallolyticus (Sgg), Streptococcus gallolyticus subsp. macedonicus (Sgm), and Streptococcus gallolyticus subsp. pasteurianus (Sgp). Among them, Sgg mainly causes infective endocarditis, prosthetic joint infection, and bacteremia, and is associated with colorectal malignancies; Sgp mainly causes benign biliary tract diseases, urinary tract infections, gastrointestinal diseases, and meningitis in the elderly; S. infantarius is associated with the occurrence of cholangiocarcinoma and pancreatobiliary carcinoma; while Sgm and S. lutetiensis are used in traditional dairy product production and plant food fermentation and are considered safe Streptococcus bovis. It can be seen that the correlations of different Streptococcus bovis with pathogenicity are different. Therefore, it is very necessary to accurately identify Streptococcus bovis isolates to species, subspecies, and strains.

[0007] Generally, the species and subspecies of Streptococcus bovis are identified by the nucleotide sequences of 16s rDNA and conserved housekeeping genes such as sodA. However, these sequences cannot distinguish different Streptococcus bovis strains. Obtaining all the genetic information of bacteria through genome sequencing can identify strains, but genome sequencing is costly, time-consuming, and requires high technology, and it is currently difficult to popularize. With the rapid economic development, the incidence of bovine diseases caused by Streptococcus bovis has been increasing year by year, and the probability of human-animal cross-infection is also increasing. There is an urgent need to develop a simple, rapid, accurate, and low-cost method to identify Streptococcus bovis strains, which helps to clarify pathogens, discover variant strains, monitor drug resistance, trace the transmission chain, and prevent the further spread of diseases. Summary of the Invention

[0008] In view of this, the present invention provides an identification primer for Streptococcus bovis strains, and a primer pair sequence is designed based on the conserved regions of the deoD gene and the rfbD gene.

[0009] Furthermore, the primer pair sequences are: deoD-F1 and rfbD-R1; the sequence information of deoD-F1 is: 5’-TTCACAGGAACTTACAAGGTCACCG-3’; the sequence information of rfbD-R1 is: 5’-ATTTTTCAACTGCTTCTTCACCCAAA-3’.

[0010] Furthermore, the primer pair sequences are: deoD-F2 and rfbD-R2; the sequence information of deoD-F2 is: 5’-CAATCTCAATCTACGCAACTGAACTTATC-3’; the sequence information of rfbD-R2 is: 5’-ATTTTTCAACTGCTTCTTCACCCAAA-3’.

[0011] In a specific embodiment of the present invention, the Streptococcus bovis strains are S. equinus NM-2-29, S. equinus NM-7, S. equinus NM-A1 or S. equinus NM-L12.

[0012] In a specific embodiment of the present invention, the Streptococcus bovis strains are S. equinus NM-L6 or S. equinus NM-L9.

[0013] Furthermore, the primer pair sequences are: 2-29-F and 2-29-R; the sequence information of 2-29-F is: 5’-CAGATGTAAAGGCACTGGCA -3’; the sequence information of 2-29-R is: 5’- TTGTACCGAATTTAGGGCTG -3’; the Streptococcus bovis strain is S. equinus NM-2-29.

[0014] Furthermore, the primer pair sequences are: 7-F and 7-R; the sequence information of 7-F is: 5’-TAAGAAACAATCACCAGGAC -3’; the sequence information of 7-R is: 5’- AAAAAGACAAAAAGGAAAAG -3’; the Streptococcus bovis strain is S. equinus NM-7.

[0015] Furthermore, the primer pair sequences are: A1-F and A1-R; the sequence information of A1-F is: 5’-GATAGTCTGTTGGTATGGAG -3’; the sequence information of A1-R is: 5’- GTTTTTGAAGTTTTTGTGAT -3’; the Streptococcus bovis strain is S. equinus NM-A1.

[0016] Further, the primer pair sequences are: L6-F and L6-R; the sequence information of L6-F is: 5’-CCTATATTTTTTCTTGCTATCC -3’; the sequence information of L6-R is: 5’- CACCCTAACACACTTTCTTACT -3’; the Streptococcus bovis strain is S. equinus NM-L6.

[0017] Further, the primer pair sequences are: L9-F and L9-R; the sequence information of L9-F is: 5’-TTGTAACGAACAAGTGCCG -3’; the sequence information of L9-R is: 5’- AACTCTCCCCATACCCTGA -3’; the Streptococcus bovis strain is S. equinus NM-L9.

[0018] The primer pair sequences provided by the present invention can be used to identify Streptococcus bovis strains, which are simpler, faster, less costly, and easier to implement than whole-genome sequencing. Description of the Drawings

[0019] Figure 1 It is the electrophoresis result diagram of the Long PCR product of the capsular polysaccharide synthesis gene cluster.

[0020] Figure 2 It is the structural diagram of the capsular polysaccharide synthesis gene cluster of 6 Streptococcus bovis strains.

[0021] Figure 3 It is the comparison diagram of the capsular polysaccharide synthesis gene cluster of Streptococcus bovis.

[0022] Figure 4 It is the electrophoresis result diagram of the PCR product for screening strain-specific primers.

[0023] Figure 5 It is the electrophoresis result diagram of the PCR product for screening species-specific primers.

[0024] Figure 6 It is the electrophoresis result diagram of the Multiplex PCR product for identifying strains. Detailed Embodiments

[0025] In the present invention, we found a specific capsular polysaccharide synthesis gene cluster of Streptococcus bovis, which can be used to identify Streptococcus bovis strains, and is simpler, faster, less costly, and easier to implement than whole-genome sequencing.

[0026] It is found that the gene cluster located between the deoD and rfbD genes in Streptococcus bovis is responsible for the synthesis of capsular polysaccharide. The sequence of this gene cluster can be used to identify Streptococcus bovis strains. If the nucleotide sequences of the gene clusters are the same, it indicates that they contain the same genes, the strains synthesize the same polysaccharide structure, and produce the same polysaccharide antigen. If the nucleotide sequences are different, the genes are different, predicting that the polysaccharide structures synthesized by the strains are different, producing different antigens and stimulating the host to produce different antibodies.

[0027] The present invention discloses a new method for identifying Streptococcus bovis strains. The gene cluster sequence of the capsular polysaccharide of Streptococcus bovis can be obtained by the primers and methods described in this patent; different Streptococcus bovis strains can be determined by the alignment and analysis of the gene cluster sequences.

[0028] Furthermore, we found specific primers in the gene cluster, which can be used as probes to distinguish different strains by a simple Multiplex PCR method.

[0029] Therefore, through the sequence of the capsular polysaccharide synthesis gene cluster or the specific probe therein, the species, subspecies, and strains of Streptococcus bovis can be identified efficiently and accurately.

[0030] Using the primers of the present invention to identify Streptococcus bovis strains is simpler, faster, lower in cost, and easier to popularize than the method of identifying strains by whole-genome sequencing analysis.

[0031] Example 1

[0032] 1. Streptococcus bovis strains

[0033] 6 Streptococcus bovis strains. Streptococcus equinus NM-2-29 (NCBI accession number CP184736), Streptococcus equinus NM-7 (NCBI accession number CP185946), Streptococcus equinus NM-A1 (NCBI accession number CP185763), Streptococcus equinus NM-L6 (NCBI accession number CP185947), Streptococcus equinus NM-L9 (NCBI accession number CP185948), Streptococcus equinus NM-L12 (NCBI accession number CP185949).

[0034] 2. Extraction of bacterial genome

[0035] Prepare the medium according to the instructions of M17 medium (ACMEC, catalog number AC12076). Take 100 μL of the bacterial strain cryopreservation solution and inoculate it into 5 mL of M17 liquid medium respectively. Incubate it statically in a 37°C, 5% CO2 incubator for 8 - 10 hr. Then centrifuge at 5000 rpm for 10 min to collect the bacterial cells. Extract the bacterial genomic DNA using the kit Wizard Genomic DNA Purification Kit (Promega, catalog number A1120), and measure the DNA concentration using a Nanodrop analyzer.

[0036] 3. Design primers

[0037] Perform bioinformatics analysis on the genomic sequences of 52 Streptococcus bovis isolates existing in the NCBI GenBank database. It is found that the capsular polysaccharide synthesis gene cluster is located between the deoD gene and the rfbD gene. Use the DNAMAN software for alignment analysis and find that these two genes are highly conserved among different strains. Based on this, use the SnapGene software to design different primer pairs in the conserved sequence interval.

[0038] The primer pair sequences are as follows:

[0039] deoD-F1: 5’-TTCACAGGAACTTACAAGGTCACCG-3’;

[0040] rfbD-R1: 5’-ATTTTTCAACTGCTTCTTCACCCAAA-3’;

[0041] deoD-F2: 5’-CAATCTCAATCTACGCAACTGAACTTATC-3’;

[0042] rfbD-R2: 5’- ATTTTTCAACTGCTTCTTCACCCAAA-3’.

[0043] 4. Obtain the polysaccharide synthesis gene cluster fragment by Long PCR

[0044] Using the genomic DNA of S. equinus NM-2-29, S. equinus NM-7, S. equinus NM-A1, S. equinus NM-L6, S. equinus NM-L9 and S. equinus NM-L12 as templates respectively, perform Long PCR using the high-fidelity KOD FX DNA polymerase (Toyobo Bio-Technology, catalog number KFX-101) and the primer pair deoD-F1 / rfbD-R1;

[0045] The reaction system and reaction program of PCR are shown in Table 1 and Table 2.

[0046] The Long PCR products were observed by 0.8% agarose gel electrophoresis, and the results are as Figure 1 shown.

[0047] Table 1. Long PCR reaction system

[0048] Component Volume (μL) DNA Template (100 ng / μL) 1 Forward Primer 1.5 Reverse Primer 1.5 2×KOD fx Buffer 25 2 mM dNTPs 10 KOD FX 1 ddH2O 10 Total Volume 50

[0049] Table 2. Long PCR reaction program

[0050] Step Temperature (°C) Time Pre-denaturation 98 2 min Denaturation 98 10 sec Annealing 57 30 sec Extension 68 20 min Number of Cycles 35

[0051] 5. Obtaining the polysaccharide synthesis gene cluster sequence

[0052] After purifying the Long PCR products with a kit (Beyotime Biotechnology Co., Ltd., catalog number D0033), they were sequenced by a sequencing company (GenScript Biotech Corporation), and the polysaccharide synthesis gene cluster sequences of 6 Streptococcus bovis strains were obtained and published in the NCBI database.

[0053] The accession number of the nucleotide sequence of S. equinus NM-2-29 is PQ657933.

[0054] The accession number of the nucleotide sequence of S. equinus NM-7 is PQ657934.

[0055] The accession number of the nucleotide sequence of S. equinus NM-A1 is PQ660244.

[0056] The accession number of the nucleotide sequence of S. equinus NM-L6 is PQ660245.

[0057] The accession number of the nucleotide sequence of S. equinus NM-L9 is PQ660246.

[0058] The accession number of the nucleotide sequence of S. equinus NM-L12 is PQ660247.

[0059] 6. Comparative analysis of the polysaccharide synthesis gene cluster

[0060] The obtained gene sequences were imported into SnapGene software, which automatically annotated the open reading frames. Each open reading frame was compared by blast (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) to predict gene functions. The sequences of similar gene clusters were downloaded and annotated on (https: / / www.bv-brc.org / ); then the obtained gbk files were uploaded to CAGECAT (https: / / cagecat.bioinformatics.nl / ) to generate a comparison map of the gene clusters ( Figure 2 ).

[0061] These gene clusters are composed of 15 - 21 genes. Each gene is represented by a box with an arrow pointing in the 3' direction, and genes with different functions are represented by different patterns. The deoD gene is at the 5' end of each gene cluster, followed by regulatory genes (lytR, lysR, cpsA, cpsB, cpsC, cpsD), and then polysaccharide synthesis genes. The number of polysaccharide synthesis genes varies in different gene clusters, indicating that the synthesized polysaccharide structures are also different. The rfbD gene is at the 3' end of the gene cluster.

[0062] The results showed that there were certain similarities and also significant differences in the polysaccharide synthesis gene clusters of different strains.

[0063] The gene cluster of S. equinus NM - 2 - 29 is 22197 bp in total and contains 19 genes; the gene cluster of S. equinus NM - 7 is 15569 bp in total and contains 15 genes; the gene cluster of S. equinus NM - A1 is 20112 bp in total and contains 17 genes; the gene cluster of S.equinus NM - L6 is 26218 bp in total and contains 21 genes; the gene cluster of S. equinus NM - L9 is 22500 bp in total and contains 18 genes; the gene cluster of S. equinus NM - L12 is 18956 bp in total and contains 15 genes.

[0064] By analyzing the functions of each gene through Blast P, it was found that the 5' ends of these gene clusters all contain 5 regulatory genes, lysR, cpsA, cpsB, cpsC, and cpsD. Among them, lysR is an LTTR - type transcriptional regulator, a regulatory gene unique to Streptococcus bovis; cpsA, cpsB, cpsC, and cpsD are responsible for regulating polysaccharide synthesis and the length of sugar chains, and they also exist in the polysaccharide synthesis gene clusters of other streptococci. In addition, there is an extra lytR gene between the deoD and lysR genes in the Streptococcus bovis strain NM - L6, which is a special regulatory gene that can indirectly regulate polysaccharide synthesis.

[0065] In addition to regulatory genes, each gene cluster contains multiple polysaccharide synthesis genes (indicated by grey arrows), including synthases responsible for synthesizing special monosaccharides, glycosyltransferases, translocases, polymerases, O-acetyltransferases, pyruvate transferases, and proteins with unknown functions. In short, different genes in the gene cluster predict different polysaccharide structures and antigenicity.

[0066] Furthermore, these gene clusters were aligned and analyzed using blastn with the polysaccharide synthesis gene cluster sequences on the genomes of 52 Streptococcus bovis strains already existing in the NCBI database. It was found that the polysaccharide synthesis gene clusters of 5 strains had a certain similarity to those of other strains in the database, and it was found that the gene cluster of strain NM-A1 was unique ( Figure 3 ). In the figure, the similarity is represented by black, white, and grey blocks. The darker the color, the higher the similarity of the corresponding gene, and the lighter the color, the lower the similarity of the corresponding gene.

[0067] The polysaccharide synthesis gene clusters of strains S. equinus NM-7 and S. infantarius AF94-18M2BA are similar. Except for the lack of a regulatory gene lytR, their gene cluster sequences have 83.94% identity.

[0068] The gene cluster sequences of strains S. equinus NM-L-12 and S.equnius NBRC 12057 have 98.28% identity, with only individual base differences, and they contain the same genes.

[0069] The polysaccharide synthesis gene cluster of strain S. equinus NM-A1 is very unique. Except for 5 regulatory genes, it has no similarity to the polysaccharide synthesis gene clusters of other strains in the database.

[0070] The gene cluster of strain S. equinus NM-2-29 has 90.9% identity with that of S. equinus CNU G6. The former has two more genes than the latter, which encode phosphocholine transferase LicD protein and oligosaccharide translocase respectively.

[0071] The polysaccharide synthesis gene cluster sequences of strains S. equinus NM-L9 and S. lutetiensis P4521K1 have 91.98% identity, and the latter has one more transposase gene.

[0072] The polysaccharide synthesis gene clusters of strain S. equinus NM-L6 and strain S. equinus ICDDRB-NRC-S6 have 55.53% identity, and 63.88% identity with strain S. lutetiensis P4521K1. They have several identical genes, but most genes are different.

[0073] Although some gene clusters are similar, no gene clusters with exactly the same nucleotide sequence were found. Therefore, the nucleotide sequence of the polysaccharide synthesis gene cluster located between the deoD and rfbD genes can be used to distinguish and identify Streptococcus bovis strains. The nucleotide sequence of this gene cluster can be easily obtained by the primers and methods described in this patent.

[0074] In addition, the 5' end of the capsular polysaccharide synthesis gene cluster of all Streptococcus bovis contains five regulatory genes (lysR, cpsA, cpsB, cpsC, cpsD), and some gene clusters also have the lytR gene. These characteristics can also be used to identify Streptococcus bovis.

[0075] 7 Mining specific primers to identify Streptococcus bovis strains by Multiplex PCR

[0076] 7.1 Design of specific primers

[0077] To develop a simpler Multiplex PCR method for identifying Streptococcus bovis strains, we designed primers for specific genes or special regions in these 6 gene clusters. As Figure 3 shown, the polysaccharide synthesis gene clusters of S. equinus NM-A1 and S. equinus NM-L6 are different from those of other strains in multiple genes. Specific primers can be designed within different glycosyltransferase genes or across genes. For S. equinus NM-7, primers were designed between the 6th gene and the 7th gene, and the target fragment contains part of the DNA of the 6th gene and the 7th gene. This primer design principle was also used for S. equinus NM-2-29 and S. equinus NM-L9. For S. equinus NM-L12, since its polysaccharide synthesis gene cluster sequence similarity with strain S. equinus NBRC 12057 is very high and contains the same genes, only the nucleotide sequence of the complete gene cluster can be used to distinguish them.

[0078] For each strain, we designed multiple pairs of primers respectively, and selected a pair of primers through PCR and electrophoresis detection. Their sequences are shown in Table 3, and these primer pairs are distributed at different positions in the gene cluster ( Figure 3). For S. equinus NM-2-29, the size of the PCR product of primer pair 2-29-F / 2-29-R is 1194 bp; for S. equinus NM-7, the PCR product of primer pair 7-F / 7-R is 881 bp; for S. equinus NM-A1, the PCR product of primer pair A1-F / A1-R is 610 bp; for S. equinus NM-L6, the PCR product of primer pair L6-F / L6-R is 408 bp; for S. equinus NM-L9, the PCR product of primer pair L9-F / L9-R is 210 bp.

[0079] Table 3. Primer Table for Strain Identification

[0080]

[0081] 7.2 Verification of Primer Pair Specificity by PCR

[0082] To detect the specificity of each primer pair, gradient PCR was performed using the corresponding primer pairs and DNA polymerase (AG / Aikery Biotech, catalog number AG11009-N) with the strain genome as the template, and the annealing temperatures were 51°C, 53°C, 57°C, and 61°C, respectively. At the same time, a negative control group was set up. The template in the control group did not contain the genome corresponding to the primer, but only contained the genomes of the other 4 strains, 20 ng of each genome, and the annealing temperature of the control group was 53°C. PCR was carried out according to the reaction system in Table 4 and the reaction program in Table 5. The PCR products were electrophoresed on a 1.0% agarose gel. The electrophoresis results are as Figure 4 shown. The results showed that each primer pair only obtained PCR products in the genome of the corresponding strain and did not obtain PCR products in the other strains of the control group, indicating that the specificity of these primer pairs is good and can be used as probes to identify the corresponding Streptococcus bovis strains.

[0083] Table 4. PCR Reaction System

[0084]

[0085] Table 5. PCR Reaction Program

[0086]

[0087] 7.3 Identification of Streptococcus bovis Based on Regulatory Genes in the Gene Cluster

[0088] Forward and reverse primers Seq-F1 / Seq-R1 were designed within the lysR and cpsB genes of the gene cluster, respectively, for amplifying the DNA fragment between the lysR and cpsB genes; forward and reverse primers Seq-F2 / Seq-R2 were designed within the deoD and cpsA genes, respectively, for amplifying the DNA fragment between the deoD and cpsA genes. The primer sequences are as follows:

[0089] Seq-F1: 5’-ATCCCCATTTCTCGCTCTAA-3’;

[0090] Seq-R1: 5’-GCCTCTGCTGCTTCTTTGAC-3’;

[0091] Seq-F2: 5’-GACGAAGACACAACAGCACAAGAAC-3’;

[0092] Seq-R2: 5’-TATCGCAGCAATGGTAGAGAAAATG-3’.

[0093] Using the genomes of the above 6 Streptococcus bovis strains and other Streptococcus strains as templates respectively, PCR was performed with the primer pairs Seq-F1 / Seq-R1 or Seq-F2 / Seq-R2 according to the reaction systems and reaction programs shown in Table 4 and Table 5. The annealing temperature was 60 °C. The PCR products were electrophoresed on 1.0% agarose gel, and the electrophoresis results are as Figure 5 shown. The results showed that these two pairs of primers only obtained the target fragments in Streptococcus bovis, and no PCR products were obtained in other Streptococcus strains. Therefore, the primer pairs Seq-F1 / Seq-R and Seq-F2 / Seq-R2 can be used to identify Streptococcus bovis.

[0094] Among them, SoC104 represents Streptococcus oralis strain C104 (S. oralis C104); SgDL1 represents Streptococcus gordonii strain DL1 (S. gordonii DL1); Pn14 represents Streptococcus pneumoniae serotype 14 (S. pneumoniae serotype14); Pn1 represents Streptococcus pneumoniae serotype 1 (S. pneumoniae serotype 1); Pl 1-16 represents Streptococcus pluranimalium 1-16 (S. pluranimalium 1-16); Pl 73 represents Streptococcus pluranimalium 73 (S. pluranimalium 73); Pl L3 represents Streptococcus pluranimalium L3 (S. pluranimalium L3).

[0095] 7.4 Identification of different Streptococcus bovis strains by Multiplex PCR

[0096] Mix the 5 pairs of primers shown in Table 3 and the primer pair Seq-F1 / Seq-R1, and perform Multiplex PCR in Streptococcus bovis strains and different Streptococcus strains shown in 7.3 of Example 1. The PCR reaction system is as follows:

[0097] Table 6. PCR reaction system

[0098]

[0099] Table 7. PCR reaction program settings

[0100]

[0101] Mix each pair of primers shown in Table 3 in equal proportions, and the initial concentration of each primer is 10 μM. Then take 2.4 μL of the mixed primers and add them to the system in Table 6 for PCR.

[0102] The results are as Figure 6 shown. These primers only obtained PCR products in 6 Streptococcus bovis strains, and there were DNA bands of different sizes in different strains, that is, different Streptococcus bovis strains showed different DNA profiles, and no PCR products were obtained in other Streptococcus strains. Therefore, these specific primers can be used to accurately distinguish and identify Streptococcus bovis strains by the Multiplex PCR method, and different DNA profiles represent different strains.

Claims

1. Identification primers for Streptococcus bovis strains, characterized in that, Primer pair sequences were designed based on the conserved regions of the deoD gene and the rfbD gene.

2. The identification primer for the Streptococcus bovis strain according to claim 1, characterized in that, The primer pair sequences are: deoD-F1 and rfbD-R1; The sequence information of deoD-F1 is: 5’-TTCACAGGAACTTACAAGGTCACCG-3’; The sequence information of rfbD-R1 is: 5’-ATTTTTCAACTGCTTCTTCACCCAAA-3’; The Streptococcus bovis strains are S. equinus NM-2-29, S. equinus NM-7, S. equinus NM-A1, S. equinus NM-L6, S. equinus NM-L9 or S. equinus NM-L12.

3. The identification primer for the Streptococcus bovis strain according to claim 1, characterized in that, The primer pair sequences are: deoD-F2 and rfbD-R2; The sequence information of deoD-F2 is: 5’-CAATCTCAATCTACGCAACTGAACTTATC-3’; The sequence information of rfbD-R2 is: 5’- ATTTTTCAACTGCTTCTTCACCCAAA-3’; The Streptococcus bovis strains are S. equinus NM-2-29, S. equinus NM-7, S. equinus NM-A1, S. equinus NM-L6, S. equinus NM-L9 or S. equinus NM-L12.

4. The identification primer for the Streptococcus bovis strain according to claim 1, characterized in that, The primer pair sequences are: 2-29-F and 2-29-R; The sequence information of 2-29-F is: 5’- CAGATGTAAAGGCACTGGCA -3’; The sequence information of 2-29-R is: 5’- TTGTACCGAATTTAGGGCTG -3’; The Streptococcus bovis strain is S. equinus NM-2-29.

5. The identification primer for the Streptococcus bovis strain according to claim 1, characterized in that, The primer pair sequences are: 7-F and 7-R; The sequence information of 7-F is: 5’- TAAGAAACAATCACCAGGAC -3’; The sequence information of 7-R is: 5’- AAAAAGACAAAAAGGAAAAG -3’; The Streptococcus bovis strain is S. equinus NM-7.

6. The identification primer for Streptococcus bovis strain according to claim 1, characterized in that, The primer pair sequences are: A1-F and A1-R; The sequence information of A1-F is: 5’- GATAGTCTGTTGGTATGGAG -3’; The sequence information of A1-R is: 5’- GTTTTTGAAGTTTTTGTGAT -3’; The Streptococcus bovis strain is S. equinus NM-A1.

7. The identification primer for Streptococcus bovis strain according to claim 1, characterized in that, The primer pair sequences are: L6-F and L6-R; The sequence information of L6-F is: 5’- CCTATATTTTTTCTTGCTATCC -3’; The sequence information of L6-R is: 5’- CACCCTAACACACTTTCTTACT -3’; The Streptococcus bovis strain is S. equinus NM-L6.

8. The identification primer for the Streptococcus bovis strain according to claim 1, characterized in that, The primer pair sequences are: L9-F and L9-R; The sequence information of L9-F is: 5’- TTGTAACGAACAAGTGCCG -3’; The sequence information of L9-R is: 5’- AACTCTCCCCATACCCTGA -3’; The Streptococcus bovis strain is S. equinus NM-L9.

9. The identification primer of Streptococcus bovis according to claim 1, characterized in that, The primer pair sequences are: Seq-F1 and Seq-R1; The sequence information of Seq-F1 is: 5’-ATCCCCATTTCTCGCTCTAA-3’; The sequence information of Seq-R1 is: 5’-GCCTCTGCTGCTTCTTTGAC-3’.

10. The identification primer for Streptococcus bovis according to claim 1, characterized in that, The primer pair sequences are: Seq-F2 and Seq-R2; The sequence information of Seq-F2 is: 5’-GACGAAGACACAACAGCACAAGAAC-3’; The sequence information of Seq-R2 is: 5’-TATCGCAGCAATGGTAGAGAAAATG-3’.

Images