Wheat scab resistance QTL molecular marker and application thereof
By developing enzyme-cleared polymorphic sequence markers in the long arm of wheat 2D chromosomes, the problem of insufficient application of wheat gibberellia-resistant QTL in breeding was solved, rapid and accurate genotype selection was achieved, and breeding efficiency and disease resistance improvement effect was improved.
Patent Information
- Application Number
- CN202510458114.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-14
- Publication Date
- 2025-07-11
AI Technical Summary
The prior art is difficult to effectively use molecular markers to assist selection, resulting in insufficient application of wheat gibberellosis-resistant QTL in breeding, affecting the efficiency of disease resistance improvement of wheat varieties.
A wheat gibberellosis-resistant QTL molecular marker was developed at 524,519,822 bp on the long arm of wheat 2D chromosomes. It was developed by PCR amplification and EcoR V enzyme digestion. Polymorphic sequence markers were used to detect favorable and adverse allelic variations in wheat, and genotype selection was performed in combination with electrophoresis technology.
It achieves rapid and accurate genotype selection, improves wheat breeding efficiency, saves manpower and material resources, has good stability and high accuracy, and is suitable for breeding of gibberellosis-resistant varieties in different regions and years.
Smart Images
Figure CN120290768A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of molecular biology, and particularly relates to a molecular marker for wheat scab resistance QTL and its application. Background Art
[0002] Wheat (Triticum aestivum L.) is one of the most important food crops in the world. Wheat scab is a fungal disease caused by the Fusarium graminearum complex, which not only causes serious yield losses, but also the toxins produced by the pathogen infection seriously affect the quality of wheat. Excessive consumption will pose a serious threat to the safety of humans and animals. In China, the wheat scab poses the greatest threat to the wheat-growing areas in the Yangtze River Basin. However, with the global climate warming and the change of farming systems, the occurrence area of wheat scab is expanding year by year, and the epidemic frequency is continuously increasing, seriously threatening the safe production of wheat in China. Wheat scab is a disease controlled by multiple genes. Cultivating wheat varieties resistant to scab by using resistance QTL is the most effective and safe way to prevent the damage of wheat scab. Although many scab resistance QTLs have been mapped, few of them can be applied in breeding and achieve significant results. The reason is that wheat scab is greatly affected by factors such as environment, genetic background and identification methods. The accurate mapping of scab resistance QTL and the development of related molecular markers are helpful to further understand the resistance mechanism of host wheat to scab and are beneficial to cultivating wheat varieties resistant to scab.
[0003] Previously, the inventor introduced a recombinant inbred line population derived from the cross of Haas / JH from the International Maize and Wheat Improvement Center (CIMMYT), carried out scab inoculation identification and QTL mapping analysis on this population, and detected a new and stable scab resistance QTL, Qfhb.yzu-2DL, on the long arm of chromosome 2D of wheat variety JH. Combining the genotype and scab phenotype results analysis of the natural population, it was found that this QTL could significantly reduce the diseased spikelet rate. If this QTL was introduced during the breeding process, it could improve the improvement efficiency of scab-resistant varieties.
[0004] With the rapid development of molecular biology, molecular marker-assisted selection technology has been maturely applied in crop breeding. This technology can quickly and accurately analyze the genetic composition of individuals at the molecular level, so as to achieve direct selection of genotypes, help breeders select desired genotypes and traits, improve breeding efficiency, and accelerate the breeding process. Searching for molecular markers tightly linked to target traits is the prerequisite for molecular marker-assisted selection breeding. Cleaved Amplified Polymorphic Sequence (CAPS) marker is a molecular marker technology based on PCR and enzyme digestion. It distinguishes the polymorphism of the amplified region by digesting the PCR-amplified DNA fragments with restriction endonucleases, and has the advantages of low cost, simple operation, high specificity, short cycle, etc. Summary of the Invention
[0005] Technical problem to be solved: Aiming at the above technical problems, the present invention provides a QTL molecular marker for wheat Fusarium head blight resistance and its application. Discovering the QTL of wheat Fusarium head blight resistance and developing molecular markers closely linked to it are crucial for molecular marker-assisted selection breeding of Fusarium head blight-resistant varieties.
[0006] Technical solution: In the first aspect, the present invention provides a QTL molecular marker for wheat Fusarium head blight resistance. The molecular marker is located at 524,519,822 bp on the long arm of wheat chromosome 2D, and the SNP allele variation is C / T.
[0007] Preferably, the upstream and downstream primer sequences for amplifying the molecular marker are shown in SEQ ID NO.1 - SEQ ID NO.2 respectively, and a DNA fragment with a size of 139 bp is obtained. The nucleotide sequence is shown in SEQ ID NO.3, as follows:
[0008] SEQ ID NO.1 (2D524519822_F): 5’-AACATTCTCAAGGCAACAAGATA-3’;
[0009] SEQ ID NO.2 (2D524519822_R): 5’-CTCTGCGGCTTCCAATACTC-3’;
[0010] SEQ ID NO.3:
[0011] AACATTCTCAAGGCAACAAGATA[T / C]CTAACTTTTTAGCATGCCAAGAATATGCTAGAAAGGTTGTTCAGACAACTTTTGGTGCACTTCAAAAATGCTTTACAATAATCCGTGGCCCTACTGAGTATTGGAAGCCGCAGAG.
[0012] In the second aspect, the present invention provides the application of the QTL molecular marker for wheat Fusarium head blight resistance described in the first aspect in predicting wheat Fusarium head blight resistance.
[0013] Preferably, using the sample wheat DNA as a template, SEQ ID NO.1 and SEQ ID NO.2 as primers for PCR amplification to obtain an amplification product, and using the restriction enzyme EcoR V to digest the obtained amplification product, followed by electrophoresis. If a DNA fragment of 139 bp in size exists, it is predicted that the sample wheat carries the unfavorable allele variation C for Fusarium head blight susceptibility, and its nucleotide sequence is as shown in SEQ ID NO.4; if a DNA fragment of 117 bp in size exists, it is predicted that the sample wheat carries the favorable allele variation T for Fusarium head blight susceptibility, and its nucleotide sequence is as shown in SEQ ID NO.5. Specifically:
[0014] SEQ ID NO.4:
[0015] AACATTCTCAAGGCAACAAGATACCTAACTTTTTAGCATGCCAAGAATATGCTAGAAAGGTTGTTCAGACAACTTTTGGTGCACTTCAAAAATGCTTTACAATAATCCGTGGCCCTACTGAGTATTGGAAGCCGCAGAG;
[0016] SEQ ID NO.5:
[0017] ATCTAACTTTTTAGCATGCCAAGAATATGCTAGAAAGGTTGTTCAGACA ACTTTTGGTGCACTTCAAAAATGCTTTACAATAATCCGTGGCCCTACTGAGT ATTGGAAGCCGCAGAG.
[0018] Furthermore, the PCR amplification system: 5 μL of template DNA, 0.4 μL each of 10 μmol / L upstream and downstream primers, 0.4 μL of 10 mM dNTPs, 2 μL of 10×PCR Buffer, 0.1 μL of rTaq enzyme, and ddH2O to make up to 20 μL;
[0019] The PCR reaction program is: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 45 s, for 35 cycles; extension at 72°C for 5 min;
[0020] The digestion system is: 5 μL of PCR amplification product, 2 μL of 10×H buffer, 0.1 μL of restriction enzyme EcoR V, 12.9 μL of ddH2O, and digestion at 37°C for 2 h.
[0021] Third aspect, the present invention provides a pair of primer pairs for predicting the resistance of wheat to Fusarium head blight, and the nucleotide sequences of the primer pairs are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively.
[0022] Fourth aspect, the present invention provides the application of the molecular marker described in the first aspect in wheat breeding.
[0023] Beneficial effects: The occurrence degree of Fusarium head blight is affected by many factors such as variety and environment. The disease occurrence degrees are not consistent in different years and regions. Therefore, specific conditions are often required when identifying the resistance level of wheat varieties to Fusarium head blight. The molecular marker for detecting Fusarium head blight QTL in the present invention can distinguish its favorable and unfavorable allelic variations through genotypes, and can save a large amount of manpower, material resources and time for the breeding of wheat varieties resistant to Fusarium head blight. The restriction fragment length polymorphism sequence marker for detecting the Fusarium head blight QTL locus of wheat provided by the present invention uses PCR, restriction endonuclease and electrophoresis techniques to perform genotype selection on the Fusarium head blight QTL of wheat so as to achieve the purpose of using molecular marker-assisted selection to breed wheat varieties resistant to Fusarium head blight. Stable and clear bands can appear in the breeding population composed of 469 natural varieties preserved in the inventor's laboratory for this marker, and it has advantages such as good stability and high accuracy. Description of the Drawings
[0024] Figure 1 It is the agarose gel electrophoresis diagram of molecular marker 2D524519822 for Haas and JH and 18 randomly selected advanced generation recombinant inbred lines derived from their hybridization. After the enzyme digestion products are electrophoresed on a 5% agarose gel, the lines with a band size of 117bp carry the favorable allelic variation resistant to Fusarium head blight and are consistent with JH; the lines with a band size of 139bp carry the unfavorable allelic variation susceptible to Fusarium head blight and are consistent with Haas.
[0025] Figure 2 It is the effect analysis of the diseased spikelet rate of the recombinant inbred line strains with favorable allelic variation genotypes and unfavorable allelic variation genotypes in Example 1. Detailed Embodiments
[0026] The present invention will be described in detail below with reference to the drawings and specific embodiments:
[0027] The experimental methods used in the examples are all conventional methods unless otherwise specified; the materials, reagents, etc. used can be obtained from commercial channels unless otherwise specified.
[0028] Example 1
[0029] Using the wheat varieties Haas and JH from the International Maize and Wheat Improvement Center (CIMMYT) and 153 progeny lines derived from their cross (shown in Table 1 below), the genotype of the Fusarium head blight resistance QTL locus located on chromosome 2D was detected by the enzyme digestion amplified polymorphic sequence marker 2D524519822, and statistical analysis was performed in combination with the Fusarium head blight phenotype.
[0030] Table 1 Names and sources of 153 wheat lines derived from Haas and JH
[0031]
[0032]
[0033]
[0034] The specific steps are as follows:
[0035] S1. Extraction of wheat sample DNA
[0036] ① Take about 5 cm of green wheat leaves, tear them up and put them into a 2 mL centrifuge tube;
[0037] ② Add 1 grinding steel bead, tighten the lid, put the centrifuge tube into liquid nitrogen and freeze for 60 s, grind the sample with a grinder for 30 s, and the frequency of the grinder is 1400 r / min until the leaves become powdery;
[0038] ③ Add 1 mL of 1.5×CTAB extraction solution to the ground sample, shake well, and put it into an oven at 70 °C for 1 h, shaking once every 20 min during this period;
[0039] ④ Cool to room temperature, add 500 μL of chloroform, invert and mix well, centrifuge at 12000 r / min, balance and centrifuge for 5 min;
[0040] ⑤ Pipette 600 μL of the supernatant into a new 1.5 mL centrifuge tube, add an equal volume of isopropanol, invert and mix well, let it stand at -20 °C for 1 h; centrifuge at 12000 r / min, balance and centrifuge for 5 min, discard the supernatant;
[0041] ⑥ Add 1 mL of 75% alcohol for washing, shake well and let it stand for 1 h;
[0042] ⑦ Centrifuge at 12000 r / min, balance and centrifuge for 5 min, discard the alcohol, pipette the excess liquid, and air dry at room temperature until the alcohol completely evaporates;
[0043] ⑧ Add 300 μL of ddH2O to dissolve and store at -20 °C for standby.
[0044] S2. PCR amplification and detection
[0045] The 20 μL PCR reaction system is as follows: 5 μL of template DNA, 0.4 μL each of 10 μmol / L upstream and downstream primers, 0.4 μL of 10 mM dNTPs, 2 μL of 10×PCR Buffer, 0.1 μL of rTaq enzyme, and 11.7 μL of ddH2O;
[0046] The PCR reaction program is as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 45 s, for 35 cycles; extension at 72°C for 5 min, and preservation at 16°C;
[0047] The digestion system is as follows: 5 μL of PCR amplification product, 2 μL of 10×H buffer, 0.1 μL of restriction enzyme EcoR V, 12.9 μL of ddH2O, and digestion at 37°C for 2 h;
[0048] The digested products were separated by electrophoresis on a 5.0% agarose gel. The electrophoresis results of the parents Haas and JH and 18 randomly selected offspring lines are as Figure 1 shown: The band with a fragment size of 139 bp after digestion of the amplification product is the line carrying the unfavorable allele variation, and the band with a fragment size of 117 bp is the line carrying the favorable allele variation.
[0049] S3. Genotypes of the target loci of all recombinant inbred lines were counted, and statistical analysis was performed in combination with the phenotypic data in 2023 and 2024. There were 71 lines carrying the Haas allele variation, 81 lines carrying the JH allele variation, and 1 heterozygous line carrying both the Haas and JH allele variations.
[0050] As Figure 2 shown, there was a significant difference in the diseased spikelet rate between the lines carrying the unfavorable Haas allele variation and the favorable JH allele variation. When the band size detected by PCR combined with digestion and electrophoresis was 139 bp, it indicated that the line carried the unfavorable allele variation; when the detection result was 117 bp, the line carried the favorable allele variation.
[0051] Example 2
[0052] 469 varieties from the natural population (shown in Table 2 below) were taken, and the genotypes of the QTL related to Fusarium head blight resistance located on chromosome 2D were detected using the restriction enzyme amplified polymorphism sequence marker 2D524519822.
[0053] Table 2 Names, sources, and genotypes of 469 varieties (lines) in the natural population
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067] Note: a R is the disease-resistant allele variant, and S is the disease-susceptible allele variant.
[0068] The specific steps are as follows:
[0069] Steps S1 - S2 are the same as those in Example 1;
[0070] S3. Statistically analyze the genotypes of the target loci of all varieties (lines). There are 329 varieties (lines) carrying the favorable allele variant and 140 varieties (lines) carrying the unfavorable allele variant. Among them, among the 398 materials from Jiangsu Province, 290 materials carry the favorable allele variant, accounting for as high as 72.9%. In the natural population, the distribution of allele variants is relatively wide. Varieties (lines) from the same region may carry different allele variants, indicating that positive selection has been carried out on the Fusarium head blight resistance locus during the breeding process, which has no negative effect on agronomic and yield traits and can be applied in different wheat-growing areas.
[0071] It has been confirmed through the above experiments that the primer sequences related to the restriction fragment length polymorphism sequence marker 2D524519822 can detect the allele variants at the Qfhb.yzu - 2DL locus of wheat varieties. This marker was screened in the natural population constructed in the inventor's laboratory. 70% of the varieties (lines) carry the favorable allele variant. Using this marker to select varieties (lines) carrying the favorable allele variant at this locus during the breeding process can greatly save the time and labor input for breeding Fusarium head blight-resistant varieties and improve the efficiency of improving wheat resistance to Fusarium head blight.
[0072] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.
Claims
1. A QTL molecular marker for resistance to Fusarium head blight in wheat, characterized in that: The molecular marker is located at 524,519,822 bp on the long arm of wheat chromosome 2D, and the SNP allelic variation is C / T.
2. A QTL molecular marker for wheat scab resistance according to claim 1, characterized in that: The upstream and downstream primer sequences for amplifying the molecular marker are shown in SEQ ID NO.1 - SEQ ID NO.2 respectively, and a DNA fragment with a size of 139 bp is obtained, and the nucleotide sequence is shown in SEQ ID NO.
3.
3. Application of the wheat Fusarium head blight resistance QTL molecular marker described in claim 2 in predicting wheat Fusarium head blight resistance.
4. The application according to claim 3, wherein: Using the sample wheat DNA as a template, SEQ ID NO.1 and SEQ ID NO.2 as primers for PCR amplification to obtain an amplification product, using the restriction enzyme EcoR V to digest the obtained amplification product, and electrophoresis. If a DNA fragment with a size of 139 bp exists, it is predicted that the sample wheat carries the unfavorable allelic variation C for Fusarium head blight; if a DNA fragment with a size of 117 bp exists, it is predicted that the sample wheat carries the favorable allelic variation T for Fusarium head blight.
5. The application according to claim 4, characterized in that, PCR amplification system: 5 μL of template DNA, 0.4 μL of each of the upstream and downstream primers at 10 μmol / L, 0.4 μL of 10 mM dNTPs, 2 μL of 10×PCR Buffer, 0.1 μL of rTaq enzyme, and supplemented with ddH2O to 20 μL; PCR reaction program: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 45 s, for 35 cycles; extension at 72°C for 5 min; Digestion system: 5 μL of PCR amplification product, 2 μL of 10×H buffer, 0.1 μL of restriction enzyme EcoR V, 12.9 μL of ddH2O, digestion at 37°C for 2 h.
6. A pair of primer pairs for predicting wheat resistance to Fusarium head blight, and the nucleotide sequences of the primer pairs are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively.
7. Application of the molecular marker described in claim 1 or 2 in wheat breeding.