Application of SNP (Single Nucleotide Polymorphism) site related to wheat scab resistance

By detecting the polymorphisms of SNP sites in the wheat genome, especially the SNP1 site, combined with KASP labeling technology, the difficulties in wheat gibberellia resistance identification and breeding were solved, and rapid and accurate breeding of disease-resistant varieties were achieved.

CN120290773APending Publication Date: 2025-07-11CROP RESOURCES RES INST OF HEILONGJIANG ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510520886.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-24
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

The prior art is scarce about genetic resources related to resistance to gibberellosis in wheat in medium and medium-sized wheat, lacking effective molecular markers, making it difficult to quickly and efficiently identify and assist breeding.

Method used

Specific PCR primer compositions were used to detect the polymorphisms of SNP sites in the wheat genome, especially the SNP1 site (nucleotide species T or C), and identify or assist in the identification of wheat gibberellosis resistance through KASP labeling technology, and wheat breeding was carried out in combination with the KASP labeling system.

Benefits of technology

The rapid and accurate identification of wheat gibberellosis resistance has been achieved, and the efficiency of wheat breeding has been improved. The selection of wheat varieties that are resistant to gibberellosis has been selected, which has significantly improved the disease resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290773A_ABST
    Figure CN120290773A_ABST
Patent Text Reader

Abstract

The invention discloses application of an SNP (Single Nucleotide Polymorphism) site related to wheat scab resistance, and belongs to the field of biochemistry. The invention aims to solve the technical problem of how to identify or assist in identifying the wheat scab resistance and assist in breeding according to the wheat scab resistance. One scheme of the invention is application of a composition for detecting polymorphism or genotype of an SNP site in a wheat genome in identification or auxiliary identification of wheat scab resistance. The SNP site is SNP1 and is an SNP site in a wheat genome, the nucleotide type of the SNP site is T or C, and the SNP site is the 36th nucleotide in SEQ ID No.1. The polymorphism of the SNP1 is directly expressed in the form of DNA and can be detected in each tissue and each development stage of wheat, the wheat scab resistance can be predicted, and the breeding process of a new variety of disease-resistant wheat is accelerated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biochemistry, and particularly to the application of SNP loci related to wheat scab resistance. Background Art

[0002] Wheat scab ( Fusarium head blight,FHB ), caused by fungi of the genus Fusarium ( Fusarium ), is a fungal disease that widely occurs in warm and humid and semi-humid regions. During the flowering period of wheat ( Triticum aestivum L. ), the release concentration of ascospores of Fusarium graminearum increases, and scab occurs severely. In China, the occurrence of scab has a tendency to expand from south to north and from east to west. In recent years, affected by climate change and straw returning under the wheat-corn rotation system, etc., the occurrence area of scab has been continuously expanding, and the frequency of moderate and above epidemics has also increased year by year. Wheat scab initially presents water-soaked brown spots with unclear edges on the glumes, and gradually expands to the whole spikelet, and then withers, and a pink mold layer appears at the lesion. The harms of scab include yield reduction, quality decline, toxin residues, etc. Scab can cause wheat sterility, reduced grain plumpness, and yield decline, generally reducing production by 10%-15%, and sometimes higher than 50%. The seed germination rate is low, and seedling rot and stem rot occur, resulting in seedling shortage and yield reduction. Fusarium can produce various toxins, such as deoxynivalenol (DON), etc. DON will cause symptoms such as dizziness, nausea, vomiting, diarrhea, fever, etc.

[0003] In recent years, domestic and foreign scholars have carried out a series of studies in aspects such as the discovery of disease-resistant genes and the identification of germplasm resources. In terms of the discovery of disease-resistant genes, more than 60 scab-related QTLs have been mapped, which are distributed on the A, B, and D genomes. Currently, Fhb1 、 Fhb7 and other genes have been cloned. However, the discovered major disease-resistant genes are few, the molecular markers are lacking, and the disease-resistant sources available for breeding are scarce. There are very few germplasm resources with wheat scab resistance, and no immune materials have been found. KASP markers have been widely used to detect SNP loci in crops such as wheat, rice, and corn, and can achieve rapid and high-throughput genotyping. After using the genotype data of wheat SNP chips for QTL mapping and genome-wide association analysis and converting the linked SNPs into KASP markers, they can be directly applied to marker-assisted selection breeding. Summary of the Invention

[0004] One technical problem to be solved by the present invention is how to identify or assist in identifying wheat scab resistance.

[0005] To solve the above technical problems, the present invention provides the application of a composition for detecting the polymorphism or genotype (i.e., allele) of SNP sites in the wheat genome in identifying or assisting in the identification of Fusarium head blight resistance in wheat; the SNP site is named SNP1, which is an SNP site in the wheat genome, and its nucleotide type is T or C, which is the 36th nucleotide of SEQ ID No.1; the composition contains the PCR primer, and the PCR primer is P1 or P2: P1. The PCR primer is a primer group composed of a single-stranded DNA with a nucleotide sequence of positions 22-41 of SEQ ID No.2, a single-stranded DNA with a nucleotide sequence of positions 22-41 of SEQ ID No.3, and a single-stranded DNA with a nucleotide sequence of SEQ ID No.4; P2. The PCR primer is a primer group composed of a single-stranded DNA with a nucleotide sequence of SEQ ID No.2, a single-stranded DNA with a nucleotide sequence of SEQ ID No.3, and a single-stranded DNA with a nucleotide sequence of SEQ ID No.4.

[0006] To solve the above technical problems, the present invention also provides the application of a composition for detecting the polymorphism or genotype (i.e., allele) of SNP sites in the wheat genome in the preparation of a product for identifying or assisting in the identification of Fusarium head blight resistance in wheat; the SNP site is named SNP1, which is an SNP site in the wheat genome, and its nucleotide type is T or C, which is the 36th nucleotide of SEQ ID No.1; the composition contains the PCR primer, and the PCR primer is the above P1 or the above P2.

[0007] To solve the above technical problems, the present invention also provides the application of a composition for detecting the polymorphism or genotype (i.e., allele) of the SNP site in the wheat genome in wheat breeding or in the preparation of wheat breeding products; the SNP site is named SNP1, which is an SNP site in the wheat genome, and its nucleotide type is T or C, which is the 36th nucleotide of SEQ ID No.1; the composition contains the PCR primer, and the PCR primer is the above P1 or the above P2.

[0008] The purpose of the breeding includes breeding wheat resistant to Fusarium head blight.

[0009] To solve the above technical problems, the present invention provides a method for identifying or assisting in the identification of Fusarium head blight resistance in wheat, including detecting the genotype of the wheat to be tested, and identifying or assisting in the identification of Fusarium head blight resistance in wheat according to the genotype of the wheat to be tested; the genotype is the genotype of the SNP1 locus in the wheat genome; the SNP1 locus is a SNP locus in the wheat genome, and its nucleotide type is T or C, which is the 36th nucleotide of SEQ ID No.1; the detection is carried out using PCR primers, and the PCR primers are the above-mentioned P1 or the above-mentioned P2.

[0010] Another technical problem to be solved by the present invention is how to conduct wheat breeding.

[0011] To solve the above technical problems, the present invention provides the following technical solutions: B1. The application of the above method in wheat breeding.

[0012] The purpose of the breeding includes selecting wheat resistant to Fusarium head blight.

[0013] B2. A method for wheat breeding, including: detecting the polymorphism of the SNP1 in the wheat genome, and selecting wheat with a homozygous type of C at the SNP1 locus in the wheat genome as a parent for breeding.

[0014] The purpose of the breeding includes selecting wheat resistant to Fusarium head blight.

[0015] Any one of the products in 1)-3) of the following composition containing the polymorphism or genotype (i.e., allele) of the SNP1 locus in the wheat genome also belongs to the protection scope of the present invention: 1) A product for detecting single nucleotide polymorphism or genotype related to Fusarium head blight resistance in wheat; 2) A product for identifying or assisting in the identification of Fusarium head blight resistance in wheat; 3) A product for wheat breeding.

[0016] In the above application, method and product, the SNP1 locus is a SNP locus in the wheat genome, and its nucleotide type is T or C, which is the 36th nucleotide of SEQ ID No.1. The detection of the polymorphism or genotype (i.e., allele) of the SNP1 locus in the wheat genome can specifically be the detection of the nucleotide type of the SNP1 locus. The genotype of the SNP1 locus in the wheat genome can be TT, CC or TC. The CC is the homozygous type of T at the SNP1 locus in the wheat genome, the CC is the homozygous type of C at the SNP1 locus in the wheat genome, and the TC is the heterozygous type of T and C at the SNP1 locus in the wheat genome.

[0017] In the above method, the identification or assisted identification of the Fusarium head blight resistance of wheat according to the genotype of the wheat to be tested may be that the Fusarium head blight resistance of the wheat to be tested with the genotype CC is stronger than or candidate stronger than that of the wheat to be tested with the genotype TT.

[0018] In the above application, method and product, the wheat breeding is to breed wheat resistant to Fusarium head blight.

[0019] In the above application, method and product, the composition for detecting the polymorphism or genotype (i.e., allele) of the SNP1 locus in the wheat genome may be the reagents and / or instruments required to determine the polymorphism or genotype of SNP1 by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP chip. Among them, the SNP chip includes a chip based on nucleic acid hybridization reaction, a chip based on single-base extension reaction, a chip based on allele-specific primer extension reaction, a chip based on "one-step" reaction, a chip based on primer ligation reaction, a chip based on restriction endonuclease reaction, a chip based on protein-DNA binding reaction, and a chip based on fluorescent molecule-DNA binding reaction.

[0020] In the above application, method and product, the composition for detecting the polymorphism or genotype (i.e., allele) of the SNP1 locus in the wheat genome is as follows 1), 2) or 3): D1) The composition for detecting the polymorphism or genotype of the SNP1 locus in the wheat genome contains PCR primers for amplifying a wheat genomic DNA fragment including the SNP1 locus. D2) The composition for detecting the polymorphism or genotype of the SNP1 locus in the wheat genome is a PCR reagent containing the PCR primers. D3) A kit containing the PCR primers described in D1) or the PCR reagent described in D2).

[0021] In the above application, method and product, the PCR primers may be labeled with a labeling agent. The labeling agent refers to any atom or molecule that can be used to provide a detectable effect and can be linked to nucleic acid. Labeling agents include but are not limited to dyes; radioactive labels, such as 32P; a conjugate moiety such as biotin; a hapten such as digoxin (DIG); a luminescent, phosphorescent or fluorescent moiety; and a separate fluorescent dye or a fluorescent dye combined with a moiety that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The label can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The label can be a charged moiety (positive or negative charge) or optionally, can be charge-neutral. The label can include a nucleic acid or protein sequence or a combination thereof, as long as the sequence containing the label is detectable. In some embodiments, the nucleic acid is directly detected without a label (e.g., directly reading the sequence). As described, the PCR primers can be a primer set consisting of single-stranded DNA with a nucleotide sequence of SEQ ID No.2, single-stranded DNA with a nucleotide sequence of SEQ ID No.3, and single-stranded DNA with a nucleotide sequence of SEQ ID No.4. SEQ ID No.2 in the sequence listing consists of 41 nucleotides, where nucleotides 1-21 are the FAM linker sequence (as a label), and nucleotides 22-41 are the specific sequence; SEQ ID No.3 in the sequence listing consists of 41 nucleotides, where nucleotides 1-21 are the HEX linker sequence (as a label), and nucleotides 22-41 are the specific sequence.

[0022] In the above applications, methods and products, the product can be a reagent or a kit or a system. The system can include a combined product of a reagent or a kit, an instrument and analysis software, such as a product consisting of PCR primers, PARMS master mix reagent, a microplate reader and the online software SNP decoder (http: / / www.snpway.com / snpdecoder01 / ), or a combined product consisting of PCR primers, PARMS master mix reagent, the online software SNP decoder and a real-time fluorescence quantitative PCR instrument. The product can include the above composition for detecting the polymorphism or genotype of SNP1 in the wheat genome.

[0023] The present invention discloses a new KASP marker for detecting the resistance to Fusarium head blight in wheat. The specific primer set provided by the present invention is composed of single-stranded DNA shown in SEQ ID No.2, single-stranded DNA shown in SEQ ID No.3, and single-stranded DNA shown in SEQ ID No.4, wherein the single-stranded DNA shown in SEQ ID No.2 and the single-stranded DNA shown in SEQ ID No.3 are provided with fluorescently labeled adapters. In one embodiment of the present invention, the above primer set with fluorescently labeled adapters is used to amplify the genomic DNA of 108 wheat varieties including the SNP1 locus, perform fluorescent signal processing, determine the nucleotide type of the SNP1 locus, and measure the resistance to Fusarium head blight of each variety. Experiments have proved that in the population composed of 108 wheat varieties, the average disease index of Fusarium head blight of homozygous wheat varieties (55) with the SNP1 locus being C is 43.6, which is significantly less than that of homozygous wheat varieties (48) with the SNP1 locus being T, which is 47.9, indicating that the resistance to Fusarium head blight of homozygous wheat varieties with the SNP1 locus being C is significantly stronger than that of homozygous wheat varieties with the SNP1 locus being T. It shows that SNP1 is a SNP molecular marker related to the resistance to Fusarium head blight in wheat. The specific primer set provided by the present invention can be used for identifying or assisting in the identification of the resistance to Fusarium head blight in wheat, can be used for screening wheat varieties resistant to Fusarium head blight, can be used for wheat molecular marker-assisted breeding, and can be used for the breeding and cultivation of wheat resistant to Fusarium head blight. The polymorphism of SNP1 is directly manifested in the form of DNA and can be detected in various tissues and at various developmental stages of wheat, which is conducive to predicting the resistance to Fusarium head blight quickly and conveniently. In practical applications, in order to improve the accuracy, substances for detecting the polymorphism and genotype of the SNP1 locus can be combined with other substances (such as substances for detecting other single nucleotide polymorphisms or genotypes related to the resistance to Fusarium head blight in wheat) to prepare products for identifying wheat varieties resistant to Fusarium head blight. The present invention has important theoretical significance and economic value for using molecular marker-assisted selection of disease-resistant wheat varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 shows the genotyping results of SNP1 of 108 wheat varieties by the KASP marker in Example 1 of the present invention. Among them, the genotype TT is marked in blue, the genotype CC is marked in red, and the genotype TC is marked in black. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0025] The present invention will be further described in detail below in conjunction with the specific embodiments. The embodiments given are only for clarifying the present invention, rather than limiting the scope of the present invention. The following embodiments provided can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.

[0026] In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence listing is the 5'-terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3'-terminal nucleotide of the corresponding DNA / RNA.

[0027] In the following examples, the experimental methods are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified.

[0028] In the following examples, SPSS 11.5 statistical software was used to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA test was used. P < 0.05 (*) indicates significant difference, P < 0.01 (**) indicates extremely significant difference, and P < 0.001 (***) indicates extremely significant difference.

[0029] In the following examples, Sumai 3 is a wheat variety bred by the Agricultural Science Research Institute of the Lixiahe Region in Jiangsu. It has good resistance to Fusarium head blight. This material is described in the non-patent literature "Ren Lijuan, Zhang Xu, Zhou Miaoping, et al. Analysis of the major gene + polygene mixed model for resistance to Fusarium head blight in Sumai 3 [J]. Jiangsu Journal of Agricultural Sciences, 2008, 24(06): 774-779.", and the public can obtain it from the applicant.

[0030] In the following examples, the synthetic wheat PS5 / V975 is a moderately scab-susceptible material introduced from Russia. It is a wheat artificially hybridized with Persian wheat PS5 as the female parent and Aegilops tauschii V975 as the male parent. Among them, V975 is recorded in the non-patent literature "Martin, S., Morrison III, W. & Akin, D. Fermentation of Maize Bran, Oat Bran, and Wheat Bran by Bacteroides ovatus V975. Curr Microbiol 36, 90–95 (1998). https: / / doi.org / 10.1007 / s002849900285", and PS5 is recorded in the non-patent literature "Zhu Z, Zhou R, Kong X, Dong Y, Jia J. Microsatellite markers linked to 2 powdery mildew resistance genes introgressed from Triticum carthlicum accession PS5 into common wheat. Genome. 2005 Aug;48(4):585-90. doi: 10.1139 / g05-016. PMID: 16094424.", which can be obtained by the public from the applicant.

[0031] Using PS5 / V975 as the female parent and Sumai 3 as the male parent to construct an RIL population, the PS5 / V975 / / Sumai 3 RIL population is obtained. This population is recorded in the non-patent literature "Zhu Zhanwang. Discovery of Wheat Scab Resistance Genes QTL and Development of Their KASP Markers by Using Genome-wide Linkage Analysis and Association Analysis [D]. Chinese Academy of Agricultural Sciences, 2020. DOI: 10.27630 / d.cnki.gznky.2020.000236.", which can be obtained by the public from the applicant.

[0032] The Fusarium graminearum in the following examples has been disclosed in the literature "Xu Lingling. (2022). Research Progress on Wheat Scab and Fusarium graminearum. South China Agriculture (16), 32-35. doi: 10.19415 / j.cnki.1673-890x.2022.16.011.", which can be obtained by the public from the applicant.

[0033] Example 1 Discovery of Scab Resistance Gene QTL and Obtaining of Its KASP Marker I. Obtaining of Phenotype The 215 families of the Sumai 3 RIL population and their parents were planted at the experimental sites in Harbin, Heilongjiang and Gongzhuling, Heilongjiang from 2018 to 2019 and from 2021 to 2022. A completely randomized block design was used with 2 replicates, single-row plots, a row spacing of 0.4 m, a row length of 1.0 m, and 50 seeds sown evenly in each row. Field management was carried out according to local practices.

[0034] Inoculation was carried out in the field by the method of single-flower drip: during the flowering stage of wheat, 10 μl of a prepared spore suspension of Fusarium graminearum (1 μl containing 100 conidia) was injected into the 5th spikelet from top to bottom of each spike. 10 spikes of each line were inoculated, and after inoculation, atomized moisture was maintained for 3 days. At 21 days after inoculation, the number of diseased spikes, the number of spikelets per spike, and the number of diseased spikelets were investigated.

[0035] Fusarium head blight index (FHB index) = incidence × severity / 100 Among them, the incidence was the ratio of the number of diseased spikes to the total number of spikes, and the severity was the average value of the ratio of the number of diseased spikelets per spike to the number of spikelets, both expressed as a percentage (Reference: STACK R W, MCMULLEN M P, 1994. A visual scale to estimate severity of Fusarium head blight in Wheat. North Dakota State University Extension Service: 1095.).

[0036] Using the modified CTAB method, genomic DNA of young leaves of 215 families was extracted. The DNA concentration was measured with a NanoDrop2000c spectrophotometer, and the DNA samples were adjusted to a standard concentration of 50 ng / μl. Then, the DNA quality was detected with 0.8% agarose gel, and the DNA with qualified quality was subjected to SNP genotyping. SNP analysis was performed using a 50K SNP chip from Affymetrix Axiom.

[0037] II. Linkage map construction The 50K SNP chip contained a total of 54,680 markers, and 11,489 markers were different between the parents. After removing the markers with heterozygosity and a missing rate greater than 10% between the parents, 9,863 markers remained. After using the IciMapping 4.1 bin function to remove redundant markers, a high-density genetic map was constructed, which contained 1,158 markers.

[0038] III. QTL analysis The QTL analysis was performed using the IciMapping 4.1 ICIM-ADD method with a LOD value of 3.0, and a new stable Fusarium head blight resistance QTL was mapped on chromosome 3B, named QFHBR.haas-3BL , which was tightly linked to AX-110668302 (SEQ ID No.1) and could explain 7.6 - 10.4% of the phenotypic variation. Its flanking markers AX-110668302 . The flanking marker locus QFHBR.haas-3BL of the wheat Fusarium head blight resistance QTL AX-110668302 at this SNP locus is called SNP1, corresponding to the 36th position of SEQ ID No.1, and its nucleotide is either T or C, represented by the letter Y. One allele genotype of this SNP locus is TT (i.e., the homozygous type with nucleotide T at the 36th position of SEQ ID No.1); its other allele genotype is CC (i.e., the homozygous type with nucleotide C at the 36th position of SEQ ID No.1); its third allele genotype is TC (i.e., the heterozygous type with nucleotides T and C at the 36th position of SEQ ID No.1) 。

[0039] SEQ ID No.1: CAAGTGGCAACTTCTGGTTCCGCTGAGAGACTGACYAGAAAAGTGTCCCCCATGTGCGCCAGTGCCTACTC Principle of KASP: Three primers are required for amplification, two forward competitive primers (the 5'-end of the primers has a base sequence complementary to the fluorescent groups HEX and FAM, and the other sequences only differ at the SNP and InDel at the 3'-end) and one reverse common primer; the PCR reaction system contains a universal sequence modified with a fluorescent group and a quenching group (Master Mix is provided by LGC company). Therefore, the forward primer can specifically bind to the DNA with the same genotype as it. The two forward primers can emit two different colors of light. If the locus on the template strand is homozygous, a single, matching fluorescence is emitted. If it is heterozygous, two fluorescences can be emitted simultaneously.

[0040] According to the principle of KASP, KASP primers were designed for the SNP1 at the flanking marker locus QFHBR.haas-3BL of the wheat Fusarium head blight resistance QTL AX- 110668302 . The primer sequences are shown in Table 1.

[0041] Table 1 KASP primer sequence table for detecting the Fusarium head blight resistance QTL QFHBR.haas-3BL

[0042] The single-stranded DNA molecules shown in SEQ ID No.2 and SEQ ID No.4 amplify the fragment of SEQ ID No.1 where the 36th nucleotide is T. The fluorescence signal of the fluorophore bound to the FAM sequence can be read using a microplate reader or a real-time fluorescence quantitative PCR instrument. The single-stranded DNA molecules shown in SEQ ID No.3 and SEQ ID No.4 amplify the fragment of SEQ ID No.1 where the 36th nucleotide is C. The fluorescence signal of the fluorophore bound to the HEX sequence can be read using a microplate reader or a real-time fluorescence quantitative PCR instrument.

[0043] The KASP marker PCR amplification system has the following components in each 4 μl reaction system: 0.048 μl Primer Mix, 2.0 μl Master Mix, 1.952 μl Template DNA (50 ng / μl). The Master Mix is purchased from LGC. The ratio of Primer Mix is: 12% HEX primer (upstream primer B), 12% FAM primer (upstream primer A), 30% Common primer (downstream primer). The primers are synthesized by Sangon Biotech (Shanghai) Co., Ltd. Amplification is performed using a 384-well PCR instrument (BIO-RAD, S1000TM Thermal Cycler).

[0044] The amplification program is as follows: 94°C for 15 min; 94°C for 20 s, 63 - 55°C for 1 min (decreasing 1°C per cycle), for 10 cycles; 94°C for 20 s, 55°C for 60 s, for 32 cycles. The PCR amplification products are placed in an automatic focusing fluorescence multi-functional microplate reader (PHERAstarplus SNP, BMG LABTECH) to read the final fluorescence data, and then the data is imported into the Klustercaller v3.4 software (LGC, Hoddesdon, UK) for genotyping.

[0045] IV. Utilization of primer pairs The experimental materials are 108 wheat varieties, as shown in Table 3 specifically.

[0046] Each experimental material was planted at the experimental site in Xinxiang, Henan in the 2018 - 2019 and 2021 - 2022 growing seasons. A completely randomized block design was used, with 2 replicates, single-row plots, row spacing of 0.4 m, row length of 1.0 m, and 50 seeds evenly sown in each row. Field management was carried out according to local practices. Inoculation was carried out by single-flower drip irrigation in the field. The inoculation method and the phenotype identification method are the same as those in the first part.

[0047] All experimental materials were detected using the primer sequences in Table 1 above, the KASP marker PCR amplification system, and the amplification program.

[0048] The results are shown in Table 2 and Figure 1 : Table 2 Genotype detection results and disease index of 108 wheat varieties

[0049] Among the 108 wheat varieties, 48 varieties showed the same genotype TT as PS5 / V975, and the average scab disease index was 52.1. 55 varieties showed the same genotype CC as Sumai 3, and the average scab disease index was 40.2; 5 varieties showed TC. Statistical tests showed QFHBR.haas-3BL that the gene effects reached significant differences ( P < 0.05).

[0050] In summary, the scab disease index of wheat varieties with the SNP1 genotype of CC was significantly lower than that of wheat varieties with the SNP1 genotype of TT, indicating that the scab resistance of wheat with the SNP1 genotype of CC (excellent allele) was significantly stronger than that of wheat with the SNP1 genotype of TT (non-excellent allele).

[0051] The above has detailed the present invention. For those skilled in the art, without departing from the purpose and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to cover any modification, use or improvement of the present invention, including modifications made with conventional techniques known in the art that depart from the scope disclosed in this application. Some basic features can be applied according to the scope of the appended claims below.

Claims

1. Use of a composition for detecting the polymorphism or genotype of SNP sites in the wheat genome in identifying or assisting in the identification of wheat scab resistance; characterized in that: The SNP locus is SNP1, which is a SNP locus in the wheat genome. Its nucleotide type is T or C, and it is the 36th nucleotide of SEQ ID No.

1. The composition contains PCR primers, and the PCR primers are P1 or P2: P1. The PCR primer is a primer set composed of a single-stranded DNA with a nucleotide sequence from the 22nd to 41st positions of SEQ ID No.2, a single-stranded DNA with a nucleotide sequence from the 22nd to 41st positions of SEQ ID No.3, and a single-stranded DNA with a nucleotide sequence of SEQ ID No.4; P2. The PCR primer is a primer set composed of a single-stranded DNA with a nucleotide sequence of SEQ ID No.2, a single-stranded DNA with a nucleotide sequence of SEQ ID No.3, and a single-stranded DNA with a nucleotide sequence of SEQ ID No.

4.

2. Use of a composition for detecting the polymorphism or genotype of SNP loci in the wheat genome in the preparation of a product for identifying or assisting in the identification of wheat scab resistance; characterized in that: The SNP locus is SNP1, which is a SNP locus in the wheat genome. Its nucleotide type is T or C, and it is the 36th nucleotide of SEQ ID No.

1. The composition contains PCR primers, and the PCR primers are P1 as described in claim 1 or P2 as described in claim 1.

3. Use of a composition for detecting the polymorphism or genotype of SNP sites in the wheat genome in wheat breeding or in the preparation of wheat breeding products, characterized in that: The SNP locus is SNP1, which is a SNP locus in the wheat genome. Its nucleotide type is T or C, and it is the 36th nucleotide of SEQ ID No.

1. The composition contains PCR primers, and the PCR primers are P1 as described in claim 1 or P2 as described in claim 1.

4. A method for identifying or assisting in the identification of Fusarium head blight resistance in wheat, comprising detecting the genotype of the wheat to be tested and identifying or assisting in the identification of Fusarium head blight resistance in the wheat according to the genotype of the wheat to be tested; characterized in that: The genotype is the genotype of SNP1 in the wheat genome. SNP1 is a SNP locus in the wheat genome. Its nucleotide type is T or C, and it is the 36th nucleotide of SEQ ID No.

1. The detection is carried out using PCR primers, and the PCR primers are P1 as described in claim 1 or P2 as described in claim 1.

5. Use of the method according to claim 4 in wheat breeding.

6. A method for wheat breeding, characterized in that: The method includes: detecting the polymorphism of SNP1 described in claim 1 in the wheat genome, and selecting homozygous wheat with the SNP1 locus being A in the wheat genome as a parent for breeding.

7. A product containing a composition for detecting the polymorphism or genotype of SNP1 in the wheat genome, which is any one of the products in 1)-3): 1) A product for detecting single nucleotide polymorphism or genotype related to wheat scab resistance; 2) A product for identifying or assisting in identifying wheat scab resistance; 3) A product for wheat breeding; SNP1 is a SNP locus in the wheat genome. Its nucleotide type is T or C, and it is the 36th nucleotide of SEQ ID No.

1.

8. The application according to any one of claims 1-3 and 5, the method according to claim 4 or 6, or the product according to claim 7, characterized in that: The wheat breeding is to breed wheat resistant to scab.

9. The application according to any one of claims 1-3, 5 and 8, the method according to claim 4, 6 or 8, or the product according to claim 7 or 8, characterized in that: The composition for detecting the polymorphism or genotype of SNP1 in the wheat genome is one of the following D1), D2) or D3): D1. The composition for detecting the polymorphism or genotype of SNP1 in the wheat genome contains PCR primers for amplifying a wheat genomic DNA fragment including the SNP1 locus; D2) The composition for detecting the polymorphism or genotype of SNP1 in the wheat genome is a PCR reagent containing the said PCR primers; D3) A kit containing the PCR primers described in D1) or the PCR reagent described in D2).

10. The application, method or product according to claim 9, characterized in that: The said PCR primers are a primer set composed of the single-stranded DNA shown in SEQ ID No.1 in the sequence listing, the single-stranded DNA shown in SEQ ID No.2 in the sequence listing, and the single-stranded DNA shown in SEQ ID No.3 in the sequence listing.