Primer and kit for detecting anthracnose resistance of mangifera indica

By designing specific primers and kits for detecting anthrax resistance in koji, real-time fluorescence quantitative PCR is used to perform real-time fluorescence quantitative PCR, the problem of scarce germplasm resources in koji is solved, and efficient resistant germplasm screening and breeding is achieved.

CN120290774APending Publication Date: 2025-07-11ENVIRONMENT & PLANT PROTECTION INST CHINESE ACADEMY OF TROPICAL AGRI SCI +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510530195.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-25
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

In the prior art, the germplasm resources and resistance genes of anthrax resistance are scarce, and effective detection methods are lacking, which affects the yield and quality of germplasm.

Method used

Specific primers and kits for detecting anthrax resistance in Oggo were designed, and FAM fluorophores and MGB quenching groups were labeled using TaqMan probes to perform real-time fluorescence quantitative PCR detection to screen resistant germplasm resources.

Benefits of technology

It has achieved efficient screening and identification of anthrax-resistant germplasm in the fruit, supported the creation of resistant germplasm resources, and improved the efficiency of germplasm disease-resistant breeding in the fruit.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290774A_ABST
    Figure CN120290774A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of molecular biology, in particular to primers and a kit for detecting anthracnose resistance of mangifera indica. The kit comprises two groups of TaqMan probe primers TGT-Probe and 2 * TGT-Probe, wherein the TGT-Probe and the 2 * TGT-Probe are used as primers. According to the invention, MiZTP29l is used as a candidate gene, and then 32 parts of collected mango germplasm are subjected to sequence comparison; specific polymorphic sites' TGT 'and' TGTTGT 'are mined in a 3' UTR region and are designed into primers for anthracnose resistance related gene identification, a fluorophore is FAM, a quenching group is MGB, a TaqMan probe is used for labeling and verification is performed in different mango germplasm, screening of field resistant germplasm is facilitated, and the method is simple and convenient to implement. And the method has important significance on breeding of anthracnose-resistant germplasm of mangifera indica, creation of resistant germplasm resources and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and particularly relates to primers and kits for detecting anthracnose resistance in mangoes. Background Art

[0002] Mango is an economically and nutritionally important tropical and subtropical fruit tree crop. China is one of the major mango-producing countries in the world. Mango has a long planting history and has become an important characteristic agricultural industry in tropical regions. Anthracnose is one of the main diseases seriously affecting the yield and quality of mangoes. In the mango industry, the importance of preventing the harm of anthracnose to mangoes is increasing day by day. Therefore, the screening and utilization of disease-resistant germplasm resources have become one of the most important control methods. However, there is a lack of disease-resistant germplasm resources and resistance genes at present. With the publication of the mango whole-genome sequencing results (Wang P, Luo Y, Huang J, et al. The genome evolution and domestication of tropical fruit mango[J]. Genome biology, 2020, 21: 1-17.), it provides a solid foundation for analyzing functional genes at the whole-genome level, bringing great convenience to the development of whole-genome association analysis of mango disease resistance, the cloning and identification of disease-resistant candidate genes, as well as the diversity selection of candidate resistance-related genes, the design and verification of SNP-specific primers. By identifying the functions of disease-resistant genes and mining and designing SNP sites of key genes closely related to disease resistance, it is of great significance for the breeding of anthracnose-resistant mango germplasms and the creation of disease-resistant germplasm resources. Summary of the Invention

[0003] Aiming at the above deficiencies in the prior art, the purpose of the present invention is to provide primers and kits for detecting anthracnose resistance in mangoes.

[0004] To achieve the above invention purpose, the technical solution adopted by the present invention is as follows:

[0005] In the first aspect, primers for detecting anthracnose resistance in mangoes are provided, which include 2 sets of TaqMan probe primers, and the primer and probe sequence information is as follows:

[0006] TGT-ZTP29l-F: TCCTCTTAATGTGTTTCGATCAAG;

[0007] TGT-Probe: CATGTATTAAGTAAGGTACTATG;

[0008] TGT-ZTP29l-R: CTATTTTACCTCCCCATGTCCTT;

[0009] 2*TGT-ZTP29l-F: GAAAGATCCTACTACATAATCCTCTTAATG;

[0010] 2*TGT-Probe: CATGTTGTATTAAGTAAGGTAC;

[0011] 2*TGT-ZTP29l-R: TGTCCTTGCCACAAATTGATG.

[0012] Furthermore, each set of probes includes one FAM fluorophore and one MGB quencher.

[0013] In the second aspect, a kit containing the above primers for detecting anthracnose resistance in mango is provided.

[0014] The beneficial effects of the present invention are as follows:

[0015] In the present invention, MiZTP29l was used as a candidate gene. Subsequently, sequence alignment was performed on 32 mango germplasms collected, and specific polymorphic sites "TGT" and "TGTTGT" were discovered in the 3'UTR region and designed as primers for identifying genes related to anthracnose resistance. The fluorophore is FAM, and the quencher is MGB. TaqMan probes were used for labeling and verified in different mango germplasms, which is beneficial for screening resistant germplasms in the field and is of great significance for the breeding of anthracnose-resistant mango germplasms and the creation of resistant germplasm resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 is the result of genome-wide association analysis;

[0017] Figure 2 is the expression level of the candidate gene under Cg treatment;

[0018] Figure 3 is the bioinformatics analysis of MiZTP29l; wherein: A is the prediction of the tertiary structure of the MiZTP29l protein; B is the transmembrane structure diagram of the MiZTP29l protein; C is the conserved domain of the MiZTP29l protein;

[0019] Figure 4 is the phylogenetic tree of mango and 29 plant MiZTP29l;

[0020] Figure 5 is the relationship between the anthracnose lesion area and the AA, TA, and TT genotypes;

[0021] Figure 6 is the SNP locus of the MiZTP29l gene;

[0022] Figure 7It is the TGTTGT mutation site; among which: 8. Nandoumang; 48. Sanianmang; 53. Huangxiangya; 59. Baixiangya; 83. Longjingdamang; 112. Repin 42; 123. Repin No. 5; 160. Zebad; 223. Hongjinhuang; 288. Haibaomang; 15. Qiumang; 36. India-2; 55. Mimang; 61. Tainong No. 1; 144. Tommy; 163. Sacred Heart; 216. Wildmang-1; 222. Kate; 225. Dongpoxiangmang; 266. Kent;

[0023] Figure 8 It is the amplification curve for specific verification of TaqMan probe TGT; among which: 1. Longjingdamang; 2. Zebda; 3. Hongjinhuang; 4. Haibaomang; 5. Tobacco; 6. Tomato; 7. Arabidopsis thaliana; 5-7 are negative controls; 8. Blank control;

[0024] Figure 9 It is the amplification curve for specific verification of TaqMan probe TGTTGT; among which: 1. Tainong No. 1; 2. Wildmang-1; 3. Kent; 4. Shanlin No. 1; 5. Tobacco; 6. Tomato; 7. Arabidopsis thaliana; 5-7 are negative controls; 8. Blank control;

[0025] Figure 10 It is the amplification for sensitivity verification of TaqMan probe TGT; among which: 1. Stock solution of Longjingdamang DNA (570 ng / μL); 2-7. 10 0 ~10 -5 Gradient dilution; 8. Blank control;

[0026] Figure 11 It is the amplification curve for sensitivity verification of TaqMan probe TGTTGT; among which: 1. Stock solution of Tainong No. 1 DNA (650 ng / μL); 2-7. 10 0 ~10 -5 Gradient dilution; 8. Blank control. Specific embodiments

[0027] The specific embodiments of the present invention are described below to facilitate those skilled in the art of the present technology to understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific embodiments. For those of ordinary skill in the art of the present technology, as long as various changes are within the spirit and scope of the present invention defined and determined by the appended claims, these changes are obvious, and all inventions and creations using the concept of the present invention are within the scope of protection.

[0028] Test Example 1

[0029] 1 GWAS preliminary mapping of anthracnose resistance genes

[0030] In this experiment, 104 mango germplasm samples were collected. After subsequent classification, identification, and collation, with reference to the published mango whole-genome annotation information, association analysis of sequencing data and phenotypic variation was performed on 104 mango germplasms, and manhattan plot and Q-Q plot [-log 10P ≥5.0] were drawn. 12 SNP loci associated with anthracnose resistance were detected and distributed on 7 chromosomes. Each SNP segment was approximately 20,000 bp, and a total of 196 genes were included in this region ( Figure 1 ). The molecular physicochemical properties of some candidate genes were screened and listed (Table 1).

[0031] Table 1 Molecular physicochemical properties of candidate genes

[0032]

[0033] 2 Expression analysis of candidate genes to screen for the anthracnose resistance gene MiZTP29l

[0034] The relative expression levels of candidate genes were detected by qRT-PCR, with the treatment at 0 d as the control group (MiActin as the internal reference gene), and the relative expression levels of each candidate gene in mango leaves under the treatment of pathogenic fungi (Cg) at different time periods were measured. The results are shown as follows ( Figure 2 ). mango000946, mango000952, and mango000945 all showed continuous up-regulation to varying degrees. Among them, the expression level of the mango000945 gene was up-regulated most significantly. Therefore, mango000945 was selected as the target gene and named MiZTP29l.

[0035] 3 Bioinformatics analysis of the anthracnose resistance gene MiZTP29l

[0036] The tertiary structure of the MiZTP29l protein was predicted by the SWISS-MODEL online software, and the structural model of Figure 3 A was obtained. The structure prediction showed that there were 8 putative transmembrane domains in the MiZTP29l protein; a transmembrane region prediction map was also obtained ( Figure 3 B in it); the conserved domain analysis of the protein sequence of the mango anthracnose resistance gene MiZTP29l was performed by NCBI Conserved Domain Search, and it was found that the 268-1065 positions of the MiZTP29l protein were the conserved domain of the Zip superfamily ( Figure 3 C in it).

[0037] The amino acid sequences of mango and 29 other plants were aligned and subjected to cluster analysis to construct a phylogenetic tree ( Figure 4), The results showed that the MiZTP29l protein had a high homology with ZTP29l of other plants. The MiZTP29l protein sequence was clustered into a small branch with Pistacia vera which belongs to the Anacardiaceae family. It was closely related to Melia azedarach (KAJ4724235.1), Citrus x clementina (KP 006446090.1), and Citrus sinensis (KP 006470582.1), indicating a high similarity in protein sequence and a close genetic relationship.

[0038] Experimental Example 2

[0039] 1 SNP locus labeled by TaqMan probe method

[0040] 1.1 Identification and comparison of specific loci

[0041] Through genome-wide association analysis, the SNP locus "A" (T / A) located on chromosome 1 was identified. This locus had three genotypes: AA, TA, and TT. The percentage of the TT genotype was high and the percentage of the AA genotype was low in the tested germplasm resources. By comparing the anthracnose lesion areas in different varieties, it was found that the lesion area of the TT genotype was smaller, while the lesion area of the AA genotype was larger ( Figure 5 ). The SNP locus "A" (T / A) was in the 3' UTR region of the gene "MiZTP29l", at a position 485 bp away from the stop codon. DNA was extracted from 32 mango germplasms, and the target sequence was amplified by PCR. Then, through Sanger sequencing and comparison of the sequencing results ( Figure 7 ), it was found that the SNP locus (T / A) of the 32 germplasms was consistent with the GWAS results. In addition, specific polymorphic loci "TGT" and "TGTTGT" were mined in the 3' UTR region and divided into two types; this SNP locus was at a position 716 bp away from the stop codon (TGA), as Figure 6 shown. The nucleotide sequences of TGTTGT-ZTP29l and TGT-ZTP29l are shown in SEQ ID NO.7 and SEQ ID NO.8.

[0042] 1.2 TaqMan probe real-time fluorescence quantitative PCR detection

[0043] (1) Primer and probe design: By comparing the sequences of 32 mango germplasms through Sanger sequencing results, the target differential fragment region was found. The Primer Express 3.0.1 primer design software was used to design primers and specific TaqMan probes. The 5' end of the probe was labeled with the FAM fluorescent reporter group, and the 3' end was labeled with the MGB quenching group. The amplified target fragments were 120 bp and 126 bp respectively. The primers and probes were synthesized by Thermo Fisher Scientific Co., Ltd. The primers were PAGE-grade purified, and the TaqMan probes were HPLC-grade purified. The primer and probe sequence information is shown in Table 1.

[0044] (2) One-step TaqMan fluorescence quantitative RT-PCR was performed using the Thermo QuantStudio 6.0 fluorescence quantitative PCR equipment (Thermo Fisher Scientific). TaqMan fluorescence quantitative RT-PCR was carried out using two sets of specific primers and probes designed for this experiment. Using the total DNA of 32 isolated from mango germplasms as templates, RNase Free ddH2O was used as a blank control, and 2 replicate wells were set for each reaction. The reaction program was: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 10 s; annealing / extension / data collection at 60°C for 30 s, for 60 cycles. The TaqMan fluorescence quantitative PCR reaction system is shown in Table 2.

[0045] Table 1 Primer and probe sequence information

[0046]

[0047] Table 2 TaqMan fluorescence quantitative PCR reaction system

[0048]

[0049] 1.3 Specificity detection results

[0050] Two groups of fluorescent probes, "TGT" and "TGTTGT", were used respectively. The first group used the DNA fragments of 4 mango germplasms (Longjing Daming, Zebda, Red Golden Queen, Seal Mango), tobacco, tomato, and Arabidopsis thaliana as templates. The second group used the DNA fragments of 4 mango germplasms (Tainong No. 1, Wild Mango - 1, Kent, Shanlin No. 1), tobacco, tomato, and Arabidopsis thaliana as templates. RNase freeddH2O was used as a blank negative control, and the optimized system was used to carry out specificity detection. The results are shown as follows ( Figure 8 , Figure 9 ). Only the amplified curves appeared in 4 mango germplasms, and no specific fluorescence curves were seen in the other four samples, and there was no increase in fluorescence values, indicating that the other four plant species and the blank control were negative reactions, indicating that the two primer and probe combinations designed had strong specificity for the mango species.

[0051] 1.4 Sensitivity detection results

[0052] The detection was carried out in two groups. The first group used the total DNA of Longjing Dmang leaves diluted in a 10-fold gradient as a template, and the second group used the total DNA of Tainong No. 1 leaves diluted in a 10-fold gradient as a template to detect the sensitivity of the TGT / TGTTGT primer and probe. The results are shown below ( Figure 10 , Figure 11 ). When the DNA concentrations of Longjing Dmang and Tainong No. 1 were 1000 ng / μL to 100 pg / μL, there were amplification curves. When the DNA concentration was 10 pg / μL, there was no fluorescence signal, indicating that the lowest detection concentration of the TGT / TGTTGT primer and probe was 100 pg / μL.

[0053] 1.5 Detection on different germplasm resources

[0054] Randomly select more than 30 germplasms from the collected mango germplasms and detect them by genotyping using this TaqMan qPCR method. The TaqMan probe genotyping results show that there are 3 genotypes in the mango germplasm population, namely "TGT", "TGTTGT", and "TGT×TGTTGT". The frequencies of the "TGT", "TGTTGT", and "TGT×TGTTGT" genotypes in this verification are 43.75%, 46.87%, and 9.38% respectively, which can be used to detect mango germplasms in the field and screen for resistant germplasms.

[0055] In summary, the present invention takes MiZTP29l as a candidate gene, then conducts sequence alignment on 32 collected mango germplasms, discovers specific polymorphic sites "TGT" and "TGTTGT" in the 3'UTR region and designs primers for the identification of anthracnose-resistant genes. The fluorescent group is FAM and the quenching group is MGB. It is labeled with a TaqMan probe and verified in different mango germplasms, which is conducive to the screening of resistant germplasms in the field and is of great significance for the breeding of mango anthracnose-resistant germplasms and the creation of resistant germplasm resources.

[0056] For those skilled in the art, it is obvious that the present invention is not limited to the details of the above exemplary embodiments, and can be implemented in other specific forms without departing from the spirit or basic characteristics of the present invention. Therefore, from any point of view, the embodiments should be regarded as exemplary and non-restrictive. The scope of the present invention is defined by the appended claims rather than the above description. Therefore, it is intended to include all changes falling within the meaning and scope of the equivalent elements of the claims in the present invention.

[0057] In addition, it should be understood that although this specification is described according to embodiments, not every embodiment only contains an independent technical solution. This narrative manner of the specification is only for clarity. Those skilled in the art should regard the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. Primers for detecting mango resistance to anthracnose, characterized in that, It includes 2 sets of TaqMan probe primers, and the primer and probe sequence information is as follows: TGT-ZTP29l-F: TCCTCTTAATGTGTTTCGATCAAG; TGT-Probe: CATGTATTAAGTAAGGTACTATG; TGT-ZTP29l-R: CTATTTTACCTCCCCATGTCCTT; 2*TGT-ZTP29l-F: GAAAGATCCTACTACATAATCCTCTTAATG; 2*TGT-Probe: CATGTTGTATTAAGTAAGGTAC; 2*TGT-ZTP29l-R: TGTCCTTGCCACAAATTGATG.

2. The primer for detecting anthracnose resistance of mango according to claim 1, characterized in that, Each set of probes includes 1 FAM fluorophore and 1 MGB quencher.

3. A kit containing the primer for detecting mango anthracnose resistance according to any one of claims 1 or 2.

Citation Information

Patent Citations

  • Microbial compositions for the prevention or reduction of growth of fungal pathogens on plants

    CN111867363A

  • Streptomycete new strain for resisting banana wilt and application of streptomycete new strain

    CN114164136A

  • Specific PCR (Polymerase Chain Reaction) detection primers for colletotrichum gloeosporioides and application of specific PCR detection primers

    CN116904642A