KASP molecular markers related to the weight traits of balsam pear fruit and their application

By developing the KASP molecular marker and its amplification primers at position 27048107 on chromosome 8 of the bitter gourd genome, the problem of high-throughput rapid identification and screening of bitter gourd fruit weight traits was solved, enabling efficient fruit weight identification and breeding support during the seedling stage.

CN120290775BActive Publication Date: 2025-11-25INST OF VEGETABLES GUANGDONG PROV ACAD OF AGRI SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510531233.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-25
Publication Date
2025-11-25
Estimated Expiration
2045-04-25

AI Technical Summary

Technical Problem

The lack of KASP molecular markers closely linked to the weight trait of bitter melon fruit in existing technologies makes it difficult to achieve high-throughput rapid identification and screening of bitter melon fruit weight.

Method used

A KASP molecular marker located at position 27048107 on chromosome 8 of the bitter melon genome and its amplification primers were developed. The weight trait of bitter melon fruit was detected by PCR amplification technology. High-throughput, rapid and accurate identification of fruit weight was achieved by designing specific fluorescent tag primers.

Benefits of technology

This technology enables high-throughput, rapid, and accurate identification and screening of bitter gourd fruit weight during the seedling stage, supporting molecular breeding of bitter gourd and improving the screening efficiency of fruit weight traits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290775B_ABST
    Figure CN120290775B_ABST
Patent Text Reader

Abstract

The application discloses a KASP molecular marker related to a balsam pear fruit weight character and application thereof, wherein the KASP molecular marker is located at position 27048107 of chromosome 8 of a balsam pear genome, and a base at the position is T or C. It is found that the KASP molecular marker is related to the balsam pear fruit weight character, and high-throughput, rapid and accurate identification of balsam pear fruit weight types can be realized at a seedling stage by using the KASP molecular marker and an amplification primer thereof, different fruit weight balsam pear germplasm resources are screened, effective technical support is provided for balsam pear molecular breeding, and the application has important application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of crop genetics and breeding technology. Specifically, this invention relates to a KASP molecular marker closely linked to a major QTL locus related to the weight of bitter gourd fruit and its application. Background Technology

[0002] Bitter melon is a vegetable crop with medicinal value, widely cultivated in China, India, Malaysia, Africa, and South America. It is rich in vitamins, minerals, saponins, and flavonoids, among other bioactive substances, and possesses antioxidant, blood sugar-lowering, and blood lipid-lowering functions. The fruit is the main edible part of the bitter melon, and its weight varies considerably. Lighter bitter melon fruits weigh only about 10g, while heavier ones can weigh over 600g, more than 60 times the weight of the lighter ones.

[0003] Fruit weight is a major factor in bitter gourd yield, an important breeding target trait, and also an important economic trait. Currently, researchers have detected 16 fruit weight QTLs using different parental materials, with varying genetic contribution rates; only 3 QTLs contribute more than 20%. No KASP molecular markers closely linked to major fruit weight QTLs have been reported.

[0004] Therefore, developing KASP molecular markers closely linked to the weight trait of bitter gourd fruit is of great guiding significance for molecular marker-assisted breeding of bitter gourd. It can help to achieve high-throughput rapid identification and screening of materials with target bitter gourd fruit weight in the seedling stage, and has important application value. Summary of the Invention

[0005] Based on this, the purpose of this invention is to provide a KASP molecular marker related to the weight trait of bitter gourd fruit and its application; using the KASP molecular marker of this invention, the weight of bitter gourd fruit to be tested can be accurately detected, and bitter gourd germplasm resources with different fruit weights can be screened.

[0006] The specific technical solutions for achieving the above-mentioned objectives are as follows.

[0007] In a first aspect, the present invention provides the application of a KASP molecular marker associated with the fruit weight trait of bitter melon in detecting the fruit weight trait of bitter melon or screening bitter melon germplasm resources with different fruit weights, wherein the KASP molecular marker is located at position 27048107 on chromosome 8 of the bitter melon genome, and the bases at this position are T or C.

[0008] In a second aspect, the present invention provides amplification primers for a KASP molecular marker associated with the weight trait of bitter melon fruit, comprising an upstream primer F1 with the sequence shown in SEQ ID NO:1, an upstream primer F2 with the sequence shown in SEQ ID NO:2, and a downstream primer R with the sequence shown in SEQ ID NO:3.

[0009] A third aspect of the present invention provides the application of amplification primers for KASP molecular markers related to the weight trait of bitter gourd fruit in detecting the weight trait of bitter gourd fruit or screening bitter gourd germplasm resources with different fruit weights.

[0010] In a fourth aspect, the present invention provides a kit for detecting the fruit weight trait of bitter gourd or screening bitter gourd germplasm resources with different fruit weights, comprising amplification primers for the KASP molecular markers related to the fruit weight trait of bitter gourd.

[0011] In a fifth aspect, the present invention provides a method for detecting the weight trait of bitter melon fruit, comprising the following steps: using the DNA of the bitter melon to be tested as a template, performing PCR amplification with the above-mentioned amplification primers, and then analyzing the genotyping data.

[0012] In a sixth aspect, the present invention provides a method for screening bitter gourd germplasm resources with different fruit weights, comprising the following steps: using the DNA of the bitter gourd to be tested as a template, performing PCR amplification with the above-mentioned amplification primers; when the genotype is CC, the bitter gourd to be tested is a heavy-fruited bitter gourd variety; when the genotype is TT or TC, the bitter gourd to be tested is a light-fruited bitter gourd variety.

[0013] In this invention, an F2 segregating population was created using bitter gourd resources with heavy fruit and those with light fruit. Twenty plants from each of the F2 populations exhibiting extreme phenotypes were used for pooled sequencing. The difference in SNP-index between the two progeny pools, Δ(SNP-index), was calculated to locate the bitter gourd fruit weight QTL within a 1.9 Mb (99% confidence level) interval on chromosome 8. KASP markers were designed at both ends and within this interval to expand the F2 population for genotyping. Combined with phenotypic data, the QTL was located within a 274.3 kb interval. Whole-genome resequencing was performed based on the F2 parents to identify SNP variant sites within this located interval. A SNP variant T / C was found at position 27048107 on chromosome 8 of bitter gourd, with base T tightly linked to the light fruit trait and base C tightly linked to the heavy fruit trait. Therefore, this SNP site is a KASP molecular marker associated with the weight trait of bitter gourd fruit. Using this KASP molecular marker and its amplification primers, high-throughput, rapid and accurate identification of bitter gourd fruit weight type can be achieved at the seedling stage, and bitter gourd germplasm resources with different fruit weights can be screened, providing effective technical support for molecular breeding of bitter gourd and having important application value. Attached Figure Description

[0014] Figure 1 This is a frequency distribution diagram of the weight of F2 fruit in Embodiment 1 of the present invention.

[0015] Figure 2 This is a distribution diagram of the two offspring Δ (SNP-index) on the chromosome in Embodiment 1 of the present invention.

[0016] Figure 3 This is the result of a linkage analysis of the weight of bitter melon fruit in Example 1 of the present invention.

[0017] Figure 4 The results are the genotyping results of 168 F2 individual plants and 203 natural populations in Example 2 of this invention. Detailed Implementation

[0018] To facilitate understanding of the present invention, a more complete description will be provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0019] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "and / or" as used in this invention includes any and all combinations of one or more of the associated listed items.

[0020] Unless otherwise specified, all examples were performed under standard experimental conditions, such as those described in Sambrook et al., Molecular Cloning: a Laboratory Manual (Sambrook J & Russell DW, 2013), or as recommended by the manufacturer.

[0021] In some embodiments of the present invention, the application of a KASP molecular marker associated with the fruit weight trait of bitter gourd is disclosed in detecting the fruit weight trait of bitter gourd or screening bitter gourd germplasm resources with different fruit weights. The KASP molecular marker is located at position 27048107 on chromosome 8 of the bitter gourd genome, where the base is T or C.

[0022] In other embodiments of the present invention, an amplification primer for a KASP molecular marker related to the weight trait of bitter melon fruit is disclosed, including upstream primer F1 with the sequence shown in SEQ ID NO:1, upstream primer F2 with the sequence shown in SEQ ID NO:2, and downstream primer R with the sequence shown in SEQ ID NO:3.

[0023] In some embodiments, the 5' end of the upstream primer F1 is modified with a HEX group, and the 5' end of the upstream primer F2 is modified with a FAM group.

[0024] In other embodiments of the present invention, the application of amplification primers for KASP molecular markers related to the fruit weight trait of bitter gourd is disclosed in detecting the fruit weight trait of bitter gourd or screening bitter gourd germplasm resources with different fruit weights.

[0025] In other embodiments of the present invention, the application of amplification primers for KASP molecular markers related to the fruit weight trait of bitter gourd in assisted breeding of bitter gourd varieties with different fruit weights is disclosed.

[0026] In other embodiments of the present invention, the application of amplification primers for KASP molecular markers related to the fruit weight trait of bitter melon is disclosed in the preparation of kits for detecting the fruit weight trait of bitter melon or screening bitter melon germplasm resources with different fruit weights.

[0027] In other embodiments of the present invention, a kit for detecting the fruit weight trait of bitter gourd or screening bitter gourd germplasm resources with different fruit weights is disclosed, including amplification primers for the KASP molecular markers related to the fruit weight trait of bitter gourd.

[0028] In other embodiments of the present invention, a method for detecting the weight trait of bitter melon fruit is disclosed, comprising the following steps: using the DNA of the bitter melon to be tested as a template, performing PCR amplification with the above-mentioned amplification primers, and then analyzing the genotyping data.

[0029] In some embodiments, the analysis of genotyping data includes the following steps: when the genotype is CC, the bitter gourd to be tested is a heavy-fruited bitter gourd variety; when the genotype is TT or TC, the bitter gourd to be tested is a light-fruited bitter gourd variety.

[0030] In some other embodiments of the present invention, a method for screening bitter gourd germplasm resources with different fruit weights is disclosed, comprising the following steps: using the DNA of the bitter gourd to be tested as a template, performing PCR amplification with the above-mentioned amplification primers; when the genotype is CC, the bitter gourd to be tested is a heavy-fruited bitter gourd variety; when the genotype is TT or TC, the bitter gourd to be tested is a light-fruited bitter gourd variety.

[0031] In some embodiments, the PCR amplification reaction system includes: 2xKASP master mix 2.5±0.1μL, 8μM~10μM upstream primer F1 0.075±0.01μL, 8μM~12μM upstream primer F2 0.075±0.01μL, 10μM downstream primer R 0.2±0.05μL, DNA template 10ng~100ng, and ddH2O added to 5μL.

[0032] In some embodiments, the PCR amplification reaction program is as follows: 94°C, 15 min; 94°C, 20 s, 65–57°C, 1 min, 10 cycles; 94°C, 20 s, 57°C, 1 min, 30 cycles.

[0033] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0034] Example 1: Development of KASP molecular markers tightly linked to QTLs of bitter melon fruit weight traits

[0035] Includes the following steps:

[0036] 1. Using K13-1-1 (heavy fruit, average single fruit weight 579.9g, high-generation inbred line, preserved in the applicant's laboratory) and 22MB4 (light fruit, average single fruit weight 132.7g, high-generation inbred line purified from resources introduced from Vietnam, preserved in the applicant's laboratory) as parents to construct F2, the frequency distribution of fruit weight is as follows: Figure 1 As shown, from Figure 1 It can be seen that the fruit weight exhibits a skewed distribution, indicating that lighter fruit weight is dominant.

[0037] 2. Using 20 strains from each of the extreme phenotypes in the F2 population, perform pooled sequencing and calculate the difference in SNP-index between the two progeny pools, Δ(SNP-index). The distribution of Δ(SNP-index) on the chromosomes of the two progeny pools is shown below. Figure 2 As shown. A window size of 1Mb and a step size of 1kb were selected. The average value of Δ(SNP-index) in each window was calculated to reflect the distribution of Δ(SNP-index). The QTL of bitter gourd fruit weight was located in the interval of approximately 1.9Mb (99% confidence level) on chromosome 8.

[0038] 3. KASP markers were designed at both ends and within this interval to expand the F2 population for genotyping. Combined with phenotypic data, the region was located within an approximately 274.3 kb interval. Linkage analysis results are as follows: Figure 3 As shown, its contribution rate is 44.3%.

[0039] 4. Perform whole-genome resequencing (Bitter gourd(OHB3-1)v2 Genome) based on the F2 parents to locate SNP variant sites within the localization interval. A SNP variant T / C was found at position 27048107.

[0040] 5. Based on the 300bp sequences upstream and downstream of the SNP site mentioned above, KASP-labeled amplification primers were designed using Primer Premiere 5.0 software. These primers include forward primers F1 and F2, and a reverse primer R. The two forward primers have allelic variants T / C at their ends. The 5' ends of the forward primers are connected to fluorescent tag sequences A and B. Specifically, the 5' end of F1 is fluorescent tag sequence A (5'-GAAGGTGACCAAGTTCATGCT-3') with a HEX group attached, and the 5' end of F2 is fluorescent tag sequence B (5'-GAAGGTCGGAGTCAACGGATT-3') with a FAM group attached. The specific primer sequences are as follows:

[0041] F1 (SEQ ID NO:1):

[0042] GAAGGTGACCAAGTTCATGCTCACCCGACGGTTACAAAAATAG C

[0043] F2 (SEQ ID NO:2):

[0044] GAAGGTCGGAGTCAACGGATTCACCCGACGGTTACAAAAATAG T

[0045] R(SEQ ID NO:3):TCGATAATTACACGCTAGCGAGAA

[0046] Example 2: Validation of the KASP molecular marker from Example 1

[0047] Young leaves from the F2 population were collected, and genomic DNA of bitter gourd was obtained by CTAB extraction. PCR amplification was performed using the primer set from Example 1. The PCR reaction volume was 5 μL, containing 2.5 μL of 2×KASP master mix, 0.075 μL of forward primer F1 (10 μM), and 0.075 μL of forward primer F2 (10 μM). ,Reverse primer R (10 μM) 0.2 μL, DNA (10 ng–100 ng) 1 μL, ddH₂O 3.3 μL. The PCR reaction program was: 94℃, 15 min; 94℃, 20 s, 65℃–57℃ (Touch down), 1 min, 10 cycles; 94℃, 20 s, 57℃, 1 min, 30 cycles. Fluorescence signals were read using a TECAN Infinite M1000 microplate reader, and analyzed and converted using the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) to obtain clear and intuitive genotyping diagrams. Samples aggregated on the X-axis were homozygous A genotype (fluorescent tag sequence A, orange), corresponding to the CC base sequence; samples aggregated on the Y-axis were homozygous B genotype (fluorescent tag sequence B, blue), corresponding to the TT base sequence; samples aggregated in the middle were heterozygous H genotype (green), corresponding to the CT base sequence.

[0048] The test results of 168 F2 individual plants are shown below. Figure 4 The figure shows that there are three genotypes, A, B, and H, in the F2 population, with a ratio of A:B:H of 42:46:80 plants. Phenotypic and genotypic analysis of the tested materials revealed that among the 168 individual plants in the F2 population, the average fruit weight was 273.5g for genotype A, 108.0g for genotype B, and 165.9g for genotype H (p-value 4.0E-20 < 0.01), indicating highly significant differences.

[0049] Therefore, the SNP mutation site discovered in this invention has a base T that is closely linked to the light fruit trait, and a base C that is closely linked to the heavy fruit trait. This KASP molecular marker can be used to detect the weight trait of bitter melon fruit, and primer pairs designed for this site can be used to effectively detect the weight of target bitter melon fruit.

[0050] Further analysis of 203 natural population materials using this molecular marker yielded the following results: Figure 4 As shown in the figure, the ratio of A:B:H is 168 plants: 25 plants: 10 plants. Phenotypic and genotypic analysis of the tested materials revealed that the average fruit weight for genotype A was 396.1g, for genotype B it was 278.3g, and for genotype H it was 210.1g, with a p-value of 4.4E-11 < 0.01, indicating highly significant differences.

[0051] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0052] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. A KASP amplification primer related to the weight trait of bitter melon fruit, characterized in that, It includes upstream primer F1 with the sequence shown in SEQ ID NO:1, upstream primer F2 with the sequence shown in SEQ ID NO:2, and downstream primer R with the sequence shown in SEQ ID NO:

3.

2. The KASP amplification primers related to the weight trait of bitter melon fruit according to claim 1, characterized in that, The 5' end of the upstream primer F1 is modified with a HEX group, and the 5' end of the upstream primer F2 is modified with a FAM group.

3. The application of the KASP amplification primers related to the weight trait of bitter gourd fruit as described in claim 1 or 2 in detecting the weight trait of bitter gourd fruit or screening bitter gourd germplasm resources with different fruit weights.

4. The application of the KASP amplification primers related to the weight trait of bitter gourd fruit as described in claim 1 or 2 in the preparation of a kit for detecting the weight trait of bitter gourd fruit or screening bitter gourd germplasm resources with different fruit weights.

5. A kit for detecting the weight of bitter melon fruits or screening bitter melon germplasm resources with different fruit weights, characterized in that, Includes the KASP amplification primers related to the weight trait of bitter melon fruit as described in claim 1 or 2.

6. A method for detecting the weight trait of bitter melon fruit, characterized in that, Includes the following steps: Using the DNA of the bitter melon to be tested as a template, PCR amplification was performed using the amplification primers described in claim 1 or 2, and the genotyping data was analyzed. When the genotype is CC, the bitter melon to be tested is a heavy-fruited bitter melon variety; when the genotype is TT or TC, the bitter melon to be tested is a light-fruited bitter melon variety.

7. A method for screening bitter gourd germplasm resources with different fruit weights, characterized in that, Includes the following steps: Using the DNA of the bitter melon to be tested as a template, PCR amplification was performed using the amplification primers described in claim 1 or 2. When the genotype is CC, the bitter melon to be tested is a heavy-fruited bitter melon variety; when the genotype is TT or TC, the bitter melon to be tested is a light-fruited bitter melon variety.

8. The method according to claim 6 or 7, characterized in that, The PCR amplification reaction system includes: 2xKASPmastermix 2.5±0.1μL, 8μM~10μM upstream primer F1 0.075±0.01μL, 8μM~12μM upstream primer F2 0.075±0.01μL, 10μM downstream primer R 0.2±0.05μL, DNA template 10ng~100ng, and ddH2O added to 5μL; The PCR amplification reaction program was as follows: 94℃, 15 min; 94℃, 20 s, 65–57℃, 1 min, 10 cycles; 94℃, 20 s, 57℃, 1 min, 30 cycles.

Citation Information

Patent Citations

  • Cultivation method of new variety of local characteristic Feiyue series bitter gourds

    CN111713349A

  • KASP marker for detecting fruit tumor character of bitter gourd and application of KASP marker

    CN112852994A