MT molecular marker related to solanine content regulation gene of potato tubers and application of MT molecular marker

Abstract

The invention relates to the technical field of biology, in particular to an MT molecular marker related to a sweet potato solanine content regulation gene and application, ploidy of a sweet potato meat solanine inhibition factor StERF9 is judged through an amplification result of a marker detection primer group, the solanine content in mature sweet potato meat is predicted through the type and expression level of a promoter, and the content of solanine in the sweet potato meat is determined. The method greatly shortens the time for measuring solanine in potato meat only after the potato growth cycle is completed, and is a novel breeding mode which is time-saving and high in precision.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to an MT molecular marker related to a gene for regulating the content of solanine in potato tubers and its application. Background Art

[0002] Potato (S Solanum tuberosum ) is the fourth major food crop in China and plays an important role in national food security. However, during storage, potatoes often germinate and rot due to unsuitable environments, resulting in the production of toxic substances mainly composed of solanine, which produces an unpleasant bitter taste. Excessive intake can also cause poisoning in humans and animals, which is a food safety issue that requires great attention at present.

[0003] Solanine, also known as solasonine, is the general term for plant steroidal glycoside alkaloids (SGAs), which consists of a hydrophobic aglycone (glycoside ligand) and a hydrophilic oligosaccharide chain. The aglycone part is composed of a cyclopentane polyhydrophenanthrene (non-polar steroidal unit) and a nitrogen-containing heterocyclic ring (nitrogen nucleus) connected. Currently, more than 100 kinds of solanines are known, and they are mostly present in plants of the Solanaceae and Liliaceae families. In addition to α-solanine and α-chaconine, the main components of solanine in potatoes also include a small amount of solavetivone, commersonine, solanidine, and leptinidine. Since in potato tubers, α-solanine and α-chaconine account for more than 95% of the total solanine content, the total solanine content of potatoes is usually represented by the sum of the contents of α-solanine and α-chaconine.

[0004] Although solanine in potatoes largely causes relatively serious food safety problems, in terms of the function and activity of solanine, solanine provides a feasible route for plant disease control and drug development. Potatoes produce solanine during natural growth, and solanine, as an alkaloid, has the functions of disease resistance, insect resistance, and antifungal properties. Studies have found that when the solanine concentration is greater than or equal to 140 mg / kg, it tastes bitter, numb, and has a burning sensation; when the solanine concentration reaches 200 mg / kg, it tastes extremely bitter and is difficult to swallow; the poor taste can prevent other animals from nibbling on potato seedlings. The United States Department of Agriculture has set the upper limit of the safe edible solanine concentration for potato tubers at 200 mg / kg FW, and the U.S. Food and Drug Administration has also set this concentration as the upper limit of the SGAs content in safe-to-eat potato tubers. Taking the solanine content as an important indicator to evaluate the quality of solanine is an important factor considered by breeders in breeding excellent potato plants. Currently, for the selection based on this indicator, it is necessary to wait for the plants to flower and bear fruit and then measure the solanine content of the fruits to screen excellent plants, which takes a long time and has a high breeding cost.

[0005] In view of this, the present invention is specifically proposed to develop practical molecular markers for application in molecular breeding of potato quality traits. Summary of the Invention

[0006] To overcome the deficiencies of the above technical defects, the present invention provides an MT molecular marker related to the gene regulating the content of solanine in potato tubers and its application, which can be used to predict the level of solanine in the tuber flesh after maturity, greatly shortening the breeding time.

[0007] To achieve the above object, the present invention is achieved through the following solutions: In the first aspect, the present invention provides an MT molecular marker related to the gene regulating the content of solanine in potato tubers, and the MT molecular marker is one or more of HapI-1, HapI-2, HapII-1, HapII-2, HapIII-1, HapIII-2, HapIV-1, HapIV-2; The nucleotide sequence of HapI-1 is shown in SEQ ID NO: 1; AGCCAATTAACCGACCTGCATAGCTCGCATTCCTCGACTAATTTAGCCTCAGATAACGTGCAAGAATTACTGAATTCTCCATCAATGGATCACGATGACCCGTTTTTCGATCTACCGGATCTTACCGTC The nucleotide sequence of HapI-2 is shown in SEQ ID NO: 2; GCCGGGTACAAAAAAAATTCAAGATGGGAATGAGGAGGAGGATGATAAGACGAAAATCAAACGAAAAAATGAAGGTGTTGTTGATGAAAAACATCCAACTTATAGAGGAGTTCGTAAGAGG The nucleotide sequence of HapII-1 is shown in SEQ ID NO: 3; AGCCAATTAACCGAGCTGCACACCTCGCATTCCTCGACTAATTTAGCTTCAGATAACGTGCAAGAATTACTCAATTCTCCATCAATGGATCACGATGACCCGTTTTTCGATCTACCGGATCTTACCATC The nucleotide sequence of the said HapII-2 is shown as SEQ ID NO: 4; GCCGGGTTCAAAAAAAAATCAAGATGGGAATGAGGAGGAGGAGGATGATAACACGAAAATCAGACGAAAAAATGAAGTTGTTGTTGATGAAAAACATCCGACTTATAGAGGAGTTCGTAAGAGG The nucleotide sequence of the said HapIII-1 is shown as SEQ ID NO: 5; AGCCAATTAACCGAGCTGCATAGCTCGCATTCCTCGACTAATTTAGCCTCGCAAGAATTACTGAATTCTCCATCAATGGATCACGATGACCCGTTTTTCGATCTACCGGATCTTACCATC The nucleotide sequence of the said HapIII-2 is shown as SEQ ID NO: 6; GCCGGGTTCAAAAAAAATTCAAGATGGGAATAACACGAAAATCAGACGAAAAAATGAAGGTGTTGTTGATGAAAAGCATCCGACTTATAGAGGAGTTCGTAAGAGG The nucleotide sequence of the said HapIV-1 is shown as SEQ ID NO: 7; AGCCAATTAACCGAGCTGCATAGCTCGCATTCCTCGACTAATTTAGCCTCGCAAGAATTACTGAATTCTCCATCAATGGATCACGATGACCCCTTTTTCGATCTACCGGATCTTACCATC The nucleotide sequence of the said HapIV-2 is shown as SEQ ID NO: 8. GCCGGGTTCAAAAAAAATTCAAGATGGGAATGAGGAGGAGGATGATAACAAGAAAATCAGACGAAAAAATGAAGGTGTTGTTGATGAAAAACATCCGACTTATAGAGGAGTTCGTAAGAGG In a second aspect, the present invention provides a primer set for amplifying MT molecular markers, comprising primer pair P1 and primer pair P2; The said primer pair P1: comprises a forward primer and a reverse primer whose nucleotide sequences are shown as SEQ ID NO: 9 and SEQ ID NO: 10 respectively; The said primer pair P2: comprises a forward primer and a reverse primer whose nucleotide sequences are shown as SEQ ID NO: 11 and SEQ ID NO: 12 respectively.

[0008] In a third aspect, the present invention provides the application of MT molecular markers and marker detection primers in any one of the following 1)-6): 1) Identifying or assisting in identifying the solanine content in potato tubers; 2) Preparing a product for identifying or assisting in identifying high solanine content in potatoes; 3) Screening or assisting in screening potatoes with high solanine content; 4) Preparing a product for screening or assisting in screening potatoes with high solanine content; 5) Potato breeding; 6) Preparing a product for potato breeding.

[0009] In some embodiments of this embodiment, the MT molecular marker is one or more of HapI-1, HapI-2, HapII-1, HapII-2, HapIII-1, HapIII-2, HapIV-1, HapIV-2; The nucleotide sequence of HapI-1 is shown in SEQ ID NO: 1; The nucleotide sequence of HapI-2 is shown in SEQ ID NO: 2; The nucleotide sequence of HapII-1 is shown in SEQ ID NO: 3; The nucleotide sequence of HapII-2 is shown in SEQ ID NO: 4; The nucleotide sequence of HapIII-1 is shown in SEQ ID NO: 5; The nucleotide sequence of HapIII-2 is shown in SEQ ID NO: 6; The nucleotide sequence of HapIV-1 is shown in SEQ ID NO: 7; The nucleotide sequence of HapIV-2 is shown in SEQ ID NO: 8.

[0010] In some embodiments of this embodiment, the MT molecular marker includes primer pair P1 and primer pair P2; The primer pair P1: includes a forward primer and a reverse primer whose nucleotide sequences are shown in SEQ ID NO: 9 and SEQ ID NO: 10 respectively; The primer pair P2: includes a forward primer and a reverse primer whose nucleotide sequences are shown in SEQ ID NO: 11 and SEQ ID NO: 12 respectively.

[0011] Furthermore, the application includes nucleic acid hybridization detection, molecular markers, preparation of molecular probes, and preparation of detection kits.

[0012] Further, according to the type of MT molecular markers in the sample to be tested, the content of solanine is predicted; Specifically, the content of solanine in the sample to be tested containing HapII-1 and HapII-2 is high; Specifically, the content of solanine in the sample to be tested containing HapIII-1 and HapIII-2 is high; Specifically, the content of solanine in the sample to be tested containing HapII-1, HapII-2, HapIII-1 and HapIII-2 is high; Specifically, the content of solanine in the sample to be tested containing HapIV-1 and HapIV-2 is low; Specifically, the content of solanine in the sample to be tested containing HapI-1 and HapI-2 is unstable.

[0013] In a fourth aspect, the present invention provides a method for identifying or assisting in identifying the content of solanine in potatoes, including: extracting the DNA of the sample to be tested, performing quantitative PCR amplification using marker detection primers, and identifying the content of solanine in potatoes according to the band size of the PCR product.

[0014] Further, the marker detection primers include primer pair P1 and primer pair P2; The primer pair P1: includes a forward primer and a reverse primer whose nucleotide sequences are respectively as shown in SEQ ID NO: 9 and SEQ ID NO: 10; The primer pair P2: includes a forward primer and a reverse primer whose nucleotide sequences are respectively as shown in SEQ ID NO: 11 and SEQ ID NO: 12.

[0015] In some specific embodiments, the present invention provides that the nucleotide sequences of the marker detection primers have 80% identity with the sequences shown in SEQ ID NO.9 - SEQ ID NO. 12; preferably 85% identity, more preferably 90% identity, more preferably 95% identity, and most preferably 99% identity.

[0016] Exemplarily, as used herein, "stringent conditions" refer to conditions under which a probe will hybridize to its target sequence to a detectable degree that exceeds hybridization to other sequences (such as at least 2-fold over background). Stringent conditions are sequence-dependent and vary with the environment. By controlling the stringency of hybridization and / or washing conditions, a target sequence that is 100% complementary to the probe can be identified. Optionally, the stringent conditions can be adjusted to allow some sequence mismatches such that a lower degree of similarity can be detected.

[0017] In some embodiments of this embodiment, amplification is performed using primer pair P1 composed of a forward primer and a reverse primer with nucleotide sequences as shown in SEQ ID NO: 9 and SEQ ID NO: 10 respectively, and a base deletion at 600 bp can be amplified, that is, DNA fragments with nucleotide sequences as shown in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 7.

[0018] In some embodiments of this embodiment, amplification is performed using primer pair P2 composed of a forward primer and a reverse primer with nucleotide sequences as shown in SEQ ID NO: 11 and SEQ ID NO: 12 respectively, and a base insertion between 204 - 231 bp can be amplified, that is, DNA fragments with nucleotide sequences as shown in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, and SEQ ID NO: 8.

[0019] Further, the identification method is specifically: the potato with high solanine content has a PCR product containing nucleotide sequences as shown in SEQ ID NO: 3 and SEQ ID NO: 4; Or, the potato with high solanine content has a PCR product containing nucleotide sequences as shown in SEQ ID NO: 5 and SEQ ID NO: 6; Or, the potato with high solanine content has a PCR product containing nucleotide sequences as shown in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6.

[0020] Further, the identification method is specifically: the potato with low solanine content has a PCR product containing nucleotide sequences as shown in SEQ ID NO: 7 and SEQ ID NO: 8; Further, the identification method is specifically: the potato with unstable solanine content has a PCR product containing nucleotide sequences as shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0021] In any of the above - mentioned methods, applications, or products, the purpose of breeding is to cultivate potato varieties with low solanine content.

[0022] Compared with the prior art, the beneficial effects of the present invention are: (1) The present invention has obtained molecular markers that are extremely significantly correlated with the solanine content of potatoes. By using the molecular markers to detect potato breeding materials, it is possible to accurately and efficiently predict the high or low solanine content without waiting for the potato plants to flower and bear fruit after planting, greatly improving the selection efficiency of potato breeding. (2) The primer pair of the present invention for detecting the promoter haplotype molecular marker related to the accumulation of solanine in potato fruits has strong specificity and can accurately amplify the sequence containing the MT molecular marker locus of the present invention. By using the primer pair to prepare a kit, it can assist in selective breeding and efficiently predict the high or low solanine content in the potato pulp after maturity. (3) The promoter haplotype molecular marker related to the accumulation of solanine in potato fruits of the present invention and its application can efficiently assist in the breeding selection of potatoes, which is a time-saving and highly accurate new breeding method and has extremely high economic value. Description of the Drawings

[0023] Figure 1 is the agarose gel electrophoresis detection diagram of primer pair P1; Figure 2 is the agarose gel electrophoresis detection diagram of primer pair P2; Figure 3 is StERF9 the influence of the gene on the solanine content; Among them, 3a is the distribution diagram of the high and low solanine content of different haplotype potatoes; 3b is the comparison diagram of the solanine content of different haplotype potatoes; 3c is the StERF9 gene expression level schematic diagram of some samples. Detailed Embodiments

[0024] To enable those skilled in the art to better understand the technical solutions of the present invention, the present invention will be described in detail below in conjunction with specific embodiments. The experimental methods without specific conditions noted in the following examples are usually carried out according to conventional conditions or according to the conditions recommended by the manufacturer. The test materials used in the following examples are all obtained from regular biochemical reagent stores without special instructions. Unless otherwise stated, percentages and parts are calculated by weight. Unless otherwise defined, all professional and scientific terms used herein have the same meaning as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to the described content can be applied to the present invention. The preferred implementation methods and materials described herein are for illustrative purposes only.

[0025] Based on the present invention, in order to shorten the breeding time of potatoes and avoid sampling and detection after maturity, the high or low solanine content is distinguished by directly measuring the time of the solanine content in the potato pulp. The inventor found StERF9The full length is 783 bp, without introns, encoding 261 amino acid residues. Among them, the AP2 conserved domain is encoded at positions 93 - 151, belonging to the typical APETALA2 / ERF class of transcription factors. The content of solanine in overexpressed potato flesh is reduced by this gene; after knockout, the content of solanine in potato flesh increases, proving that this gene is a solanine inhibitor in potato flesh. Based on the phylogenetic tree of different subspecies of potato, the inventors StERF9 carried out sequence analysis and found that this gene is a domestication gene. The StERF9 haplotype in cultivated varieties was significantly selected, with a 9 - base deletion at 600 bp, and the deletion position was named P1. There was an insertion between 204 - 231 bp, and the insertion position was named P2. According to the evolutionary sequence, it is mainly divided into 4 haplotypes, named HapI, HapII, HapIII, and HapIV. Among them, for HapI, there is no deletion at P1 and there is an insertion at P2; for HapII, there is no deletion at P1 and there is an insertion at P2 (3 bp more than HapI); for HapIII, there is a deletion at P1 and no insertion at P2; for HapIV, there is a deletion at P1 and an insertion at P2. In order to more intuitively distinguish different haplotypes, we designed primers to detect their differences in a shorter region. The haplotype of each classification can be identified by the position of the polyacrylamide gel band of the PCR amplification product, which can efficiently assist in the screening of potato breeding materials.

[0026] The technical solutions of the present invention will be further described in detail below in conjunction with specific embodiments and the accompanying drawings. It should be understood that the following embodiments are only used to explain the present invention and are not used to limit the present invention.

[0027] Example 1 Experimental materials: The potato materials of the present invention are all from the experimental group of the Potato Research Institute of the College of Life Sciences, Yunnan Normal University.

[0028] Download relevant sequences from the potato genome sequence website (http: / / solanaceae.plantbiology.msu.edu / Pgscdown - load.shtml), select the sequences of specific regions, use the online primer design website (http: / / www.idtdna.com / Primerquest / Home / Index) for primer design, and select StERF9 PCR amplification primers were designed at 600 bp and 204 - 231 bp of the gene. According to the electrophoresis results, first - generation sequencing was sent for screening to determine the marker detection primers that can be used to distinguish different haplotypes. The primer information is shown in Table 1: Table 1

[0029] Example 2 (1) Potato leaves of the test materials were collected, and genomic DNA was extracted using the improved CTAB method. PCR was performed on P1 using the designed marker detection primers. The amplification system and amplification procedure are shown in Tables 2 and 3: Table 2 Amplification system

[0030] Table 3 Amplification procedures

[0031] The amplified product was detected by electrophoresis with 8% agarose gel. The details of PAGE gel electrophoresis are as follows: Preparation of gel: Mix 10 mL 40% Bis, 5 mL 10×TBE and 35 mL pure water, add 30 μL TEMED and 500 μL 10% APS, mix well, pour into a glass plate, insert a comb and wait for solidification; Electrophoresis: Load 1 uL of PCR product and run at 200 V, 400 mA, 150 W for 1.5 h; Silver staining: Wash the PAGE gel with pure water, weigh 1 g of AgNO3 and dissolve it in 1 L of pure water, and place the gel in the water for staining at 200 rpm for 20 min; Color development: Wash the gel with pure water, weigh 15g of NaOH and dissolve it in 1L of pure water, then add 3-4mL of formaldehyde with a rubber dropper and mix well. Place the washed PAGE gel in the water and color it at 200 rpm for 20 min to obtain Figure 1 . from Figure 1 As can be seen in the figure, primer pair P1 can amplify StERF9 The nucleotide fragment at 600 bp in the gene coding region. The amplified length of HapI-1 and HapII-1 is 129 bp, and the amplified length of HapIII-1 and HapIV-1 is 120 bp. StERF9 The gene sequence bands have good specificity and no mixed bands. The nucleotide sequence of the amplified product HapI-1 is shown in SEQ ID NO: 1, and the length is 129 bp; the nucleotide sequence of the amplified product HapII-1 is shown in SEQ ID NO: 3, and the length is 129 bp; the nucleotide sequence of the amplified product HapIII-1 is shown in SEQ ID NO: 5, and the length is 120 bp; the nucleotide sequence of the amplified product HapIV-1 is shown in SEQ ID NO: 7, and the length is 120 bp; SEQ ID NO: 1 AGCCAATTAACCGACCTGCATAGCTCGCATTCCTCGACTAATTTAGCCTCAGATAACGTGCAAGAATTACTGAATTCTCCATCAATGGATCACGATGACCCGTTTTTCGATCTACCGGATCTTACCGTC SEQ ID NO: 3 AGCCAATTAACCGAGCTGCACACCTCGCATTCCTCGACTAATTTAGCTTCAGATAACGTGCAAGAATTACTCAATTCTCCATCAATGGATCACGATGACCCGTTTTTCGATCTACCGGATCTTACCATC SEQ ID NO: 5 AGCCAATTAACCGAGCTGCATAGCTCGCATTCCTCGACTAATTTAGCCTCGCAAGAATTACTGAATTCTCCATCAATGGATCACGATGACCCGTTTTTCGATCTACCGGATCTTACCATC SEQ ID NO: 7 AGCCAATTAACCGAGCTGCATAGCTCGCATTCCTCGACTAATTTAGCCTCGCAAGAATTACTGAATTCTCCATCAATGGATCACGATGACCCCTTTTTCGATCTACCGGATCTTACCATC (2) Collect the potato leaves of the test materials, extract genomic DNA using the improved CTAB method, and perform PCR with the designed marker detection primer P2. The amplification system and amplification program are shown in Tables 4 and 5: Table 4 Amplification System

[0032] Table 5 Amplification Program

[0033] The amplified products were detected by electrophoresis on 8% agarose. The PAGE gel electrophoresis is as follows: Prepare the gel: Mix 10 mL of 40% Bis, 5 mL of 10×TBE, and 35 mL of pure water, add 30 μL of TEMED and 500 μL of 10% APS, mix well and pour into the glass plate, insert the comb and wait for it to solidify; Electrophoresis: Load 1 μL of the PCR product and perform electrophoresis at 200 V, 400 mA, and 150 W for 1.5 h; Silver staining: Wash the PAGE gel with pure water. Weigh 1 g of AgNO3 and dissolve it in 1 L of pure water. Place the gel in it and stain at 200 rpm for 20 min; Color development: Wash the gel with pure water. Weigh 15 g of NaOH and dissolve it in 1 L of pure water. Then add 3 - 4 mL of formaldehyde with a dropper and mix well. Place the washed PAGE gel in it and develop at 200 rpm for 20 min to obtain Figure 2 。

[0034] From Figure 2 it can be seen that the primer pair P2 can amplify a nucleotide fragment at the 600 bp position of the gene coding region. The amplification length of HapI - 2 is 121 bp, the amplification length of HapII - 2 is 124 bp, the amplification length of HapIII - 2 is 106 bp, and the amplification length of HapIV - 2 is 121 bp. The amplified StERF9 gene sequence bands have good specificity and few non - specific bands. StERF9 The nucleotide sequence of the amplification product HapI - 2 is shown in SEQ ID NO: 2, with a length of 121 bp; the nucleotide sequence of the amplification product HapII - 2 is shown in SEQ ID NO: 4, with a length of 124 bp; the nucleotide sequence of the amplification product HapIII - 2 is shown in SEQ ID NO: 6, with a length of 106 bp; the nucleotide sequence of the amplification product HapIV - 2 is shown in SEQ ID NO: 8, with a length of 121 bp; SEQ ID NO: 2 GCCGGGTACAAAAAAAATTCAAGATGGGAATG---AGGAGGAGGATGATAAGACGAAAATCAAACGAAAAAATGAAGGTGTTGTTGATGAAAAACATCCAACTTATAGAGGAGTTCGTAAGAGG SEQ ID NO: 4 GCCGGGTTCAAAAAAAAATCAAGATGGGAATGAGGAGGAGGAGGATGATAACACGAAAATCAGACGAAAAAATGAAGTTGTTGTTGATGAAAAACATCCGACTTATAGAGGAGTTCGTAAGAGG SEQ ID NO: 6 SEQ ID NO: 6 GCCGGGTTCAAAAAAAATTCAAGATGGGAAT------------------AACACGAAAATCAGACGAAAAAATGAAGGTGTTGTTGATGAAAAGCATCCGACTTATAGAGGAGTTCGTAAGAGG SEQ ID NO: 8 GCCGGGTTCAAAAAAAATTCAAGATGGGAATG---AGGAGGAGGATGATAACAAGAAAATCAGACGAAAAAATGAAGGTGTTGTTGATGAAAAACATCCGACTTATAGAGGAGTTCGTAAGAGG Example 3 Investigation StERF9 Effect of Gene Haplotype on Solanine Content Potato leaves of the test materials were collected, RNA was extracted, transcriptome sequencing was performed, and the corresponding FPKM values of the genes were obtained through analysis. Graphs were drawn using the FPKM values, as shown in Figure 3 3c in

[0035] Thirty-two test materials with high solanine content (solanine content > 200 mg / kg) and 62 test materials with low solanine content (low solanine content ≤ 200 mg / kg) were genotyped using MT molecular markers HapI-1, HapI-2, HapII-1, HapII-2, HapIII-1, HapIII-2, HapIV-1, and HapIV-2. The results were as shown in Figure 3 3a in

[0036] As Figure 3 shown in 3b in

[0037] It is shown that the solanine content of potatoes can be identified according to the following method: The potato genomic DNA is subjected to PCR amplification using primer pair P1 and primer pair P2 to obtain a PCR product. The solanine content of potatoes with the HapII type or HapIII type in the PCR product is higher than that of potatoes with the HapIV type in the PCR product.

[0038] In practical applications, potatoes with a high solanine content can also be screened or assisted in screening according to the following method: The potato genomic DNA is subjected to quantitative PCR amplification using primer pair P1 and primer pair P2 to obtain a PCR product. The PCR product is detected by electrophoresis, and potatoes with the HapII type or HapIII type in the PCR product are selected.

[0039] In practical applications, potatoes with a low solanine content can also be screened or assisted in screening according to the following method: The potato genomic DNA is subjected to quantitative PCR amplification using primer pair P1 and primer pair P2 to obtain a PCR product. The PCR product is detected by electrophoresis, and potatoes with the HapIV type in the PCR product are selected.

[0040] Finally, it should be noted that the above description is only the preferred embodiment of the present invention. Those skilled in the art can make various similar representations under the inspiration of the present invention without violating the purpose and claims of the present invention. Such transformations all fall within the protection scope of the present invention.

Claims

1. An MT molecular marker related to a gene for regulating the solanine content in potato tubers, characterized in that, The MT molecular markers are one or more of HapI-1, HapI-2, HapII-1, HapII-2, HapIII-1, HapIII-2, HapIV-1, and HapIV-2; The nucleotide sequence of HapI-1 is as shown in SEQ ID NO: 1; The nucleotide sequence of HapI-2 is as shown in SEQ ID NO: 2; The nucleotide sequence of HapII-1 is as shown in SEQ ID NO: 3; The nucleotide sequence of HapII-2 is as shown in SEQ ID NO: 4; The nucleotide sequence of HapIII-1 is as shown in SEQ ID NO: 5; The nucleotide sequence of HapIII-2 is as shown in SEQ ID NO: 6; The nucleotide sequence of HapIV-1 is as shown in SEQ ID NO: 7; The nucleotide sequence of HapIV-2 is as shown in SEQ ID NO:

8.

2. A primer for detecting a marker for amplifying an MT molecular marker, characterized in that, It includes primer pair P1 and primer pair P2; The primer pair P1: includes a forward primer and a reverse primer with nucleotide sequences as shown in SEQ ID NO: 9 and SEQ ID NO: 10 respectively; The primer pair P2: includes a forward primer and a reverse primer with nucleotide sequences as shown in SEQ ID NO: 11 and SEQ ID NO: 12 respectively.

3. Use of the MT molecular marker according to claim 1 or the marker detection primer according to claim 2 in any one of the following 1)-6): 1) Identifying or assisting in identifying the solanine content in potato tubers; 2) Preparing a product for identifying or assisting in identifying high solanine content in potatoes; 3) Screening or assisting in screening potatoes with high solanine content; 4) Preparing a product for screening or assisting in screening potatoes with high solanine content; 5) Potato breeding; 6) Preparing a product for potato breeding.

4. The application according to claim 3, wherein: The use includes nucleic acid hybridization detection, molecular markers, preparing molecular probes, and preparing detection kits.

5. The application according to claim 3, wherein: Predict the solanine content according to the type of MT molecular marker in the test sample; The solanine content in the test sample containing HapII-1, HapII-2, HapIII-1, and HapIII-2 is high; The solanine content in the test sample containing HapIV-1 and HapIV-2 is low; The solanine content in the test sample containing HapI-1 and HapI-2 is unstable.

6. A method for identifying or assisting in identifying the content of solanine in potatoes, characterized in that It includes: Extract the DNA of the test sample, perform quantitative PCR amplification using the marker detection primer, and identify the solanine content in potatoes according to the band size of the PCR product.

7. The method according to claim 6, wherein The marker detection primer includes primer pair P1 and primer pair P2; The primer pair P1: includes a forward primer and a reverse primer with nucleotide sequences as shown in SEQ ID NO: 9 and SEQ ID NO: 10 respectively; The primer pair P2: includes a forward primer and a reverse primer with nucleotide sequences as shown in SEQ ID NO: 11 and SEQ ID NO: 12 respectively.

8. The method according to claim 6, wherein the identification method is specifically as follows: the potato with the PCR product containing the following DNA fragments has a high content of solanine; The DNA fragments are the nucleotide sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4; and / or, the DNA fragments are the nucleotide sequences shown in SEQ ID NO: 5 and SEQ ID NO:

6.

9. The method according to claim 6, wherein the identification method is specifically as follows: the potato with the PCR product containing the following DNA fragments has a low content of solanine; The DNA fragments are the nucleotide sequences shown in SEQ ID NO: 7 and SEQ ID NO:

8.

10. The method according to claim 6, wherein the identification method is specifically as follows: the potato with the PCR product containing the following DNA fragments has an unstable content of solanine; The DNA fragments are the nucleotide sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2.

Images