MT molecular markers related to solanine content regulatory genes in potato tubers and their application

Abstract

The present invention relates to the field of biotechnology, and in particular to a MT molecular marker related to a potato tuber solanine content regulating gene and its application, and to determining the potato flesh solanine inhibitory factor by amplification results of a marker detection primer set. StERF9 The ploidy of potatoes can be determined by the type and expression level of the promoter, and the level of solanine in the mature potato flesh can be predicted. This greatly shortens the time required to measure solanine in potato flesh after the potato growth cycle is completed. It is a new breeding method that saves time and is highly accurate.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an MT molecular marker related to a potato tuber solanine content regulating gene and an application thereof. Background Art

[0002] Potatoes (S olanum tuberosum Potatoes are China's fourth-largest grain crop and play a vital role in national food security. However, during storage, potatoes often experience sprouting and rotting of tubers due to unsuitable storage conditions. This leads to the production of toxic substances, primarily solanine, which creates an unpleasant bitter taste. Excessive consumption can also cause poisoning in humans and animals, making it a food safety issue that requires significant attention.

[0003] Solanine, also known as solanine, is a general term for plant steroidal glycoalkaloids (SGAs). It is composed of a hydrophobic aglycone (aglycone) and a hydrophilic oligosaccharide chain. The aglycone portion is composed of a cyclopentane polyhydrophenanthrene (a non-polar steroidal unit) connected to a nitrogen-containing heterocycle (nitrogen core). Currently, there are over 100 known solanines, most of which are found in plants of the Solanaceae and Liliaceae families. In addition to α-solanine and α-chaconine, the main solanine components in potatoes include small amounts of tropaeoline, camosanine, lepaeoline, and lepaeoline. Because α-solanine and α-chaconine account for over 95% of the total solanine content in potato tubers, the sum of the α-solanine and α-chaconine contents is usually used to represent the total solanine content in potatoes.

[0004] While solanine in potatoes has largely contributed to serious food safety concerns, its functions and activity offer a viable avenue for plant disease control and drug development. Potatoes naturally produce solanine, an alkaloid with anti-disease, insect resistance, and antifungal properties. Studies have shown that solanine concentrations of 140 mg / kg or higher produce a bitter, numbing, and burning taste. At concentrations of 200 mg / kg, the taste becomes bitter and difficult to swallow. This unpleasant taste can also deter animals from gnawing on young potato seedlings. The U.S. Department of Agriculture has set the safe limit for solanine consumption in potato tubers at 200 mg / kg FW, a level also established by the U.S. Food and Drug Administration as the upper limit for safe consumption of SGAs in potato tubers. The solanine content is used as an important indicator to evaluate the quality of solanine and is an important factor considered by breeders when breeding high-quality potato plants. Currently, the selection and breeding for this indicator requires waiting for the plants to bloom and bear fruit, and then measuring the solanine content of the fruit to screen out high-quality plants. The selection process is long and the cost is high.

[0005] In view of this, the present invention is proposed to develop practical molecular markers for application in molecular breeding of potato quality traits. Summary of the Invention

[0006] In order to overcome the shortcomings of the above technical defects, the present invention provides an MT molecular marker related to the solanine content regulatory gene in potato tubers and its application, which can be used to predict the level of solanine in mature potato flesh, greatly shortening the breeding time.

[0007] To achieve the above object, the present invention is implemented through the following scheme:

[0008] In a first aspect, the present invention provides a MT molecular marker related to a solanine content regulating gene in potato tubers, wherein the MT molecular marker is one or more of HapI-1, HapI-2, HapII-1, HapII-2, HapIII-1, HapIII-2, HapIV-1, and HapIV-2;

[0009] The nucleotide sequence of HapI-1 is shown in SEQ ID NO: 1; AGCCAATTAACCGACCTGCATAGCTCGCATTCCTCGACTAATTTAGCCTCAGATAACGTGCAAGAATTACTGAATTCTCCATCAATGGATCACGATGACCCGTTTTTCGATCTACCGGATCTTACCGTC

[0010] The nucleotide sequence of HapI-2 is shown in SEQ ID NO: 2; GCCGGGTACAAAAAAAATTCAAGATGGGAATGAGGAGGAGGATGATAAGACGAAAATCAAACGAAAAAATGAAGGTGTTGTTGATGAAAAACATCCAACTTATAGAGGAGTTCGTAAGAGG

[0011] The nucleotide sequence of HapII-1 is shown in SEQ ID NO: 3; AGCCAATTAACCGAGCTGCACACCTCGCATTCCTCGACTAATTTAGCTTCAGATAACGTGCAAGAATTACTCAATTCTCCATCAATGGATCACGATGACCCGTTTTTCGATCTACCGGATCTTACCATC

[0012] The nucleotide sequence of HapII-2 is shown in SEQ ID NO: 4; GCCGGGTTCAAAAAAAAATCAAGATGGGAATGAGGAGGAGGAGGATGATAACACGAAAATCAGACGAAAAAATGAAGTTGTTGTTGATGAAAAACATCCGACTTATAGAGGAGTTCGTAAGAGG

[0013] The nucleotide sequence of HapIII-1 is shown in SEQ ID NO: 5; AGCCAATTAACCGAGCTGCATAGCTCGCATTCCTCGACTAATTTAGCCTCGCAAGAATTACTGAATTCTCCATCAATGGATCACGATGACCCGTTTTTCGATCTACCGGATCTTACCATC

[0014] The nucleotide sequence of HapIII-2 is shown in SEQ ID NO: 6; GCCGGGTTCAAAAAAAATTCAAGATGGGAATAACACGAAAATCAGACGAAAAAATGAAGGTGTTGTTGATGAAAAGCATCCGACTTATAGAGGAGTTCGTAAGAGG

[0015] The nucleotide sequence of HapIV-1 is shown in SEQ ID NO: 7; AGCCAATTAACCGAGCTGCATAGCTCGCATTCCTCGACTAATTTAGCCTCGCAAGAATTACTGAATTCTCCATCAATGGATCACGATGACCCCTTTTTCGATCTACCGGATCTTACCATC

[0016] The nucleotide sequence of HapIV-2 is shown in SEQ ID NO: 8. GCCGGGTTCAAAAAAAATTCAAGATGGGAATGAGGAGGAGGATGATAACAAGAAAATCAGACGAAAAAATGAAGGTGTTGTTGATGAAAAACATCCGACTTATAGAGGAGTTCGTAAGAGG

[0017] In a second aspect, the present invention provides a primer set for amplifying MT molecular markers, comprising a primer pair P1 and a primer pair P2;

[0018] The primer pair P1 comprises a forward primer and a reverse primer whose nucleotide sequences are shown in SEQ ID NO: 9 and SEQ ID NO: 10, respectively;

[0019] The primer pair P2 comprises a forward primer and a reverse primer whose nucleotide sequences are shown as SEQ ID NO: 11 and SEQ ID NO: 12, respectively.

[0020] In a third aspect, the present invention provides the use of MT molecular markers and marker detection primers in any of the following 1)-6):

[0021] 1) Identify or assist in identifying the solanine content in potato tubers;

[0022] 2) preparing and identifying products containing or assisting in the identification of high solanine content in potatoes;

[0023] 3) screening or assisting in screening potatoes with high solanine content;

[0024] 4) preparing a product for screening or assisting in screening potatoes with high solanine content;

[0025] 5) Potato breeding;

[0026] 6) Prepare potato breeding products.

[0027] In some examples of this embodiment, the MT molecular marker is one or more of HapI-1, HapI-2, HapII-1, HapII-2, HapIII-1, HapIII-2, HapIV-1, and HapIV-2;

[0028] The nucleotide sequence of HapI-1 is shown in SEQ ID NO: 1;

[0029] The nucleotide sequence of HapI-2 is shown in SEQ ID NO: 2;

[0030] The nucleotide sequence of HapII-1 is shown in SEQ ID NO: 3;

[0031] The nucleotide sequence of HapII-2 is shown in SEQ ID NO: 4;

[0032] The nucleotide sequence of HapIII-1 is shown in SEQ ID NO: 5;

[0033] The nucleotide sequence of HapIII-2 is shown in SEQ ID NO: 6;

[0034] The nucleotide sequence of HapIV-1 is shown in SEQ ID NO: 7;

[0035] The nucleotide sequence of HapIV-2 is shown in SEQ ID NO:8.

[0036] In some examples of this embodiment, the MT molecular marker includes primer pair P1 and primer pair P2;

[0037] The primer pair P1 comprises a forward primer and a reverse primer whose nucleotide sequences are shown in SEQ ID NO: 9 and SEQ ID NO: 10, respectively;

[0038] The primer pair P2 comprises a forward primer and a reverse primer whose nucleotide sequences are shown as SEQ ID NO: 11 and SEQ ID NO: 12, respectively.

[0039] Furthermore, the applications include nucleic acid hybridization detection, molecular labeling, preparation of molecular probes, and preparation of detection kits.

[0040] Furthermore, the solanine content is predicted based on the type of MT molecular marker in the sample to be tested;

[0041] Specifically, the test samples containing HapII-1 and HapII-2 had high solanine content;

[0042] Specifically, the test samples containing HapIII-1 and HapIII-2 had high solanine content;

[0043] Specifically, the test samples containing HapII-1, HapII-2, HapIII-1, and HapIII-2 had high solanine content;

[0044] Specifically, the solanine content in the tested samples containing HapIV-1 and HapIV-2 was low;

[0045] Specifically, the solanine content in the test samples containing HapI-1 and HapI-2 is unstable.

[0046] In a fourth aspect, the present invention provides a method for identifying or assisting in identifying the solanine content in potatoes, comprising: extracting DNA from a sample to be tested, performing quantitative PCR amplification using labeled detection primers, and identifying the solanine content in potatoes based on the band size of the PCR product.

[0047] Furthermore, the marker detection primers include primer pair P1 and primer pair P2;

[0048] The primer pair P1 comprises a forward primer and a reverse primer whose nucleotide sequences are shown in SEQ ID NO: 9 and SEQ ID NO: 10, respectively;

[0049] The primer pair P2 comprises a forward primer and a reverse primer whose nucleotide sequences are shown as SEQ ID NO: 11 and SEQ ID NO: 12, respectively.

[0050] In some specific embodiments, the present invention provides a nucleotide sequence of a labeled detection primer having 80% identity with the sequence shown in SEQ ID NO. 9 to SEQ ID NO. 12; preferably, 85% identity, more preferably, 90% identity, more preferably, 95% identity, and most preferably, 99% identity.

[0051] Illustratively, "stringent conditions" as used herein refer to conditions under which a probe will hybridize to its target sequence to a detectable extent exceeding hybridization to other sequences (e.g., at least 2 times above background). Stringent conditions are sequence-dependent and vary depending on the environment. By controlling the stringency of hybridization and / or washing conditions, a target sequence that is 100% complementary to the probe can be identified. Alternatively, stringent conditions can be adjusted to allow for some sequence mismatches, such that a lower degree of similarity is detected.

[0052] In some examples of this embodiment, amplification of P1 using a forward primer and a reverse primer consisting of nucleotide sequences as shown in SEQ ID NO: 9 and SEQ ID NO: 10, respectively, can amplify a base deletion at 600 bp, that is, a DNA fragment with a nucleotide sequence as shown in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 7.

[0053] In some examples of this embodiment, amplification of P2 using a primer pair consisting of a forward primer and a reverse primer having nucleotide sequences as shown in SEQ ID NO: 11 and SEQ ID NO: 12, respectively, can amplify a base insertion between 204 and 231 bp, i.e., a DNA fragment having a nucleotide sequence as shown in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, or SEQ ID NO: 8.

[0054] Furthermore, the identification method is specifically as follows: the potato whose PCR product contains the nucleotide sequence shown in SEQ ID NO: 3 and SEQ ID NO: 4 has a high solanine content;

[0055] Alternatively, the PCR product contains the nucleotide sequences shown in SEQ ID NO: 5 and SEQ ID NO: 6, and the potato has a high solanine content;

[0056] Alternatively, the PCR product contains the nucleotide sequences shown in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6, and the potato has a high solanine content.

[0057] Furthermore, the identification method is specifically as follows: the potato whose PCR product contains the nucleotide sequence shown in SEQ ID NO: 7 and SEQ ID NO: 8 has a low solanine content;

[0058] Furthermore, the identification method is specifically as follows: the solanine content of potatoes whose PCR products contain nucleotide sequences such as those shown in SEQ ID NO: 1 and SEQ ID NO: 2 is unstable.

[0059] In any of the above methods, uses or products, the purpose of the breeding is to cultivate potato varieties with low solanine content.

[0060] Compared with the prior art, the present invention has the following beneficial effects:

[0061] (1) The present invention obtains a molecular marker that is extremely significantly correlated with the solanine content of potatoes. By using the molecular marker to detect potato breeding materials, it is possible to accurately and efficiently predict whether the solanine content of the potato plants is high or low without having to plant and wait for the potato plants to bloom and bear fruit, thereby greatly improving the selection efficiency of potato breeding;

[0062] (2) The primer pair of the present invention for detecting the promoter haplotype molecular marker associated with solanine accumulation in potato fruit has strong specificity and can accurately amplify the sequence containing the MT molecular marker site of the present invention. The use of the primer pair to prepare a kit can assist in selective breeding and effectively predict the level of solanine in mature potato flesh;

[0063] (3) The promoter haplotype molecular marker related to solanine accumulation in potato fruit of the present invention and its application can effectively assist potato breeding selection, which is a new breeding method with high time-saving and high precision and has extremely high economic value. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] Figure 1 is the agarose gel electrophoresis detection diagram of primer pair P1;

[0065] Figure 2 is the agarose gel electrophoresis detection diagram of primer pair P2;

[0066] Figure 3 for StERF9 Genetic influence on solanine content;

[0067] 3a is the distribution diagram of solanine content in different haplotype potatoes; 3b is the comparison diagram of solanine content in different haplotype potatoes; 3c is the distribution diagram of solanine content in some samples. StERF9 Schematic diagram of gene expression levels. DETAILED DESCRIPTION

[0068] In order to make those skilled in the art better understand the technical scheme of the present invention, the present invention is described in detail below in conjunction with specific embodiments. The experimental methods for which specific conditions are not specified in the following examples are usually based on conventional conditions or the conditions recommended by the manufacturer. The test materials used in the following examples, unless otherwise specified, are purchased from conventional biochemical reagent stores. Unless otherwise specified, percentages and parts are calculated by weight. Unless otherwise defined, all professional and scientific terms used in the text have the same meaning as those familiar to those skilled in the art. In addition, any method and material similar to or equivalent to the described content can be applied to the present invention. The preferred implementation methods and materials described in the text are only for demonstration purposes.

[0069] Based on the present invention, in order to shorten the breeding time of potatoes, it is not necessary to wait until they are mature before sampling and testing. The solanine content in the potato flesh can be directly measured to identify the solanine content. The inventors found that StERF9 The total length is 783bp, without introns, encoding 261 amino acid residues, of which the AP2 conserved domain is encoded at positions 93-151, belonging to the typical APETALA2 / ERF transcription factor. The solanine content in potato flesh is reduced when the gene is overexpressed; after knockout, the solanine content in potato flesh increases, proving that the gene is a solanine inhibitory factor in potato flesh. Based on the evolutionary development tree of different potato subspecies, the inventors conducted a comprehensive study on the solanine inhibitory factor in different subspecies. StERF9 Sequence analysis revealed that this gene is a domestication gene. StERF9 The haplotype is clearly under selection, with a 9-base deletion at 600 bp, designated P1, and an insertion between 204 and 231 bp, designated P2. Based on the order of evolution, it is divided into four main haplotypes: HapI, HapII, HapIII, and HapIV. HapI has no deletion in P1 and an insertion in P2; HapII has no deletion in P1 and an insertion in P2 (3 bp longer than HapI); HapIII has a deletion in P1 and no insertion in P2; and HapIV has a deletion in P1 and an insertion in P2. To more intuitively distinguish between haplotypes, primers were designed to detect differences within a shorter region. The position of the PCR amplification product bands on polyacrylamide gels can be used to identify the haplotype classification, effectively assisting in the screening of potato breeding materials.

[0070] The technical solutions of the present invention are further described in detail below in conjunction with specific embodiments and drawings. It should be understood that the following embodiments are only used to explain the present invention and are not used to limit the present invention.

[0071] Example 1

[0072] Experimental Materials:

[0073] The potato materials of the present invention all come from the experimental group of Potato Research Institute of the School of Life Sciences of Yunnan Normal University.

[0074] From the potato genome sequence website http: / / solanaceae.plantbiology.msu.edu / Pgscdown-

[0075] Download the relevant sequences from the website load.shtml), select the specific region sequence, and design the primers using the online primer design website (http: / / www.idtdna.com / Primerquest / Home / Index). StERF9 PCR amplification primers were designed at 600 bp and 204-231 bp of the gene. The results of electrophoresis were sent for first-generation sequencing for screening to determine the marker detection primers that can be used to distinguish different haplotypes. The primer information is shown in Table 1:

[0076] Table 1

[0077]

[0078] Example 2

[0079] (1) Collect potato leaves as test materials, extract genomic DNA using the modified CTAB method, and perform PCR on P1 using the designed marker detection primers. The amplification system and amplification procedure are shown in Tables 2 and 3:

[0080] Table 2 Amplification system

[0081]

[0082] Table 3 Amplification procedures

[0083]

[0084] The amplified products were detected by electrophoresis on 8% agarose gel. The details of PAGE gel electrophoresis are as follows:

[0085] Preparation of gel: Mix 10 mL 40% Bis, 5 mL 10× TBE, and 35 mL pure water, add 30 μL TEMED and 500 μL 10% APS, mix well, pour into glass plate, insert comb and wait for solidification;

[0086] Electrophoresis: Load 1 μL of PCR product and run at 200 V, 400 mA, and 150 W for 1.5 h.

[0087] Silver staining: Wash the PAGE gel with pure water, weigh 1 g of AgNO3 and dissolve it in 1 L of pure water, then stain the gel at 200 rpm for 20 min.

[0088] Color development: Wash the gel with pure water, weigh 15g of NaOH and dissolve it in 1L of pure water, then add 3-4mL of formaldehyde with a rubber dropper and mix well. Place the washed PAGE gel in the solution and color it at 200 rpm for 20 minutes. Figure 1 .

[0089] from Figure 1 As can be seen in the figure, primer pair P1 can amplify StERF9 The nucleotide fragment at 600 bp of the gene coding region. The amplified length of HapI-1 and HapII-1 is 129 bp, and the amplified length of HapIII-1 and HapIV-1 is 120 bp. StERF9 The gene sequence bands have good specificity and no mixed bands.

[0090] The nucleotide sequence of the amplified product HapI-1 is shown in SEQ ID NO: 1, with a length of 129 bp; the nucleotide sequence of the amplified product HapII-1 is shown in SEQ ID NO: 3, with a length of 129 bp; the nucleotide sequence of the amplified product HapIII-1 is shown in SEQ ID NO: 5, with a length of 120 bp; and the nucleotide sequence of the amplified product HapIV-1 is shown in SEQ ID NO: 7, with a length of 120 bp.

[0091] SEQ ID NO: 1

[0092] AGCCAATTAACCGACCTGCATAGCTCGCATTCCTCGACTAATTTAGCCTCAGATAACGTGCAAGAATTACTGAATTCTCCATCAATGGATCACGATGACCCGTTTTTCGATCTACCGGATCTTACCGTC

[0093] SEQ ID NO: 3

[0094] AGCCAATTAACCGAGCTGCACACCTCGCATTCCTCGACTAATTTAGCTTCAGATAACGTGCAAGAATTACTCAATTCTCCATCAATGGATCACGATGACCCGTTTTTCGATCTACCGGATCTTACCATC

[0095] SEQ ID NO: 5

[0096] AGCCAATTAACCGAGCTGCATAGCTCGCATTCCTCGACTAATTTAGCCTCGCAAGAATTACTGAATTCTCCATCAATGGATCACGATGACCCGTTTTTCGATCTACCGGATCTTACCATC

[0097] SEQ ID NO: 7

[0098] AGCCAATTAACCGAGCTGCATAGCTCGCATTCCTCGACTAATTTAGCCTCGCAAGAATTACTGAATTCTCCATCAATGGATCACGATGACCCCTTTTTCGATCTACCGGATCTTACCATC

[0099] (2) Potato leaves were collected as test materials, and genomic DNA was extracted using the modified CTAB method. PCR was performed using the designed marker detection primer P2. The amplification system and amplification procedure are shown in Tables 4 and 5:

[0100] Table 4 Amplification system

[0101]

[0102] Table 5 Amplification procedure

[0103]

[0104] The amplified products were detected by electrophoresis on 8% agarose gel. The details of PAGE gel electrophoresis are as follows:

[0105] Preparation of gel: Mix 10 mL 40% Bis, 5 mL 10× TBE, and 35 mL pure water, add 30 μL TEMED and 500 μL 10% APS, mix well, pour into glass plate, insert comb and wait for solidification;

[0106] Electrophoresis: Load 1 μL of PCR product and run at 200 V, 400 mA, and 150 W for 1.5 h.

[0107] Silver staining: Wash the PAGE gel with pure water, weigh 1 g of AgNO3 and dissolve it in 1 L of pure water, then stain the gel at 200 rpm for 20 min.

[0108] Color development: Wash the gel with pure water, weigh 15g of NaOH and dissolve it in 1L of pure water, then add 3-4mL of formaldehyde with a rubber dropper and mix well. Place the washed PAGE gel in the solution and color it at 200 rpm for 20 minutes. Figure 2 .

[0109] from Figure 2 As can be seen, primer pair P2 can amplify the coding StERF9 The nucleotide fragment at 600 bp of the gene coding region. The amplified length of HapI-2 is 121 bp, the amplified length of HapII-2 is 124 bp, the amplified length of HapIII-2 is 106 bp, and the amplified length of HapIV-2 is 121 bp. StERF9 The gene sequence bands have good specificity and few mixed bands.

[0110] The nucleotide sequence of the amplified product HapI-2 is shown in SEQ ID NO: 2, with a length of 121 bp; the nucleotide sequence of the amplified product HapII-2 is shown in SEQ ID NO: 4, with a length of 124 bp; the nucleotide sequence of the amplified product HapIII-2 is shown in SEQ ID NO: 6, with a length of 106 bp; and the nucleotide sequence of the amplified product HapIV-2 is shown in SEQ ID NO: 8, with a length of 121 bp.

[0111] SEQ ID NO: 2

[0112] GCCGGGTACAAAAAAAATTCAAGATGGGAATG---AGGAGGAGGATGATAAGACGAAAATCAAACGAAAAAATGAAGGTGTTGTTGATGAAAAACATCCAACTTATAGAGGAGTTCGTAAGAGG

[0113] SEQ ID NO: 4

[0114] GCCGGGTTCAAAAAAAAATCAAGATGGGAATGAGGAGGAGGAGGATGATAACACGAAAATCAGACGAAAAAATGAAGTTGTTGTTGATGAAAAACATCCGACTTATAGAGGAGTTCGTAAGAGG

[0115] SEQ ID NO: 6

[0116] GCCGGGTTCAAAAAAAATTCAAGATGGGAAT------------------AACACGAAAATCAGACGAAAAAATGAAGGTGTTGTTGATGAAAAGCATCCGACTTATAGAGGAGTTCGTAAGAGG

[0117] SEQ ID NO: 8

[0118] GCCGGGTTCAAAAAAAATTCAAGATGGGAATG---AGGAGGAGGATGATAACAAGAAAATCAGACGAAAAAATGAAGGTGTTGTTGATGAAAAACATCCGACTTATAGAGGAGTTCGTAAGAGG

[0119] Example 3 Investigation StERF9 Effect of gene haplotype on solanine content

[0120] The potato leaves of the experimental materials were collected, RNA was extracted, and transcriptome sequencing was performed. After analysis, the FPKM values ​​corresponding to the genes were obtained and the FPKM values ​​were used to draw a graph. Figure 3 3c in.

[0121] Thirty-two high-solanine content test materials (solanine content > 200 mg / kg) and 62 low-solanine content test materials (low-solanine content ≤ 200 mg / kg) were typed using MT molecular markers HapI-1, HapI-2, HapII-1, HapII-2, HapIII-1, HapIII-2, HapIV-1, and HapIV-2. The results are as follows: Figure 3 As shown in Figure 3a, it can be seen from the figure that the proportion of HapIII type is the highest in potato materials with high solanine content, and the proportion of HapIV type is the highest in potato materials with low solanine content. The results show that each MT molecular marker is significantly associated with the phenotype of solanine content. The MT molecular marker provided by the present application scheme can accurately identify the solanine content.

[0122] like Figure 3 As shown in Figure 3b, under the condition of ensuring normal expression, the solanine content of materials containing HapI type (including HapI-1 and HapI-2) is unstable; the solanine content of materials containing HapII type (including HapII-1 and HapII-2) is stable and high; the solanine content of materials containing HapIII type (including HapIII-1 and HapIII-2) is 71.4% likely to be high; and the solanine content of materials containing HapIV type (including HapIV-1 and HapIV-2) is 87.5% likely to be low.

[0123] The results showed that the solanine content of potatoes can be identified according to the following method: potato genomic DNA is amplified by PCR using primer pair P1 and primer pair P2 to obtain PCR products. The solanine content of potatoes containing HapII type or HapIII type in the PCR products is higher than that of potatoes containing HapIV type in the PCR products.

[0124] In practical applications, potatoes with high solanine content can also be screened or assisted in screening according to the following method: primer pair P1 and primer pair P2 are used to perform quantitative PCR amplification on potato genomic DNA to obtain PCR products, and the PCR products are detected by electrophoresis to select potatoes whose PCR products contain HapII type or HapIII type.

[0125] In practical applications, potatoes with low solanine content can also be screened or assisted in screening according to the following method: primer pair P1 and primer pair P2 are used to perform quantitative PCR amplification on potato genomic DNA to obtain PCR products, the PCR products are detected by electrophoresis, and potatoes whose PCR products contain the HapIV type are selected.

[0126] Finally, it should be noted that the above description is only a preferred embodiment of the present invention. Under the guidance of the present invention, those skilled in the art can make various similar expressions without violating the purpose and claims of the present invention. Such changes fall within the scope of protection of the present invention.

Claims

1. A MT molecular marker related to a gene regulating solanine content in potato tubers, characterized in that: The MT molecular markers are HapI-1, HapI-2, HapII-1, HapII-2, HapIII-1, HapIII-2, HapIV-1 and HapIV-2; The nucleotide sequence of HapI-1 is shown in SEQ ID NO: 1; The nucleotide sequence of HapI-2 is shown in SEQ ID NO: 2; The nucleotide sequence of HapII-1 is shown in SEQ ID NO: 3; The nucleotide sequence of HapII-2 is shown in SEQ ID NO: 4; The nucleotide sequence of HapIII-1 is shown in SEQ ID NO: 5; The nucleotide sequence of HapIII-2 is shown in SEQ ID NO: 6; The nucleotide sequence of HapIV-1 is shown in SEQ ID NO: 7; The nucleotide sequence of HapIV-2 is shown in SEQ ID NO:

8.

2. A marker detection primer for amplifying the MT molecular marker according to claim 1, characterized in that: including primer pair P1 and primer pair P2; The primer pair P1 comprises a forward primer and a reverse primer whose nucleotide sequences are shown in SEQ ID NO: 9 and SEQ ID NO: 10, respectively; The primer pair P2 comprises a forward primer and a reverse primer whose nucleotide sequences are shown as SEQ ID NO: 11 and SEQ ID NO: 12, respectively.

3. Use of the MT molecular marker according to claim 1 in any one of the following 1) to 4): 1) Identify or assist in identifying the solanine content in potato tubers; 2) preparing and identifying products containing or assisting in the identification of high solanine content in potatoes; 3) screening or assisting in screening potatoes with high solanine content; 4) preparing a product for screening or assisting in screening potatoes with high solanine content; The tested samples containing HapII-1 and HapII-2 had high solanine content; The tested samples containing HapIII-1 and HapIII-2 had high solanine content; The solanine content in the tested samples containing HapIV-1 and HapIV-2 was low; The solanine content in the tested samples containing HapI-1 and HapI-2 was unstable.

4. Use of the labeled detection primer according to claim 2 in any one of the following 1) to 4): 1) Identify or assist in identifying the solanine content in potato tubers; 2) preparing and identifying products containing or assisting in the identification of high solanine content in potatoes; 3) screening or assisting in screening potatoes with high solanine content; 4) preparing a product for screening or assisting in screening potatoes with high solanine content; Using marker detection primers to perform PCR amplification on the potato to be tested, the solanine content can be predicted based on the type of MT molecular marker in the sample to be tested; The tested samples containing HapII-1 and HapII-2 had high solanine content; The tested samples containing HapIII-1 and HapIII-2 had high solanine content; The solanine content in the tested samples containing HapIV-1 and HapIV-2 was low; The solanine content in the test samples containing HapI-1 and HapI-2 was unstable; The nucleotide sequence of HapI-1 is shown in SEQ ID NO: 1; The nucleotide sequence of HapI-2 is shown in SEQ ID NO: 2; The nucleotide sequence of HapII-1 is shown in SEQ ID NO: 3; The nucleotide sequence of HapII-2 is shown in SEQ ID NO: 4; The nucleotide sequence of HapIII-1 is shown in SEQ ID NO: 5; The nucleotide sequence of HapIII-2 is shown in SEQ ID NO: 6; The nucleotide sequence of HapIV-1 is shown in SEQ ID NO: 7; The nucleotide sequence of HapIV-2 is shown in SEQ ID NO:

8.

5. The use according to claim 4, characterized in that: The product is a detection kit.

6. A method for identifying or assisting in identifying the solanine content in potatoes, characterized in that include: Extract the DNA of the sample to be tested, perform quantitative PCR amplification using labeled detection primers, and identify the solanine content in potatoes based on the PCR product; The label detection primers include primer pair P1 and primer pair P2; The primer pair P1 comprises a forward primer and a reverse primer whose nucleotide sequences are shown in SEQ ID NO: 9 and SEQ ID NO: 10, respectively; The primer pair P2 comprises a forward primer and a reverse primer whose nucleotide sequences are shown as SEQ ID NO: 11 and SEQ ID NO: 12, respectively; The test sample whose PCR product contains the nucleotide sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4 has a high solanine content.

7. A method for identifying or assisting in identifying the solanine content in potatoes, characterized in that include: Extract the DNA of the sample to be tested, perform quantitative PCR amplification using labeled detection primers, and identify the solanine content in potatoes based on the PCR product; The label detection primers include primer pair P1 and primer pair P2; The primer pair P1 comprises a forward primer and a reverse primer whose nucleotide sequences are shown in SEQ ID NO: 9 and SEQ ID NO: 10, respectively; The primer pair P2 comprises a forward primer and a reverse primer whose nucleotide sequences are shown as SEQ ID NO: 11 and SEQ ID NO: 12, respectively; The test sample whose PCR product contains the nucleotide sequences shown in SEQ ID NO: 5 and SEQ ID NO: 6 has a high solanine content.

8. A method for identifying or assisting in identifying the solanine content in potatoes, characterized in that include: Extract the DNA of the sample to be tested, perform quantitative PCR amplification using labeled detection primers, and identify the solanine content in potatoes based on the PCR product; The label detection primers include primer pair P1 and primer pair P2; The primer pair P1 comprises a forward primer and a reverse primer whose nucleotide sequences are shown in SEQ ID NO: 9 and SEQ ID NO: 10, respectively; The primer pair P2 comprises a forward primer and a reverse primer whose nucleotide sequences are shown as SEQ ID NO: 11 and SEQ ID NO: 12, respectively; The PCR product contains the nucleotide sequences shown in SEQ ID NO: 7 and SEQ ID NO: 8 and has a low solanine content.

Images