Nucleic acid non-enzymatic amplification method and device based on double-liquid-phase separation and application
Through the nucleic acid non-enzymatic amplification method and microfluidic chip technology based on dual liquid phase separation, the problem of long reaction time of RNA analysis technology is solved, and fast and sensitive RNA detection is achieved, suitable for immediate diagnosis.
Patent Information
- Application Number
- CN202510463286.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-14
- Publication Date
- 2025-07-11
AI Technical Summary
The existing RNA analysis technology has a long reaction time in rapid detection and requires precise primer design and complex operations, making it difficult to meet the needs of immediate detection.
Using a non-enzymatic amplification method based on dual liquid phase separation, the substrate and the sample to be detected are mixed by centrifugal vibration, and the cascade CHA reaction is used to achieve rapid amplification, combined with microfluidic chips and smartphone fluorescence detection, to achieve fast and easy-to-use RNA detection.
It realizes detection of low concentrations of RNA in 1.5 minutes, with high sensitivity and ease of use, and is suitable for instant POC RNA diagnosis.
Smart Images

Figure CN120290789A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biological detection, and particularly relates to a nucleic acid non-enzymatic amplification method, device and application based on biphasic separation. Background Art
[0002] RNA molecules play a key role in many biological processes, making them highly valuable in the analysis of various fields such as biomedical research and clinical diagnosis. RT-qPCR-related methods are still active in the field of RNA analysis due to their good sensitivity and specificity. Although it was invented 38 years ago, it requires a strict operating environment and expensive constant temperature instruments. More importantly, the time required to control emerging infectious diseases (such as the COVID-19 pandemic) is too long. In view of this, the development of new-generation RNA analysis technologies focuses on high reaction efficiency, ease of use, and better analytical performance.
[0003] Currently, there have been reports on the establishment of high-performance RNA analysis platforms. For example, Gootenberg et al. from the Massachusetts Institute of Technology in the United States published "SHERLOCK: nucleic acid detection with CRISPR nucleases" in nature protocols. This paper reported a SHERLOCK system that uses CRISPR-Cas13a for simple and sensitive RNA analysis. However, although SHERLOCK detection takes less time compared to RT-qPCR, the platform still requires a reaction time of 30 minutes to 3 hours, which is not sufficient for point-of-care testing. In contrast, Japanese scholar Notomi et al. published "Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products" in nature protocols. The RT-LAMP platform proposed in this paper provides faster detection by combining reverse transcription and amplification into one step, and the reaction time is usually around 30 to 60 minutes. RT-LAMP reduces complexity and duration, making it more suitable for rapid RNA analysis. However, these technologies still face challenges such as the need for precise primer design and time-consuming. Summary of the Invention
[0004] The primary object of the present invention is to overcome the deficiencies of the prior art and provide a nucleic acid non-enzymatic amplification method based on biphasic separation.
[0005] Another object of the present invention is to provide a nucleic acid non-enzymatic amplification device based on biphasic separation.
[0006] Another object of the present invention is to provide an application of the above method or device.
[0007] The object of the present invention is achieved by the following technical solutions:
[0008] A nucleic acid non-enzymatic amplification method based on biphasic separation, comprising the following steps: centrifugally vibrating and mixing an amplification substrate and a sample to be detected to obtain a nucleic acid non-enzymatic amplification product.
[0009] The amplification substrate is a system that can form biphasic separation and can perform a cascade CHA reaction, and its composition is preferably as follows: two nucleic acid single strands C1-H1 and C1-H2 that form DNA hairpin pair C1, two nucleic acid single strands C2-H1 and C2-H2 that form DNA hairpin pair C2, a buffer solution, and an organic solvent; C1-H1 with a concentration of 100 nM, C1-H2 with a concentration of 100 nM, C2-H1 with a concentration of 100 nM, C2-H2 with a concentration of 100 nM, a buffer solution, and an organic solvent are mixed in a volume ratio of 12-13:12-13:12-13:12-13:60-70:1000; preferably mixed in a volume ratio of 12.5:12.5:12.5:12.5:65:1000.
[0010] The buffer solution is a buffer solution that can perform a cascade CHA reaction; preferably a TNaK buffer solution.
[0011] The organic solvent is preferably an organic solvent with low solubility in water and in liquid form; more preferably an alcohol with a carbon chain length of C4-C5; most preferably isobutanol.
[0012] The nucleic acid single strand is preferably a nucleic acid with the following sequence:
[0013] N Gene-C1-H1: 5'-TGCGCGACA / i6FAMdT / TCCGAAGAGATGTACTAGGTCTTCGGAA / iBHQ1dT /
[0014] GTCCATACTCAGTCAG-3';
[0015] N Gene-C1-H2: 5'-CGAAGACCTAGTACATCTCTTCGGAATGTGATGTACTAGG-3';
[0016] N Gene-C2-H1: 5'-CCA / i6FAMdT / ACTCAGTCAGGGATCATGTAGCTGACTGAGTA / iBHQ1dT / GGTAATTT-3';
[0017] N Gene-C2-H2: 5'-GGATCATGTAGCCATACTCAGTCAGCTACATGATCCCTGACTG-3’;
[0018] O Gene-C1-H1: 5'-CTTCTG / i6FAMdT / AATTTTTAAACGATGTACTAGGGTTTAAAAAT / iBHQ1dT / ACCATACTCAGTCAG-3’;
[0019] O Gene-C1-H2: 5'-TTAAACCCTAGTACATCGTTTAAAAATTAGATGTACTAGG-3’;
[0020] O Gene-C2-H1: 5'-CCA / i6FAMdT / ACTCAGTCAGGGATCATGTAGCTGACTGAGTA / iBHQ1dT / GGACATTC-3’;
[0021] O Gene-C2-H2: 5'-GGATCATGTAGCCATACTCAGTCAGCTACATGATCCCTGACTG-3’.
[0022] The sample to be detected is nucleic acid; preferably RNA; more preferably at least one of the N gene and the ORF1 gene of the novel coronavirus.
[0023] The amplification substrate and the sample to be detected are preferably mixed at a volume ratio of 4-6:1; more preferably at a volume ratio of 5:1.
[0024] The centrifugation conditions are preferably centrifugation at 4000-5000 rpm for 4-6 s; more preferably centrifugation at 4500 rpm for 5 s.
[0025] The vibration conditions are preferably vibration at 150-350 rpm for 4-6 s. More preferably vibration at 250 rpm for 5 s.
[0026] Use of the above nucleic acid non-enzymatic amplification method based on biphasic separation in nucleic acid amplification and / or nucleic acid detection.
[0027] The nucleic acid detection is for non-diagnostic and non-therapeutic purposes.
[0028] A nucleic acid detection method, comprising the following steps:
[0029] (1) Qualitative analysis of the sample to be detected can be carried out by fluorescence detection of the product obtained by the above nucleic acid non-enzymatic amplification method based on biphasic separation;
[0030] (2) By analyzing the fluorescence detection intensity through software and referring to the standard curve, quantitative analysis of the sample to be detected can be carried out.
[0031] The wavelength of the fluorescence described in step (1) is preferably 470 - 490 nm; more preferably 480 nm.
[0032] The software described in step (2) is preferably ImageJ software.
[0033] A nucleic acid non - enzymatic amplification device based on double - liquid - phase separation, designed based on the above - mentioned nucleic acid non - enzymatic amplification method based on double - liquid - phase separation, includes a microfluidic chip, a groove for placing the microfluidic chip, and a motor for centrifugation and vibration connected to the groove; a sample loading hole and reaction holes communicating with the sample loading hole are arranged on the microfluidic chip; the reaction holes are arranged around the sample loading hole, so that under the action of centrifugal force, the sample to be detected in the sample loading hole enters the reaction holes.
[0034] The shape of the microfluidic chip is preferably circular, which is more conducive to centrifugation under the action of the motor for centrifugation and vibration.
[0035] The motor for centrifugation and vibration is a motor obtained by combining a centrifugal motor and a vibration motor.
[0036] For the convenience of use, the nucleic acid non - enzymatic amplification device based on double - liquid - phase separation further includes a power supply connected to the motor for centrifugation and vibration.
[0037] Application of the above - mentioned nucleic acid non - enzymatic amplification device based on double - liquid - phase separation in nucleic acid amplification and / or nucleic acid detection.
[0038] A more preferred solution is to integrate the amplification device and the detection device. The present invention provides a nucleic acid non - enzymatic amplification and detection device based on double - liquid - phase separation, including an amplification part, a detection part and a housing; the amplification part is located inside the housing, and the detection part is located at the upper end of the housing;
[0039] The amplification part includes a microfluidic chip, a groove for placing the microfluidic chip, and a motor for centrifugation and vibration connected to the groove; a sample loading hole and reaction holes communicating with the sample loading hole are arranged on the microfluidic chip; the reaction holes are arranged around the sample loading hole;
[0040] The detection part includes a light source for exciting fluorescence, a filter, a card slot for placing a fluorescence reading device, and a fluorescence reading device; a light - transmitting hole facing the filter is arranged on the card slot for placing the fluorescence reading device; during use, the light emitted by the light source for exciting fluorescence irradiates the microfluidic chip, and the fluorescence signal of the reaction holes of the microfluidic chip enters the fluorescence reading device placed in the card slot for placing the fluorescence reading device after being filtered by the filter.
[0041] The light source for exciting fluorescence is preferably a blue light source; more preferably a blue light source with a wavelength of 470 - 490 nm; most preferably a 480 nm blue light-emitting diode (LED).
[0042] The filter is preferably a 520 nm filter.
[0043] The material of the filter is preferably plastic.
[0044] The fluorescence reading device is preferably a smart phone.
[0045] The function of the housing is to provide a dark environment to facilitate the detection of fluorescence.
[0046] An activity door is provided on the housing to facilitate the operation of the microfluidic chip, light source, and power supply, mainly facilitating the replacement or sample addition operation of the microfluidic chip; the position of the activity door can be around the four sides and the upper end of the housing.
[0047] For ease of use, the nucleic acid non-enzymatic amplification device based on double liquid phase separation further includes a power supply A connected to a motor for centrifugation and vibration and a power supply B connected to a light source for exciting fluorescence. The power supply A and the power supply B are the same power supply or different power supplies.
[0048] The power supply is preferably a lithium-ion battery; more preferably a rechargeable lithium-ion battery; most preferably a lithium battery with a DC voltage of 5V (DC 5V lithium battery).
[0049] The above-mentioned nucleic acid non-enzymatic amplification detection device based on double liquid phase separation is also provided with a charging socket, and the charging socket is connected to the power supply.
[0050] The preparation method of the above-mentioned nucleic acid non-enzymatic amplification detection device based on double liquid phase separation is to 3D print the main frame and the microfluidic chip, and then install the light source and the motor.
[0051] The application of the above-mentioned nucleic acid non-enzymatic amplification detection device based on double liquid phase separation in nucleic acid amplification and / or nucleic acid detection.
[0052] The application of the above-mentioned nucleic acid non-enzymatic amplification detection device based on double liquid phase separation includes the following steps:
[0053] 1) Amplification reaction: Add the amplification substrate to the reaction wells of the microfluidic chip, add the sample to be detected to the sample addition wells of the microfluidic chip, turn on the motor for centrifugation and vibration, centrifuge the sample to be detected from the sample addition wells to the reaction wells through centrifugation, and then amplify the reaction signal by vibrating to fully mix the amplification substrate and the sample to be detected;
[0054] 2) Detection process: Turn on the light source for exciting fluorescence to excite the amplified product obtained in step 1) to emit fluorescence, then collect the fluorescence image through a fluorescence reading device and perform fluorescence analysis, thereby realizing the analysis and detection of nucleic acids.
[0055] The amplification reaction principle of the present invention is to accelerate the DNA amplification circuit based on double liquid phase separation. The double liquid phase separation system consists of two phases. The aqueous phase is dissolved DNA, and the organic dehydrated phase is undissolved DNA. With the strong dehydration process, a large number of DNA amplification circuit substrates and input droplets are squeezed at the junction of the aqueous phase, significantly improving the collision efficiency, thereby increasing the reaction rate of the DNA amplification circuit. After a short centrifugation, the product is re-aggregated and prepared for further analysis. The tCHA reaction consists of cascaded metastable DNA hairpins C1 and C2, where C1 can be triggered by the target RNA and release sticky ends to trigger C2. During the triggering of the metastable DNA hairpin, the fluorescent molecule FAM and the quencher BHQ1 modified at the opposite position of the hairpin are separated, releasing a strong fluorescent signal. This reaction principle is to accelerate the two-layer cascaded CHA based on double liquid phase separation (DLLPS-tCHA).
[0056] The present invention has the following advantages and effects compared with the prior art:
[0057] (1) The present invention can detect low-concentration RNA in only 1.5 min (1 min of specimen thermal lysis + 30 s of amplification reaction), which is faster than RT-qPCR.
[0058] (2) The present invention is applied in a smartphone integrated microfluidic chip and a lateral flow assay (LFA) platform, and both platforms highlight its potential in POC RNA diagnosis.
[0059] (3) The present invention has the advantages of less time consumption, high sensitivity, easy use, etc. It has a wide range of applications and can perform qualitative detection of nucleic acids. Description of the Drawings
[0060] Figure 1 It is a schematic diagram of the nucleic acid non-enzymatic amplification detection device of the present invention.
[0061] Figure 2 It is a schematic diagram of the structure of the microfluidic chip.
[0062] Figure 3 It is a detailed circuit diagram of the device.
[0063] Figure 4 It is a result diagram of the optimization of the organic phase in LLPS.
[0064] Figure 5 It is a result diagram of the optimization of the number of DLLPS cycles.
[0065] Figure 6 It is a result graph of the sensitivity of the DLLPS-tCHA reaction.
[0066] In the figure: 1 - motor for centrifugation and vibration, 2 - microfluidic chip, 3 - 480 nm blue light-emitting diode (LED) illuminator, 4 - plastic filter (520 nm, long pass), 5 - smartphone, 6A - circuit of the detection part, 6B - circuit of the amplification part, 7 - circuit board, 8 - charging socket, 9A - switch of the detection part, 9B - switch of the amplification part, 10 - lithium-ion battery, 11 - sample loading hole, 12 - reaction hole. Specific implementation mode
[0067] The present invention will be further described in detail below in conjunction with the embodiments and the accompanying drawings, but the implementation modes of the present invention are not limited thereto.
[0068] The sequences of the nucleic acids used in the present invention are shown in Table 1:
[0069] Table 1
[0070]
[0071] Example 1
[0072] A nucleic acid non-enzymatic amplification detection device based on double liquid phase separation, as Figures 1 to 3 shown:
[0073] The detection part is an upper-layer 3D printing component, which internally contains a 480 nm blue light-emitting diode (LED) illuminator 3 and a plastic filter (520 nm, long pass) 4. There is a groove for placing a smartphone and a smartphone 5 on the top layer. The switch 9A of the detection part is installed behind the panel, and the circuit 6A inside the right side is connected to the amplification part circuit 6B.
[0074] The amplification part is a lower-layer 3D printing component. The surface groove is used to place the microfluidic chip 2, on which there are a sample loading hole 11 and a reaction hole 12 (as Figure 2 shown). A motor 1 for centrifugation and vibration is installed below the microfluidic chip; the switch 9B and the charging socket 8 of the amplification part are installed behind the panel, and a circuit board 7 is installed inside the left side and is connected to the DC 5V lithium battery 10 at the bottom and the circuit 6B.
[0075] The detailed diagram of the circuit is as Figure 3 shown. The power supply is a lithium battery with a DC voltage of 5V, which is connected to the charging socket circuit, the LED light source circuit, the centrifugal motor M1 circuit, and the vibration motors M2 and M3 circuits.
[0076] Example 2
[0077] This example is an optimization of the organic phase in liquid-liquid phase separation (LLPS).
[0078] Isobutanol, butanol, isoamylol, and pentanol were respectively selected as the organic phase solvents, and TNaK buffer (the TNaK buffer consists of sodium chloride with a final concentration of 125 mM, Tris with a concentration of 20 mM, and potassium chloride with a concentration of 20 mM, adjusted to pH = 7.5 with hydrochloric acid) was used as the aqueous phase solution. The DLLPS process was carried out under the same conditions (1 mL of aqueous phase solution + 1 mL of organic phase solvent were fully mixed, using a Vortex mixer, mixed evenly at 2800 rpm for 45 s). A small amount of the dense phase droplet sample formed after DLLPS was taken, dropped on a glass slide, and imaged and analyzed using a confocal laser scanning microscope (CLSM). The average diameter of the droplets was measured and calculated through ImageJ software, and the change in fluorescence intensity was recorded. The results are as Figure 4 shown. As the water absorption of the system increases, the average diameter of the dense phase droplets shows the trend of isobutanol < butanol < isoamylol < pentanol, the internal fluorescence becomes brighter, and the average diameter of the droplets decreases.
[0079] Furthermore, the performance of DLLPS-CHA under different organic phases was monitored and analyzed by fluorescence kinetics. The specific steps are as follows:
[0080] (1) The dry powder of single-stranded nucleic acid was first centrifuged at 4 °C and 12,000 rpm for 5 min, then dissolved in TE buffer according to the recommended volume on the tube, mixed evenly using a Vortex mixer for 2 - 3 minutes, and finally centrifuged at 4 °C and 12,000 rpm for 5 min, and then heated at 95 °C for 5 min for denaturation to obtain a single-stranded nucleic acid solution.
[0081] (2) A LLPS system was prepared by fully mixing 1 mL of aqueous phase solution + 1 mL of organic phase solvent, and then 12.5 μL of each hairpin substrate composed of two single-stranded nucleic acids CHA-H1 and CHA-H2 (concentration of 100 nM) was added, mixed evenly (using a Vortex mixer, mixed evenly at 2800 rpm for 45 s), and finally 10 μL of the trigger strand CHA-input single-stranded with a concentration of 100 nM was added, and fluorescence kinetics monitoring was immediately started. The results show that during the DLLPS process, the fluorescence release amount in the isobutanol system is the highest, and the release rate is the fastest (7,663 a.u., T half = 0.056 min). The above results indicate that the organic phase solvent isobutanol has better water absorption and a faster DLLPS speed, thereby improving the overall efficiency of the amplification system ( Figure 4 ).
[0082] Example 3
[0083] Normal CHA: Add 12.5 μL each of the hairpin substrates composed of two nucleic acid single strands CHA-H1 and CHA-H2 (concentration: 100 nM) to 2 mL of the aqueous solution, mix well (using a Vortex mixer, mix at 2800 rpm for 45 s), and finally add 10 μL of the trigger strand CHA-input single strand with a concentration of 100 nM, and immediately start fluorescence kinetic monitoring.
[0084] According to the steps in Example 2, compare DLLPS-CHA with normal CHA. Fluorescence kinetic monitoring shows that after 10 seconds of DLLPS action, the CHA (FAM) signal almost reaches the plateau, while CHA without DLLPS takes 15 minutes to reach the plateau; then optimize the number of cycles. The results show that the fluorescence intensity of the reaction system is the highest when passing through 3 DLLPS cycles. The above results indicate that the DLLPS-CHA system has the strongest fluorescence signal at 3 DLLPS cycles, that is, 30 seconds ( Figure 5 ).
[0085] Example 4
[0086] Use the nucleic acid non-enzymatic amplification detection device based on biphasic liquid separation provided in Example 1 to conduct the following experiments:
[0087] (1) Prepare tCHA and isobutanol reagents: Mix 12.5 μL of nucleic acid single strand N Gene-C1-H1 (100 nM), 12.5 μL of nucleic acid single strand N Gene-C1-H2 (100 nM), 12.5 μL of nucleic acid single strand N Gene-C2-H1 (100 nM), 12.5 μL of nucleic acid single strand N Gene-C2-H2 (100 nM), 65 μL of TNaK buffer, and 1 mL of isobutanol to obtain tCHA and isobutanol reagents for detecting the N gene; Mix 12.5 μL of nucleic acid single strand O Gene-C1-H1 (100 nM), 12.5 μL of nucleic acid single strand O Gene-C1-H2 (100 nM), 12.5 μL of nucleic acid single strand O Gene-C2-H1 (100 nM), 12.5 μL of nucleic acid single strand O Gene-C2-H2 (100 nM), 65 μL of TNaK buffer, and 1 mL of isobutanol to obtain tCHA and isobutanol reagents for detecting the ORF1 gene. Then place the tCHA and isobutanol detection system with a total volume of 50 μL / well into the reaction well 12 of the microfluidic chip 2.
[0088] (2) Load 10 μL / well of RNA solutions of the COVID-19 infection marker N gene at different concentrations (100 aM to 1 nM) (i.e., N gene in Table 1, with TE buffer as the solvent) and the RNA solution of the ORF1 gene (i.e., ORF1 Gene in Table 1) into the sample loading wells 11 of the microfluidic chip 2. Then turn on the motor 1 for centrifugation and vibration (centrifuge at 4500 rpm for 5 s and vibrate at 250 rpm for 5 s). The solution is centrifuged into the reaction wells 12 and undergoes an amplification reaction by fully mixing with the tCHA and isobutanol reagents. The tCHA solution is dehydrated. Then turn on the 480 nm blue light-emitting diode (LED) illuminator to excite fluorescence, collect the fluorescence images using the built-in camera of the smartphone, arrange the obtained images in sequence, and analyze the fluorescence intensity through ImageJ software. The results show the available sensitivity and dynamic range of the N gene (LOD, 423 aM) and the ORF1 gene group (LOD, 414 aM). Figure 6 )
[0089] The above embodiments are preferred embodiments of the present invention. However, the embodiments of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.
Claims
1. A nucleic acid non-enzymatic amplification method based on biphasic separation, characterized in that It includes the following steps: amplifying a substrate and a sample to be detected through centrifugal vibration mixing to obtain a nucleic acid non-enzymatic amplification product; The amplification substrate is a system that can form a two-phase liquid separation and can perform a cascade CHA reaction.
2. The nucleic acid non-enzymatic amplification method based on biphasic separation according to claim 1, wherein: The system composition of the amplification substrate is as follows: two nucleic acid single strands C1-H1 and C1-H2 that form a DNA hairpin pair C1, two nucleic acid single strands C2-H1 and C2-H2 that form a DNA hairpin pair C2, a buffer solution, and an organic solvent; C1-H1 with a concentration of 100 nM, C1-H2 with a concentration of 100 nM, C2-H1 with a concentration of 100 nM, C2-H2 with a concentration of 100 nM, the buffer solution, and the organic solvent are proportioned by volume ratio of 12-13:12-13:12-13:12-13:60-70:1000; The buffer solution is a buffer solution that can perform a cascade CHA reaction; The organic solvent is an organic solvent with low solubility in water and in liquid form; The sample to be detected is RNA; The amplification substrate and the sample to be detected are proportioned by volume ratio of 4-6:
1.
3. The nucleic acid non-enzymatic amplification method based on two-phase liquid separation according to claim 2, characterized in that: The buffer solution is a TNaK buffer solution; The organic solvent is isobutanol; The nucleic acid single strand is a nucleic acid with the following sequence: N Gene-C1-H1: 5'-TGCGCGACA / i6FAMdT / TCCGAAGAGATGTACTAGGTCTTCGGAA / iBHQ1dT / GTCCATACTCAGTCAG-3'; N Gene-C1-H2: 5'-CGAAGACCTAGTACATCTCTTCGGAATGTGATGTACTAGG-3'; N Gene-C2-H1: 5'-CCA / i6FAMdT / ACTCAGTCAGGGATCATGTAGCTGACTGAGTA / iBHQ1dT / GGTAATTT-3'; N Gene-C2-H2: 5'-GGATCATGTAGCCATACTCAGTCAGCTACATGATCCCTGACTG-3'; O Gene-C1-H1: 5'-CTTCTG / i6FAMdT / AATTTTTAAACGATGTACTAGGGTTTAAAAAT / iBHQ1dT / ACCATACTCAGTCAG-3'; O Gene-C1-H2: 5'-TTAAACCCTAGTACATCGTTTAAAAATTAGATGTACTAGG-3'; O Gene-C2-H1: 5'-CCA / i6FAMdT / ACTCAGTCAGGGATCATGTAGCTGACTGAGTA / iBHQ1dT / GGACATTC-3'; O Gene-C2-H2: 5'-GGATCATGTAGCCATACTCAGTCAGCTACATGATCCCTGACTG-3’; The sample to be detected is at least one of the N gene and the ORF1 gene of the novel coronavirus.
4. A nucleic acid detection method, characterized in that It includes the following methods: (1) Qualitative analysis of the sample to be detected can be performed by fluorescence detection of the product obtained by the nucleic acid non-enzymatic amplification method based on biphasic liquid separation according to any one of claims 1 to 3. (2) Quantitative analysis of the sample to be detected can be performed by software analysis of the fluorescence detection intensity with reference to the standard curve.
5. A nucleic acid non-enzymatic amplification device based on double liquid phase separation, characterized in that: Designed based on the nucleic acid non-enzymatic amplification method based on biphasic liquid separation according to any one of claims 1 to 3, it includes a microfluidic chip, a groove for placing the microfluidic chip, and a motor for centrifugation and vibration connected to the groove; a sample addition hole and reaction holes communicating with the sample addition hole are provided on the microfluidic chip; the reaction holes are arranged around the sample addition hole.
6. The nucleic acid non-enzymatic amplification device based on biphasic liquid separation according to claim 5, wherein: The shape of the microfluidic chip is circular; The motor for centrifugation and vibration is a motor obtained by combining a centrifugal motor and a vibration motor; The nucleic acid non-enzymatic amplification device based on biphasic liquid separation further includes a power supply connected to the motor for centrifugation and vibration.
7. A nucleic acid non-enzymatic amplification detection device based on double liquid phase separation, characterized in that: It includes an amplification part, a detection part, and a housing; the amplification part is located inside the housing, and the detection part is located at the upper end of the housing; The amplification part includes a microfluidic chip, a groove for placing the microfluidic chip, and a motor for centrifugation and vibration connected to the groove; a sample addition hole and reaction holes communicating with the sample addition hole are provided on the microfluidic chip; the reaction holes are arranged around the sample addition hole; The detection part includes a light source for exciting fluorescence, a filter, a card slot for placing a fluorescence reading device, and a fluorescence reading device; a light transmission hole facing the filter is provided on the card slot for placing the fluorescence reading device; when in use, the light emitted by the light source for exciting fluorescence irradiates the microfluidic chip, and the fluorescence signal of the reaction holes of the microfluidic chip enters the fluorescence reading device placed in the card slot for placing the fluorescence reading device after being filtered by the filter.
8. The nucleic acid non-enzymatic amplification detection device based on double liquid phase separation according to claim 7, wherein: The light source for exciting fluorescence is a blue light source; The filter is a 520nm filter; The fluorescence reading device is a smart phone; The nucleic acid non-enzymatic amplification device based on biphasic liquid separation further includes a power supply A connected to the motor for centrifugation and vibration and a power supply B connected to the light source for exciting fluorescence, and the power supply A and the power supply B are the same power supply or different power supplies; The nucleic acid non-enzymatic amplification detection device based on biphasic liquid separation is further provided with a charging socket, and the charging socket is connected to the power supply.
9. A method for preparing the nucleic acid non-enzymatic amplification detection device based on dual liquid phase separation according to claim 7 or 8, characterized in that: The main frame and the microfluidic chip of the nucleic acid non-enzymatic amplification detection device according to claim 8 are 3D printed, and then the light source and the motor are installed.
10. Use of the nucleic acid non-enzymatic amplification detection device based on double liquid phase separation according to claim 7 or 8, characterized in that It includes the following steps: 1) Amplification reaction: Add the amplification substrate into the reaction wells of the microfluidic chip, add the sample to be detected into the sample loading well of the microfluidic chip, turn on the motor for centrifugation and vibration, centrifuge the sample to be detected from the sample loading well to the reaction wells by centrifugation, and then amplify the amplification reaction signal by vibrating to fully mix the amplification substrate and the sample to be detected; 2) Detection process: Turn on the light source for exciting fluorescence to excite the amplified product obtained in step 1) to emit fluorescence, then collect the fluorescence image through the fluorescence reading device and perform fluorescence analysis, so as to realize the analysis and detection of nucleic acids.