Instant tea compound capable of improving metabolism and resisting oxidation and preparation method of instant tea compound

Abstract

The invention discloses an instant tea compound capable of improving metabolism and resisting oxidation and a preparation method of the instant tea compound, and belongs to the technical field of health-care food. The invention discloses an instant tea compound capable of improving metabolism and resisting oxidation. The instant tea compound comprises white tea, black tea, epigallocatechin gallate (EGCG) and edible essence. The white tea and the black tea are fermented, extracted, concentrated and dried at the same time, and then are compounded with other raw materials, so that the prepared instant tea compound is beneficial to improving metabolism and improving the antioxidant effect of an organism.

Description

Technical Field

[0001] The present invention relates to the technical field of health foods, and more particularly to an instant tea complex for improving metabolism and antioxidation and a preparation method thereof. Background Art

[0002] Fresh leaves of white tea and black tea contain various active enzymes such as polyphenol oxidase, peroxidase, hydrolase, oxidoreductase, and lyase. Their activities directly affect the quality transformation and health care functions of tea. Among them, polyphenol oxidase has a relatively high activity and dominates the oxidation reaction of polyphenols during the withering process of tea. It is the core catalyst in the tea fermentation process and can promote the gradual transformation of tea polyphenols into active substances such as theaflavins, thearubigins, and tea brown pigments.

[0003] According to the WHO 2023 report, the proportion of overweight / obese people globally reaches 39% (about 2.3 billion), and among them, the number of patients with hyperlipidemia exceeds 500 million; the prevalence of dyslipidemia in Chinese adults is as high as 40.4% (Report on Cardiovascular Health and Diseases in China 2022).

[0004] Research shows that the inhibition of telomerase activity is closely related to metabolic disorders (such as obesity and hyperlipidemia). Activating telomerase can improve cellular energy metabolism and delay aging. Traditional instant teas (such as black tea instant powder and green tea extract) mainly rely on the active ingredients of a single tea type (such as tea polyphenols and theaflavins), such as the black tea powder and oolong tea powder mentioned in CN202210426216.9 and CN202311032944.2, lacking the ability of multi-target synergistic anti-aging and metabolic regulation, especially having limited effects on enhancing telomerase activity and improving metabolic syndrome (such as insulin resistance and hyperlipidemia). EGCG can regulate glucose and lipid metabolism by activating the AMPK pathway, but its natural stability is poor and it is easily decomposed during high-temperature processing. Existing processes (such as spray drying and high-temperature sterilization) result in a reduction in bioavailability by more than 30%. For example, the spray drying technology used for the black tea instant powder mentioned in CN202210426216.9 causes the inactivation of effective ingredients such as EGCG, theaflavins, and thearubigins at high temperatures, reducing the content of effective ingredients in the product. In addition, the synergistic effect of theaflavins in black tea and the high-content polyphenols in white tea can enhance the antioxidant efficiency, but there is no technology to combine and ferment the two and strengthen the function of EGCG.

[0005] Therefore, providing an instant tea complex for improving metabolism and antioxidation and a preparation method thereof is an urgent problem to be solved by those skilled in the art. Summary of the Invention

[0006] In view of this, the present invention provides an instant tea complex for improving metabolism and antioxidation and a preparation method thereof, which has the characteristics of multiple components, multiple targets, and high content of effective ingredients, and can effectively improve the body's metabolism and enhance the antioxidant ability.

[0007] To achieve the above object, the present invention adopts the following technical solutions:

[0008] An instant tea complex for improving metabolism and antioxidation, comprising the following raw materials in parts by weight:

[0009] 30-50 parts of white tea, 30-50 parts of black tea, 2-4 parts of epigallocatechin gallate, and 0-2 parts of edible essence.

[0010] Furthermore, a preparation method of the instant tea complex for improving metabolism and antioxidation comprises the following steps:

[0011] (1) According to the parts by weight, mix fresh white tea and black tea and evenly spread them on a fermentation tray;

[0012] (2) Fermentation conditions: Control the temperature in the fermentation chamber at 25-35°C, keep the humidity at 85-95%, ferment for 4-8 hours, keep the room ventilated to ensure the supply of oxygen, and let it ferment naturally;

[0013] (3) After fermentation, place the raw materials in an extraction tank, extract them twice at low temperature, add 20-30 times the mass of pure water each time, combine the two extraction liquids, perform membrane filtration, vacuum freeze concentration until the solid content ≥ 30%, and dry to obtain a compound tea powder; The low-temperature extraction adopts a low-temperature multi-stage extraction process, specifically as follows:

[0014] The first stage: Ultrasonic-assisted extraction at 40-50°C for 10-20 minutes to extract small molecule polyphenols;

[0015] The second stage: Under the condition of 55°C, add 2400 U of hydrolysis complex enzyme per kilogram of tea leaves and enzymolyze for 55-65 minutes to release bound components;

[0016] The enzyme activity of the hydrolysis complex enzyme is 100,000 U / g, and the mass ratio of cellulase to pectinase is 1:1;

[0017] (4) Weigh EGCG according to the parts by weight, perform low-temperature gradient mixing to avoid its degradation at high temperature, and the specific operation is as follows:

[0018] Stage 1: Mix 50% of EGCG with the compound tea powder at 40°C and a humidity ≤ 10% and stir slowly for 10 minutes;

[0019] Stage 2: Lower the temperature to 30°C, add 30% of EGCG, and stir slowly for 10 minutes in an environment with a humidity ≤ 10%;

[0020] Stage 3 (final mixing): Lower the temperature to 25°C, add the remaining 20% of EGCG and edible essence, and stir and mix slowly for 15 minutes in an environment with a humidity ≤ 10%.

[0021] Further, the low-speed stirring speed described in step (4) is 200 rpm.

[0022] Further, the application of the instant tea complex in the preparation of antioxidant products.

[0023] Further, the application of the instant tea complex in the preparation of products for enhancing telomerase activity.

[0024] As can be seen from the above technical solutions, compared with the prior art, the present invention discloses an instant tea complex for improving metabolism and antioxidation and its preparation method. Through the natural fermentation of two kinds of tea leaves, the content of effective components such as theaflavins and theabrownins in the product is increased. Through the EGCG gradient stabilization technology, EGCG is added in gradients for targeted supplementation to make up for the losses during the processing, comprehensively improving the content of the effective components in the product, enhancing the antioxidation effect of the product and improving the metabolic effect. Description of the Drawings

[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only the embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained according to the provided drawings.

[0026] Figure 1 It is a graph of the content of effective components of Examples 1-5 and Comparative Examples 1-3.

[0027] Figure 2 It is a representative graph of the antioxidant efficacy of the blank control group.

[0028] Figure 3 It is a representative graph of the antioxidant efficacy of the positive control group.

[0029] Figure 4 It is a representative graph of the antioxidant efficacy of Example 1.

[0030] Figure 5 It is a representative graph of the antioxidant efficacy of Example 2.

[0031] Figure 6 It is a representative graph of the antioxidant efficacy of Example 3.

[0032] Figure 7 It is a representative graph of the antioxidant efficacy of Example 4.

[0033] Figure 8 It is a representative graph of the antioxidant efficacy of Example 5.

[0034] Figure 9 It is a representative graph of the antioxidant efficacy of Comparative Example 1.

[0035] Figure 10 It is the representative diagram of the antioxidant effect of Comparative Example 2.

[0036] Figure 11 It is the representative diagram of the antioxidant effect of Comparative Example 3. Detailed implementation manners

[0037] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0038] The white tea used in the embodiments of the present invention is purchased from the local wholesale market in Anji; the black tea is purchased from the local wholesale market in Wuyishan; epigallocatechin gallate is purchased from Chengdu Huagao Biological Products Co., Ltd.; the edible essence is purchased from Hangzhou Bairui Flavor & Fragrance Co., Ltd.; the hydrolytic complex enzyme (cellulase + pectinase) is purchased from Shandong Longkete Enzyme Preparation Co., Ltd., the enzyme activity of the hydrolytic complex enzyme is 100,000 U / g, and the mass ratio of cellulase to pectinase is 1:1.

[0039] Example 1

[0040] A preparation method of an instant tea complex for improving metabolism and antioxidant function, comprising the following steps:

[0041] (1) According to the weight parts, take 30 parts each of fresh white tea and black tea, mix them evenly and spread them out on the fermentation tray, control the temperature of the fermentation chamber at 30 °C, keep the humidity at 90%, and ferment for 6 h. After the fermentation is completed, place the raw materials in the extraction tank, add 25 times the mass multiple of pure water, perform ultrasonic-assisted extraction at 45 °C for 15 min, raise the temperature to 55 °C, add 2400 U of hydrolytic complex enzyme per kilogram of tea leaves and enzymolyze for 60 min, extract twice, combine the two extraction liquids, perform membrane filtration, vacuum freeze concentration until the solid content ≥ 30%, and dry to obtain the compound tea powder.

[0042] (2) Weigh 3 parts of EGCG according to the weight parts, perform low-temperature gradient mixing to avoid its degradation at high temperature. The specific operations are as follows:

[0043] Stage 1: Mix 50% of EGCG with the compound tea powder at 40 °C and humidity ≤ 10% and stir at low speed (200 rpm) for 10 minutes;

[0044] Stage 2: Lower the temperature to 30 °C, add 30% of EGCG, and stir at low speed (200 rpm) for 10 minutes in an environment with humidity ≤ 10%;

[0045] Stage III (Final Mixing): When the temperature drops to 25°C, add the remaining 20% EGCG and 1 part of edible essence, and mix at low speed (200 rpm) for 15 minutes in an environment with humidity ≤ 10%.

[0046] Example 2

[0047] A preparation method of an instant tea complex for improving metabolism and antioxidant properties, comprising the following steps:

[0048] (1) According to the parts by weight, take 40 parts each of fresh white tea and black tea, mix them evenly and spread them out on the fermentation tray, control the temperature of the fermentation chamber at 25°C, keep the humidity at 85%, and ferment for 4 h. After the fermentation is completed, place the raw materials in the extraction tank, add 20 times the mass multiple of pure water, perform ultrasonic-assisted extraction at 40°C for 10 min, raise the temperature to 55°C, add 2400 U of hydrolysis complex enzyme per kilogram of tea leaves and enzymolyze for 55 min, extract twice, combine the two extraction liquids, perform membrane filtration, vacuum freeze concentration until the solid content ≥ 30%, and dry to obtain the compound tea powder.

[0049] (2) Weigh 2 parts of EGCG according to the parts by weight, perform low-temperature gradient mixing to avoid its high-temperature degradation, and the specific operation is as follows:

[0050] Stage I: Mix 50% EGCG and the compound tea powder at low speed (200 rpm) for 10 minutes in an environment at 40°C and humidity ≤ 10%;

[0051] Stage II: Lower the temperature to 30°C, add 30% EGCG, and mix at low speed (200 rpm) for 10 minutes in an environment with humidity ≤ 10%;

[0052] Stage III (Final Mixing): When the temperature drops to 25°C, add the remaining 20% EGCG and 1 part of edible essence, and mix at low speed (200 rpm) for 15 minutes in an environment with humidity ≤ 10%.

[0053] Example 3

[0054] A preparation method of an instant tea complex for improving metabolism and antioxidant properties, comprising the following steps:

[0055] (1) According to the parts by weight, take 50 parts each of fresh white tea and black tea, mix them evenly and spread them out on the fermentation tray, control the temperature of the fermentation chamber at 35°C, keep the humidity at 95%, and ferment for 8 h. After the fermentation is completed, place the raw materials in the extraction tank, add 30 times the mass multiple of pure water, perform ultrasonic-assisted extraction at 50°C for 20 min, raise the temperature to 55°C, add 2400 U of hydrolysis complex enzyme per kilogram of tea leaves and enzymolyze for 65 min, extract twice, combine the two extraction liquids, perform membrane filtration, vacuum freeze concentration until the solid content ≥ 30%, and dry to obtain the compound tea powder.

[0056] (2) Weigh 4 parts of EGCG by weight, and perform low-temperature gradient mixing to avoid its degradation at high temperatures. The specific operation is as follows:

[0057] Phase 1: Mix 50% of EGCG with the compound tea powder at 40°C and a humidity ≤ 10% environment with low-speed stirring (200 rpm) for 10 minutes;

[0058] Phase 2: Lower the temperature to 30°C, add 30% of EGCG, and perform low-speed stirring (200 rpm) for 10 minutes in an environment with a humidity ≤ 10%;

[0059] Phase 3 (final mixing): Lower the temperature to 25°C, add the remaining 20% of EGCG and 2 parts of edible essence, and perform low-speed stirring (200 rpm) and mixing for 15 minutes in an environment with a humidity ≤ 10%.

[0060] Example 4

[0061] A method for preparing an instant tea complex for improving metabolism and antioxidation, comprising the following steps:

[0062] (1) According to the weight parts, take 40 parts each of fresh white tea and black tea, mix them evenly and then spread them out evenly in the fermentation tray. Control the temperature of the fermentation chamber at 30°C and the humidity at 90%, and ferment for 6 hours. After the fermentation is completed, place the raw materials in the extraction tank, add 25 times the mass multiple of pure water, perform ultrasonic-assisted extraction at 45°C for 15 minutes, raise the temperature to 55°C, add 2400 U of hydrolytic complex enzyme per kilogram of tea leaves and enzymolyze for 60 minutes, extract twice, combine the two extraction liquids, then perform membrane filtration and vacuum freeze concentration until the solid content ≥ 30%, and dry to obtain the compound tea powder.

[0063] (2) Weigh 3 parts of EGCG by weight, and perform low-temperature gradient mixing to avoid its degradation at high temperatures. The specific operation is as follows:

[0064] Phase 1: Mix 50% of EGCG with the compound tea powder at 40°C and a humidity ≤ 10% environment with low-speed stirring (200 rpm) for 10 minutes;

[0065] Phase 2: Lower the temperature to 30°C, add 30% of EGCG, and perform low-speed stirring (200 rpm) for 10 minutes in an environment with a humidity ≤ 10%;

[0066] Phase 3 (final mixing): Lower the temperature to 25°C, add the remaining 20% of EGCG, and perform low-speed stirring (200 rpm) and mixing for 15 minutes in an environment with a humidity ≤ 10%.

[0067] Example 5

[0068] A method for preparing an instant tea complex for improving metabolism and antioxidation, comprising the following steps:

[0069] (1) According to the weight parts, take 50 parts each of fresh white tea and black tea, mix them evenly and then spread them out evenly in the fermentation tray. Control the temperature of the fermentation chamber at 30 °C and the humidity at 90%, and ferment for 6 h. After fermentation, place the raw materials in the extraction tank, add 25 times the mass multiple of pure water, carry out ultrasonic-assisted extraction at 45 °C for 15 min, raise the temperature to 55 °C, add 2400 U of hydrolysis complex enzyme per kilogram of tea leaves and enzymolyze for 60 min, extract twice, combine the two extraction liquids, then carry out membrane filtration and vacuum freeze concentration until the solid content ≥ 30%, and dry to obtain the compound tea powder.

[0070] (2) Weigh 3 parts of EGCG according to the weight parts, carry out low-temperature gradient mixing to avoid its high-temperature degradation. The specific operation is as follows:

[0071] Stage 1: Mix 50% of EGCG with the compound tea powder at 40 °C and a humidity ≤ 10% environment with low-speed stirring (200 rpm) for 10 minutes;

[0072] Stage 2: Lower the temperature to 30 °C, add 30% of EGCG, and carry out low-speed stirring (200 rpm) for 10 minutes in an environment with a humidity ≤ 10%;

[0073] Stage 3 (final mixing): Lower the temperature to 25 °C, add the remaining 20% of EGCG and 1 part of edible essence, and carry out low-speed stirring (200 rpm) and mixing for 15 minutes in an environment with a humidity ≤ 10%.

[0074] The difference between Comparative Example 1 and Example 1 is that 60 parts of fresh white tea are weighed and the white tea is fermented alone.

[0075] The difference between Comparative Example 2 and Example 1 is that 60 parts of fresh black tea are weighed and the black tea is fermented alone.

[0076] The difference between Comparative Example 3 and Example 1 is that epigallocatechin gallate is not added.

[0077] In order to determine the component differences of the instant tea complexes prepared in Examples 1-5 and Comparative Examples 1-3, the content of theaflavins, theabrownins and thearubigins is used as an index for detection.

[0078] (1) Test method:

[0079] The determination of theaflavin content adopts GB / T 30483 "Determination of theaflavins in tea - High performance liquid chromatography method".

[0080] The determination of thearubigin and theabrownin contents adopts NY / T 3675 "Determination of thearubigin and theabrownin contents in black tea - Spectrophotometer method".

[0081] (2) Test results

[0082] From Figure 1It can be seen that the active ingredients in Examples 1-5 are significantly higher than those in Comparative Example 1 and Comparative Example 2. This may be because the initial polyphenol content in fresh white tea is relatively high. When the two kinds of tea are fermented simultaneously, the oxidation pathway may be more complex, which can promote the generation and transformation of active ingredients with each other, resulting in the generation of more active ingredients. In addition, white tea contains more unoxidized flavonoids (such as quercetin), which may participate in oxidative condensation reactions during deep fermentation, supplementing the formation pathway of thearubigins. The fermentation of black tea is more dependent on the enzymatic oxidation system of catechins. The differences in the material bases of the two may lead to different final pigment types and proportions.

[0083] I. Efficacy verification and evaluation

[0084] 1. Contributing to antioxidant

[0085] In order to further verify the excellent effects of the instant tea complex of the present invention compared with the prior art, the inventors also studied the scavenging test of reactive oxygen species (ROS) in zebrafish embryos by the instant tea complex of the present invention to verify the antioxidant efficacy of the instant tea complex of the present invention. The specific method is as follows:

[0086] The wild-type AB strain zebrafish (Danio rerio) spawning test from a reliable source (such as the Chinese National Zebrafish Resource Center) was applied. The parent fish should have good reproductive ability, and the fish age is preferably 6-12 months. Before the reproductive spawning test, the parent fish should be domesticated for more than 14 days after being introduced into the laboratory.

[0087] Healthy zebrafish embryos were selected and cultured at a density of no more than 1 fish embryo in 200 μL of fish embryo culture medium at 28°C ± 1°C until 2 days after fertilization. 240 healthy zebrafish embryos 2 days after fertilization were selected into a 96-well plate, with one fish embryo and 0.2 ml of the corresponding solution in each well, and placed in an incubator at 28°C ± 1°C until 72 h ± 1 h after fertilization. They were transferred to a 24-well plate, with 12 fish embryos and 2 ml of reactive oxygen species (ROS) working solution in each well, and then placed in an incubator at 28°C ± 1°C for 2 h ± 1 h. Then, the fish embryos were placed on their sides and photographed under a fluorescence stereomicroscope according to the unified photographing parameters ( Figures 2 - 11 ), and finally, data and results were calculated using Image J software. The specific grouping and corresponding solution doses are as follows:

[0088] A: Blank control group, fish embryo culture medium;

[0089] B: Positive control group, glutathione working solution;

[0090] C: Taking the sample of Example 1 as the test sample, the test concentration is 0.43 g / L;

[0091] D: Taking the sample of Example 2 as the test sample, the test concentration is 0.43 g / L;

[0092] E: Use the sample of Example 3 as the test sample, and the test concentration is 0.43 g / L.

[0093] F: Use the sample of Example 4 as the test sample, and the test concentration is 0.43 g / L.

[0094] G: Use the sample of Example 5 as the test sample, and the test concentration is 0.43 g / L.

[0095] H: Use the sample of Comparative Example 1 as the test sample, and the test concentration is 0.43 g / L.

[0096] I: Use the sample of Comparative Example 2 as the test sample, and the test concentration is 0.43 g / L.

[0097] J: Use the sample of Comparative Example 3 as the test sample, and the test concentration is 0.43 g / L.

[0098] Among them, the fish embryo culture solution is prepared as follows: Weigh 2940 mg of anhydrous calcium chloride, 1233 mg of magnesium sulfate heptahydrate, 630 mg of sodium bicarbonate, and 55 mg of potassium chloride, and dissolve them in 10 L of water. The pH value is 6.5 - 8.5, and all chemicals are of analytical pure grade.

[0099] The glutathione solution is prepared as follows: Weigh 1 g of glutathione powder and dissolve it in 10 mL of water to prepare a 100 g / L stock solution. Divide it into small aliquots and store them in the refrigerator. It is valid within 3 months. The working solution is diluted from the stock solution to 0.1 g / L with the fish embryo culture solution and freshly prepared before use.

[0100] The reactive oxygen species (ROS) staining solution is prepared as follows: Weigh 100 mg of H2DCFDA and dissolve it in 10 mL of dimethyl sulfoxide to prepare a stock solution. Aliquot 1 mL into brown glass vials and store them frozen. It is valid within 3 years. The working solution is diluted 20 - fold from the stock solution with the fish embryo culture solution and freshly prepared before use.

[0101] 1.1 Effects on reactive oxygen species (ROS) in zebrafish embryos

[0102] Reactive oxygen species (ROS) in living cells can oxidize proteins, nucleic acids, lipids or other molecules, and change the expression of downstream genes through the Keap1-Nrf2 signal in physiological and pathological diseases, thereby reducing immunity, damaging cells, and even inducing cardiovascular diseases, etc. As shown in Table 1, compared with Group B, the ROS clearance rates of Groups C-G and J were significantly increased (P < 0.05). Among them, the ROS clearance rate of Group F was the highest, reaching 36.00%; the influence of Groups H-I on the ROS clearance rate was not significant (P > 0.05). Compared with Groups H-I, the ROS clearance rates of Groups C-G were significantly increased (P < 0.05). Among them, the ROS clearance rate of Group H was the lowest, at 24.22%. Compared with Groups H and I, the antioxidant activity of Group J was also significantly increased (P < 0.05), which may be related to the co-fermentation of the two kinds of tea. It shows that the instant tea complex of the present invention has good antioxidant properties. It may be because after the two kinds of tea are fermented simultaneously, more effective components such as theaflavins, theabrownins and thearubigins are produced, improving the antioxidant ability of the product.

[0103] Table 1 Effects on reactive oxygen species (ROS) in zebrafish embryos

[0104]

[0105] Note: Different superscript letters in the same column indicate significant differences between different groups (P < 0.05), and the same letter indicates no significant difference between different groups (P > 0.05).

[0106] 2. Contribute to enhancing telomerase activity

[0107] In order to further verify the excellent effects of the instant tea complex of the present invention compared with the prior art, the inventors also studied the promotion test of the instant tea complex of the present invention on the telomerase activity of zebrafish to verify the role of the instant tea complex of the present invention in enhancing telomerase activity. The specific method is as follows:

[0108] Q-TRAP kit: TB Green Premix Ex Taq (Takara; Cat no. RR420A) was purchased from Wuhan Kehaojia Biotechnology Co., Ltd.

[0109] Q-TRAP primer sequences:

[0110] Forward primer: GCGCGGCTTACCCTTACCCTTACCCTAACC; SEQ ID NO.1;

[0111] Reverse primer: AATCCGTCGAGCAGAGTT; SEQ ID NO.2.

[0112] Perform spawning tests on wild-type AB strain zebrafish (Danio rerio) sourced from reliable sources (such as the Chinese National Zebrafish Resource Center). The parent fish should have good reproductive ability - the optimal fish age is 6 to 12 months. Backcrossing is preferably used for propagation to maintain genetic diversity. After 5 generations of breeding with pure strain parent fish, a new batch of parent fish needs to be replaced. The parent fish should not have obvious visible infection and disease characteristics and should not have undergone drug treatment within 2 months. Before the spawning test, the parent fish should be acclimated in the laboratory for more than 14 days.

[0113] Randomly select 360 healthy zebrafish at 96 ± 1 h post-fertilization, evenly distribute them into 24-well plates, with 12 zebrafish and 2.4 mL of the corresponding solution in each well. Incubate them in an incubator at 28 ± 1 °C until 8 days post-fertilization. Collect each group of zebrafish in a 10 ml petri dish, rinse them with phosphate-buffered saline (PBS) solution and transfer them to a 1.5 mL centrifuge tube. Place it in an ice bath to remove the PBS solution, add 70 μL of Q-TRAP NP-40 lysis buffer containing 1x complete protease inhibitor (purchased from Roche). Homogenize the zebrafish with a pellet pestle and place it in an ice bath for 30 min. Centrifuge at 15000 rpm for 20 min at 4 °C, take 50 μL of the supernatant into a 1.5 mL centrifuge tube, add 100 μL of RNase / DNase-free ultrapure distilled water, and store frozen. Use a BCA protein assay kit (23227; Thermo Scientific,) to determine the total protein content of each group.

[0114] Prepare a reference standard (HeLa cells as the reference standard) and make a standard dose curve with a 1:5 dilution series. Prepare the primer mixture and Q-TRAP reaction mixture according to the Q-TRAP kit. Dilute the samples 10-fold with RNase / DNase-free ultrapure distilled water. Add 9 μL of the Q-TRAP reaction mixture and 1 μL of the diluted protein sample to each PCR well. Seal the PCR well plate with an optical adhesive film and centrifuge at 1000 rpm for 5 min at 4 °C. After incubating in the dark at 30 °C for 30 min, perform Q-TRAP amplification. Collect the Q-TRAP data. Use Ct as the amplification result, plot the standard dose-response curve between the average Ct value of HeLa cells and the log10 protein concentration and check if R 2 is > 0.90, and calculate the relative telomerase activity of each group as the test result.

[0115] There are 3 parallels in each group. The specific grouping and the corresponding solution doses are as follows:

[0116] A: Blank control group, fish embryo culture medium;

[0117] B: Positive control group, 0.1% Rehmannia glutinosa solution;

[0118] C: Use the sample from Example 1 as the test sample, with a test concentration of 0.64 g / L;

[0119] D: Use the sample from Example 2 as the test sample, with a test concentration of 0.64 g / L;

[0120] E: Use the sample from Example 3 as the test sample, with a test concentration of 0.64 g / L;

[0121] F: Use the sample from Example 4 as the test sample, with a test concentration of 0.64 g / L;

[0122] G: Use the sample from Example 5 as the test sample, with a test concentration of 0.64 g / L;

[0123] H: Use the sample from Comparative Example 1 as the test sample, with a test concentration of 0.64 g / L;

[0124] I: Use the sample from Comparative Example 2 as the test sample, with a test concentration of 0.64 g / L;

[0125] J: Use the sample from Comparative Example 3 as the test sample, with a test concentration of 0.64 g / L;

[0126] 2.1 Effects on the telomerase activity of zebrafish

[0127] Telomerase is a reverse transcriptase that can compensate for the reduced telomere length by synthesizing new DNA sequences on telomeres during cell division. As people age, the vast majority of cells in human tissues experience telomere shortening and a decline in telomerase activity, leading to the process of aging. As shown in Table 2, compared with Group B, the promotion rates of telomerase activity in Groups C-G and J were significantly increased (P < 0.05), and the promotion rate of telomerase activity in Group F reached 88.00%; the effects of Groups H-I on telomerase activity were not significant (P > 0.05). It shows that the instant tea complex of the present invention has the effect of promoting telomerase activity. It may be because the co-fermentation of the two kinds of tea can produce more active ingredients, and the caffeine contained in this product can activate the expression of telomerase, thus promoting the activity of telomerase. In addition, it may also be because the antioxidant substances such as theaflavins and theabrownins contained can scavenge free radicals and avoid oxidative damage to telomeric DNA.

[0128] Table 2 Effects on the telomerase activity of zebrafish

[0129]

[0130]

[0131] Note: Different superscript letters in the same column indicate significant differences between different groups (P < 0.05), and the same letter indicates no significant difference between different groups (P > 0.05).

[0132] The foregoing description of the disclosed embodiments enables those skilled in the art to practice or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. An instant tea complex for improving metabolism and antioxidation, characterized in that, Comprising the following raw materials in parts by weight: 30 - 50 parts of white tea, 30 - 50 parts of black tea, 2 - 4 parts of epigallocatechin gallate, 0 - 2 parts of edible essence.

2. The preparation method of an instant tea complex for improving metabolism and antioxidation according to claim 1, characterized in that, Comprising the following steps: (1) According to the parts by weight, mix fresh white tea and black tea and evenly spread them into a fermentation tray; (2) Fermentation conditions: control the temperature of the fermentation chamber at 25 - 35°C, keep the humidity at 85 - 95%, ferment for 4 - 8 h, and keep the room ventilated; (3) After fermentation, place the raw materials in an extraction tank, extract twice at low temperature, add 20 - 30 times the mass of pure water each time, combine the two extraction liquids, then perform membrane filtration and vacuum freeze - concentration until the solid content ≥ 30%, and dry to obtain a compound tea powder; the low - temperature extraction adopts a low - temperature multi - stage extraction process, specifically as follows: The first stage: ultrasonic - assisted extraction at 40 - 50°C for 10 - 20 min; The second stage: under the condition of 55°C, add 2400 U of hydrolysis complex enzyme per kilogram of tea leaves and enzymolyze for 55 - 65 min; The enzyme activity of the hydrolysis complex enzyme is 100,000 U / g, and the mass ratio of cellulase to pectinase is 1:1; (4) Weigh EGCG according to the parts by weight and perform low - temperature gradient mixing, and the specific operation is as follows: Stage 1: Mix 50% of EGCG and the compound tea powder at 40°C and a humidity ≤ 10% and stir at a low speed for 10 minutes; Stage 2: Lower the temperature to 30°C, add 30% of EGCG, and stir at a low speed for 10 minutes in an environment with a humidity ≤ 10%; Stage 3: Lower the temperature to 25°C, add the remaining 20% of EGCG and the edible essence, and stir and mix at a low speed for 15 minutes in an environment with a humidity ≤ 10%.

3. The preparation method of an instant tea complex for improving metabolism and antioxidation according to claim 2, characterized in that, The low - speed stirring speed in step (4) is 200 rpm.

4. Use of the instant tea complex according to claim 1 in the preparation of antioxidant products.

5. Use of the instant tea complex according to claim 1 in the preparation of products for enhancing telomerase activity.

Images