Preparation method and application of bionic tabasheer

Abstract

The invention provides a preparation method of bionic tabasheer, which comprises the following steps: analyzing strains which are produced in Guangdong and naturally formed tabasheer, according to the formation principle of natural tabasheer, artificially cutting stems of bambusa bambusae or bambusa huissimilis to flow out bleeding sap, and inoculating the strains to wounds, namely carrying out bionic fermentation culture by taking the bleeding sap as a culture medium to obtain the bionic tabasheer. A compound of specific fungi and fermentation conversion products thereof is obtained, and the compound is the bionic tabasheer. The inoculated strain comprises ascomycophylum hypocrea tabasheer fungus and / or ascomycophylum petiohilum fungus and / or ascomycophylum arthrosporidium fungus and / or deuterophylum nodules fusarium fungus. The bionic tabasheer disclosed by the invention is used for resisting exogenous febrile convulsion, expectoration, lung injury, coma, epilepsy, stroke, fatty liver and hyperlipidemia in forms of decoction pieces, formula granule decoction pieces extracted from the bionic tabasheer, ultramicro wall-broken decoction pieces and the like.

Description

Technical Field

[0001] The present invention relates to the field of preparation of traditional Chinese medicine raw materials, and in particular to a preparation method and application of bionic baicalensis. Background Art

[0002] In clinical applications, Radix Glehniae is highly favored by doctors due to its significant efficacy, and its demand is increasing. However, Radix Glehniae resources are very scarce.

[0003] It is generally believed that natural dahlia is a species of grass plant, bamboo shoots. Bamboo textile McClure or Huasilao bamboo Schizostachyum Chinese Rendle is a lump of dried secretion from the bamboo stems. The process of its formation is that after bamboo wasps bite holes in the bamboo, bleeding fluid is formed inside the bamboo. The bleeding fluid accumulates in the bamboo and is continuously enriched over a long period of time.

[0004] Most of the jasmine currently available on the market is made by burning bamboo forests, then collecting the distillate from the cracked bamboo stalks and solidifying it for use as jasmine. This product deviates from the natural jasmine, and its effectiveness as a substitute is controversial.

[0005] Chinese invention CN 111375024 B discloses a method for preparing Tianzhuhuang. However, the theoretical basis for this method is that Tianzhuhuang is formed from the bleeding fluid of infected green bamboo or Chinese bamboo after being injured. Therefore, the invention uses yeast and a combination of bacteria from three types of fungi to infect fresh bamboo after being perforated, causing the bamboo to be infected and secrete more bleeding fluid. The purpose is also to enrich the bleeding fluid, which constitutes the main substance component of the Tianzhuhuang obtained in this invention.

[0006] The present invention, however, is based on a different theoretical foundation. It posits that after bamboo wasps bore holes into the bamboo, the bleeding fluid exudates from the bamboo, forming a natural culture medium and a nutrient environment for the growth of specific fungi. The specific fungi and the fermentation products of the bleeding fluid under the action of the fungi are the primary components of natural basil. In other words, its formation is essentially an in vivo fermentation process using bamboo bleeding fluid as the culture medium, forming a complex of fermentation products and the specific fungi. However, current existing technologies clearly cannot achieve this process.

[0007] In view of this, the present invention is proposed. Summary of the Invention

[0008] The purpose of the present invention is to overcome the above-mentioned defects and deficiencies in the prior art and to provide a method for preparing bionic baicalensis.

[0009] The second object of the present invention is to provide bionic jasmine prepared by the preparation method.

[0010] The third object of the present invention is to provide the application of the bionic dahlia.

[0011] The above-mentioned object of the present invention is achieved through the following technical solutions: A method for preparing bionic jasmine, comprising inoculating a wound of fresh green-skinned bamboo or Chinese bamboo with fungi isolated from naturally occurring jasmine produced in Guangdong or commercially available strains, and using bamboo wound fluid as a culture medium for bionic in vivo fermentation culture to obtain a complex of the fungi and its fermentation conversion product, namely, bionic jasmine (defined as broad jasmine); the inoculated strains at least include the genus Bamboo Flavor Fungi of the order Hypocreales of the phylum Ascomycota ( Shiraia ) and / or the ascomycete Polytrichomonas spp. ( Pestalotiopsis ) and / or Ascomycetes of the genus Chromospora ( Apiospora / Early genus name Arthrinium ) and / or Fusarium genus of the order Aspergillusales of the subphylum Deuteromycetes ( Fusarium ) fungi.

[0012] Based on the above theory, the present invention innovatively isolated a specific fungus from the naturally occurring dahlia produced in Guangdong, deeply analyzed the species composition of the naturally occurring dahlia, and then inoculated the species or commercially available species on green bamboo or Huasilao bamboo for in vivo fermentation, cultivating a bionic dahlia with a complex of fungi and transformation products as the main components. Specifically, according to the formation principle of natural dahlia, the present invention uses biomimetic technology to simulate the formation principle of natural dahlia, and implants the genus Bamboo Flavor Fungus (of the genus Bamboo Flavor Fungus, order Hypocreales, order Ascomycota, order Hypocreales, order Ascomycota, order Hypocrea ... Shiraia ) and / or the ascomycete Polytrichomonas spp. ( Pestalotiopsis ) and / or Ascomycetes of the genus Chromospora ( Apiospora / Early genus name Arthrinium ) and / or Fusarium genus of the order Fusariumales of the subphylum Deuteromycetes ( Fusarium ) as the main component, or by inoculating the aforementioned commercially available fungal species into fresh wounds of green-barked bamboo or Chinese bamboo, and fermenting in vivo using bamboo wound fluid as a culture medium. The resulting substance, primarily composed of a complex of fungi and their fermentation products, is biomimetic baicalensis. This biomimetic baicalensis resembles the formation state of natural baicalensis, boasts high yield, and is easy to process, resolving the challenges of scarce natural baicalensis resources and unreliable efficacy.

[0013] Furthermore, the preparation method comprises the following steps: S1. Drill holes in fresh bamboo stems of bamboo from the bamboo plant Qingpi or Huasilao to the size of holes naturally infested by bamboo wasps. S2. The implant concentration in the hole is 10 2 ~10 10 CFU / mL includes at least the genus Bambooxanthophytes of the order Hypocreales of the phylum Ascomycota ( Shiraia ) and / or the ascomycete Polytrichomonas spp. ( Pestalotiopsis) and / or Ascomycetes of the genus Chromospora ( Apiospora / Early genus name Arthrinium ) and / or Fusarium genus of the order Fusariumales of the subphylum Deuteromycetes ( Fusarium ) fungi, the injection volume is 1mL~10mL / incision, and the number of inoculations is 1~5 times; S3. After the fungal complex (containing fungi and their fermentation products) grows, collect and dry it to obtain the bionic jasmine (Guang jasmine).

[0014] Furthermore, the diameter of the punched hole is 0.8 to 2.5 mm, and the location of the punched hole is in the middle of the bamboo node, which can ensure that the normal growth of the bamboo is not affected, and is consistent with the formation conditions of natural jasmine, constituting bionic generation conditions.

[0015] Furthermore, the inoculation concentration is 300 to 3000 CFU / mL.

[0016] Furthermore, after inoculation, a culture medium that is conducive to bacterial colonization is added, such as gelatin, agar, honey, or agar-agar extract.

[0017] Furthermore, the fungus of the genus Bambusa is Shiraia bambusicola Henn., Polytrichomoniasis fungi are Pestalotiopsis clavata , the chromosporous fungus of the genus Arthrospira is Apiospora reed and Apiospora Guiyang Fusarium fungi are Fusarium sporotrichioides The combination of the above strains can make the wound fluid flow out continuously, providing a nutritional environment that is conducive to the growth of fungi, such as Apiospora reed It has the function of decomposing cellulose, and at the same time, the mixed bacteria can ferment and transform the components of the bleeding fluid.

[0018] Furthermore, the Shiraia bambusicola Henn.、 Pestalotiopsis clavata 、 Apiospora reed 、 Apiospora guiyangensis and Fusarium sporotrichioides The ratio is any combination of ratios.

[0019] The present invention also provides bionic jasmine (Ganjasmine) prepared by any of the above preparation methods.

[0020] The bionic radix dasyphylla (Gandhiza sativa) slices prepared according to the above method can be further refined and extracted to prepare bionic radix dasyphylla (Gandhiza sativa) extracts or formula granule slices and ultrafine crushed wall-broken slices that can be directly used for ease of use and to facilitate drug absorption.

[0021] The present invention also provides a bionic jasmine (Ganoderma lucidum) extract or a formula granule decoction piece, which is prepared by the following preparation method: S1. Bionic Daphne jasminoides (Daphne jasminoides) is crushed into coarse particles; S2. Add 6 to 9 times the amount of 60% to 80% ethanol, heat and reflux to extract, each time for 2 to 3.5 hours, extract 2 to 3 times, filter, combine the extracts, recover the ethanol, and obtain an alcohol extract; add 8 to 10 times the amount of water to soak the residue for 1 to 4 hours, heat and extract, each time for 1.5 to 3 hours, extract 2 to 3 times, filter, and concentrate to obtain a water extract; the alcohol and water extracts obtained above are mixed to obtain an extract; or add 8 to 10 times the amount of water to soak for 1 to 4 hours, heat and extract, each time for 1.5 to 3 hours, extract 2 to 3 times, filter, and concentrate to obtain an extract; S3. The extract obtained in step S2 is dried and crushed to obtain the biomimetic Radix Glehniae water extract, or further granulated by dry or wet pressing to prepare the formula granules.

[0022] The present invention also provides a bionic radix jasminoides (Ganoderma lucidum) ultrafine grinding and wall-breaking medicinal slice, which is obtained by completely drying the bionic radix jasminoides, crushing it into coarse particles, and then ultrafine grinding it into fine powder of 120-250 meshes.

[0023] The present invention also provides the use of any of the above-mentioned bionic jasmine, the bionic jasmine extract or the formulated granular slices, or the bionic jasmine ultrafinely crushed and broken slices in the preparation of a medicine for treating exogenous high fever convulsions, sputum cough, lung injury, coma, epilepsy, stroke, fatty liver and / or hyperlipidemia.

[0024] The present invention also provides a medicine containing any one of the above-mentioned bionic baicalensis, the bionic baicalensis extract or the formulated granular medicinal slices or the bionic baicalensis ultrafinely pulverized and wall-broken medicinal slices.

[0025] In order to overcome the natural resource limitations of natural dahlia, ensure its clinical efficacy, and maximize its medicinal value, the present inventors studied the formation mechanism of natural dahlia and explored the fungal species in naturally formed dahlia produced in Guangdong. The present invention simulates the formation mechanism of natural dahlia and, based on the obtained fungal species information, can also be obtained by commercially purchasing these fungi (including the genus Bamboo Flavor Fungus of the order Hypocreales of the phylum Ascomycota ( Shiraia ) and / or the ascomycete Polytrichomonas spp. ( Pestalotiopsis ) and / or Ascomycetes of the genus Chromospora ( Apiospora ) and / or Fusarium genus of the order Fusariumales of the subphylum Deuteromycetes ( Fusarium The present invention simulates the growth environment of natural dahlia and preferably uses the fungus of the genus Bamboo Flavor as the Shiraia bambusicola Henn., Polytrichomoniasis fungi are Pestalotiopsis clavata , the chromosporous fungus of the genus Arthrospira is Apiospora reed and Apiospora Guiyang, preferably the fungus of the genus Fusarium of the subphylum Deuteromycetes is Fusarium sporotrichioides It is injected into specific bamboo, infecting the bamboo to promote the outflow of wound sap, and the wound sap serves as a culture medium to grow fungi and transformation product complexes, and high-quality jasmine is produced through this bionic method.

[0026] Compared with the prior art, the present invention has the following beneficial effects: (1) The existing technology lacks understanding and research on the formation mechanism of natural dahlia. This invention conducts in-depth research on the formation mechanism of natural dahlia, and for the first time innovatively reveals that specific fungi and fermentation products are the main components of dahlia by fermenting fresh bamboo in vivo using bleeding fluid as a culture medium. The specific bacterial community of natural dahlia produced in Guangdong was isolated, cultivated, and identified, which plays an important role in the development of dahlia alternative research.

[0027] (2) The present invention provides a method for preparing bionic dahliae, which is based on the formation principle of natural dahliae. The fungi isolated from the naturally formed dahliae produced in Guangdong are used as strains, or commercial strains are used, and are inoculated into the wounds of fresh green-skinned bamboo or Huasilao bamboo. The bamboo wound fluid is used as a culture medium for bionic in vivo fermentation culture to obtain a substance mainly composed of a complex of fungi and their fermentation conversion products, namely, bionic dahliae. The inoculated strains include the genus Bamboo Flavor of the order Hypocreales of the Ascomycetes and / or the genus Districhia of the order Ascomycetes and / or the genus Chromospores of the order Ascomycetes and / or the genus Fusarium of the order Tuberculales of the subdivision Deuteromycetes. The bionic dahliae obtained by the method of the present invention has similar quality to that of natural dahliae and high yield, thus solving the problem of the scarcity of dahliae resources. The bionic rhizoma damiana of the present invention can be used for medical purposes such as medicinal slices, extracted formula granule medicinal slices, and ultrafine wall-broken medicinal slices to resist exogenous high fever convulsions, expectoration, lung injury, coma, epilepsy, stroke, fatty liver, and hyperlipidemia. DETAILED DESCRIPTION

[0028] The present invention is further described below with reference to specific examples, which, however, are not intended to limit the present invention in any way. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in the art.

[0029] Unless otherwise specified, the reagents and materials used in the following examples were commercially available.

[0030] The isolation and purification of the biomimetic fermentation fungus of Glechoma longituba was completed through the following experiments: Source of materials: collected from green bamboo in Huaiji County, Zhaoqing City, Guangdong Province ( Bamboo textiles Mc Clure ) in fresh Indian jasmine.

[0031] Culture medium: (1) PDA culture medium: Peel 200 g of potatoes (slice and soak, filter through 8 layers of gauze to collect the filtrate), add 20 g of glucose and 20 g of agar powder while hot, stir evenly, add water to 1000 mL, and adjust to natural pH; (2) PDA liquid culture medium: 200 g potatoes (sliced, soaked and boiled, filtered through 8 layers of gauze to obtain the filtrate), 20 g glucose, 1000 mL water, natural pH.

[0032] After preparation, all of the above culture media were sterilized in a high-pressure steam sterilizer at 121°C for 30 minutes.

[0033] Tissue block separation method: First clean the surface of the fruiting body of Gentiana jasminoides, and cut the fruiting body into 3*3*3mm tissue blocks with sterilized scissors under sterile conditions. Wash the tissue blocks twice in sterile water, and then disinfect them with 75% ethanol for 30s and 2% sodium hypochlorite for 5min, and then rinse them with sterile water for 3 times. Finally, place them in a culture dish containing different bacterial strains. Put 4 tissue blocks in each culture dish, arrange them evenly, and culture them upside down in a constant temperature incubator at 25℃. Observe the growth of the colonies for 3-5 days, and purify the isolated strains using the single spore separation method.

[0034] Shake Fermentation: The screened strain was inoculated into a 250 mL shake flask containing 100 mL of PDA liquid medium. The shaker was incubated at 25°C, 150 rpm for 48 hours to prepare for subsequent HPLC analysis of the active pharmaceutical ingredient.

[0035] Molecular biological identification: The genomic DNA of the fungus was extracted by the modified CTAB method, and then the ITS region of rDNA was amplified by PCR. The primers used were ITS1 / ITS4 (sequences were 5'-GGAAGTAAAAGTCGAAACAA-3' (SEQ ID No. 1) and 5'-TCCTCCGCTTATTGATATGC-3' (SEQ ID No. 2)). The amplified fragments included part of the 18S rDNA, ITS1 and ITS2, the entire 5.8 rDNA and part of the 28S rDNA.

[0036] The PCR reaction system (50 μL) included 5 μL of 10x Taq Reaction Buffer, 4 μL of 25 mmol / L Mg₂+, 2 μL each of 5 μmol / L ITSI-F and ITS4-B, 1 μL of 40 mmol / L dNTPs, 90 ng of DNA template, and 0.6 μL of 5 U / μL Taq polymerase. The volume was made up to 50 μL with double-distilled water. Amplification was performed on a My Cycler PCR amplifier using the following protocol: initial denaturation at 95°C for 5 min, followed by 35 cycles of denaturation at 95°C for 1 min, annealing at 53°C for 1 min, and extension at 72°C for 1 min 30 s. Finally, a final extension at 72°C for 7 min was performed. Amplified products were stored at 4°C.

[0037] The resulting PCR products were prepared by Qingke Biotechnology Co., Ltd. Based on the rDNA-ITS sequencing results of the strains, BLAST alignment was performed in the NCBI database (http: / / www.ncbi.nlm.nih.gov / BLAST) for sequence homology analysis. The results are shown in Table 1 below, indicating that the fungal species in naturally occurring radix dasyphyllae from Guangdong are primarily composed of the following five species.

[0038] Table 1 rDNA-ITS sequencing results of strains and Blast comparison results in the NCBI database

[0039]

[0040] Shiraia bambusicola Henn. rDNA-ITS sequence (SEQ ID No.3): tccgtaggggtgacctgcggaaggatcattacctagtagtacggggttatagcaatatagccccagtctgcacccatgtcttttgcgtactaaatgtttcctcggcaggcctgcctgccggttggacacgcttatactctttgtaattgcaatcagcgtctgaaccaactataatatttacaactttcaacaacggatctcttggttctggcatcgatgaagaacgcagcgaaatgcgataagtagtgtgaattgcagaattcagtgaatcatcgaatctttgaacgcacattgcgccccatggtattccatggggcatgcctgttcgagcgtcatttgaaaactcaagctttgcttggtattgggtggttgtcctgttctttgcaactggactcgccttaaagatattggcagccggcattttggccttggagcgcagcacaatttgcggatccaggttggagtactgacgtccatttaagcttaccacgcttgacctcggatcaggtagggatacccgctgaacttaagcatatcaaaagccgggaggaag。

[0041] Pestalotiopsis clavata rDNA-ITS sequence (SEQ ID No. 4): caaggtctccgttggtgaaccagcggagggatcattatagagttttctaaactcccaacccatgtgaacttaccattgttgcctcggcagaagctgctcggtgcaccttaccctggaacggcctaccctgtagcgccttaccctggaacggcttaccctgtagcggctgccggtggactaccaaactcttgttattttattgtaatctgagcgtcttattttaataagtcaaaactttcaacaacggatctcttggttctggcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcacattgcgcccattagtattctagtgggcatgcctgttcgagcgtcatttcaacccttaagcctagcttagtgttgggagcctactgcttttgctagctgtagctcctgaaatacaacggcggatctgcgatatcctctgagcgtagtaatttttatctcgcttttgactggagttgcagcgtctttagccgctaa。

[0042] Apiospora reed rDNA-ITS sequence (SEQ ID No.5): gccgctggtactggtgagttcgaggctggtatctccaaggatggccagactcgtgagcacgctctgctcgccttcaccctcggtgtcaagcagctcatcgtcgccatcaacaagatggacaccaccaagtggtctgaggcccgttacaaggagatcatcaaggagacctcctctttcatcaagaaggtcggctacaaccccaaggaggtcgctttcgtccccatctccggcttccacggcgacaacatgctggaggagtccggcaacatgccctggtacaagggttgggagaaggagaccaaggctggcggcaagaagaccggcaagaccctgttccaggccatcgatgccatcaactctccccagcgtcctaccgacaagcccctccgtcttcccctccaggatgtttacaagatcggtggtattggcactgtgcccgtcggccgtatcgagaccggtactctgaagcccggtatggtcgtcaccttcgctcccgccaacgtcaccactgaggtcaagtccgtcgagatgcaccaccagcagcttcccgagggtttccccggtgacaacgttggtttcaacgtcaagaacgtctccgtcaaggagatccgtcgtggcaacgttgccggtgactccaagaacgacccccctctgggtgccgcttctttcaacgcccaggtcattgtcctcaaccaccctggtcagatcggtgccggttacgctcccgtcctcgattgccacaccgcccacattgcttgcaagttctctgagcttcttgagaagatcgaccgccgtactggtaagtcggttgagaactctcccaagttcgtcaagtctggtgatgccgccatcgtcaagatgattccctccaagcccatgtgcgttgaggctttcaccgac。

[0043] Apiospora guiyangensis rDNA-ITS sequence (SEQ ID No.6): tgtaacaaggtctccgttggtgaaccagcggagggatcattacagagttatacaactcccataccatttgtaaactttactcagttatgcctcggcgtgaactgcgtacggaggcagagtggtgttacccggtaagctaccctgtagcttaccctgtagcactaccctgcaccactcccgcgcagcccgccggtggtacactaaactcttgttttattttatattctgagcgtattattttaataattaaaactttcaacaacggatctcttggttctggcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcacattgcgcccatcagtattctggtgggcatgcctgttcgagcgtcatttcaacccttaagcctagcttagtgttgggaatctactgtattgtagttccttaaagacagtggcggagcgatagttgtcctctgagcgtagtaaatttatttctcgcttctgtaaggctctatcctcccgccataaaacccccaattttttagtggttgacctcggatcaggtaggaatacccgctgaacttaagcata。

[0044] Fusarium sporotrichioides rDNA-ITS sequence (SEQ ID No.7): .

[0045] The bionic jasmine is prepared by purchasing the above-mentioned fungus species from the market and simulating the formation principle of natural jasmine.

[0046] In the following examples, Shiraia bambusicola Henn. was purchased from Ningbo Mingzhou Biotechnology Co., Ltd., product number BMZ075832; Pestalotiopsis clavata Purchased from Sino-An Gene Technology (Wuhan) Co., Ltd., catalog number RN-35611; Apiospora reed Purchased from Gray Algae Biology, product number HZB597350 ;Apiospora guiyangensis Purchased from China General Microorganism Culture Collection, accession number CGMCC3.20365; Fusarium sporotrichoidPurchased from Testol Biotechnology, product number TS132130. Example 1

[0047] 1) Drill holes in the middle of the upper middle section of a 4-9cm diameter bamboo. Depending on the thickness of the bamboo, the holes should be distributed and the diameter of the holes should vary from 1.0 to 2.5mm.

[0048] 2) Fungi Shiraia bambusicola Henn.、 Pestalotiopsis clavata 、 Apiospora reed 、 Apiospora guiyangensis 、 Fusarium sporotrichioides A mixed bacterial solution was prepared in a ratio of 1:1:1:1:1. PDA, peptone medium, and an appropriate amount of gelatin were added to the bacterial solution to increase viscosity for easier colonization. The concentration of the mixed bacterial solution was 1000 CFU / mL.

[0049] 3) After the bleeding fluid flows out of the wells, apply 5-10 mL of the mixed bacterial solution to each well opening and into the bleeding fluid.

[0050] 4) Observe the colonization and growth of the fungus, replant 1 to 4 times, and after about 3 months, collect the fungal complex (containing the fungus and its fermentation products) and dry it. 15.3 to 28.2 g of bionic jasmine can be obtained from each bamboo section.

[0051] 5) In this example, a total of 5.9 kg of bionic dahliae was obtained. Example 2

[0052] 1) Drill holes in the middle of the upper segments of 4-8cm diameter Huasilao bamboo. The diameter of the holes should be 0.8-1.5mm, depending on the thickness of the bamboo.

[0053] 2) Fungi Shiraia bambusicola Henn.、 Pestalotiopsis clavata 、 Apiospora reed 、 Apiospora guiyangensis 、 Fusarium sporotrichioides A mixed bacterial solution was prepared in a ratio of 1:1:1:1:1. PDA culture medium and an appropriate amount of honey were added to the bacterial solution to increase viscosity and facilitate colonization. The concentration of the mixed bacterial solution was 300 CFU / mL.

[0054] 3) After the bleeding fluid flows out of the wells, apply 3-6 mL of the mixed bacterial solution to each well opening and into the bleeding fluid.

[0055] 4) Observe the colonization and growth of the fungus, replant 1 to 3 times, and after about 3 months, collect the fungal complex (containing the fungus and its fermentation products) and dry it. 11.5 to 27.6 g of bionic jasmine can be obtained from each bamboo section.

[0056] 5) In this example, a total of 4.6 kg of bionic dahliae was obtained. Example 3

[0057] 1) Drill holes in the middle of the upper section of a 4-9cm diameter bamboo. The hole diameter should be 1.0-2.5mm depending on the thickness of the bamboo.

[0058] 2) Fungi Shiraia bambusicola Henn.、 Pestalotiopsis clavata 、 Apiospora reed 、 Apiospora guiyangensis 、 Fusarium sporotrichioides A mixed bacterial solution was prepared in a ratio of 1:1:3:1:1. PDA, peptone medium, and an appropriate amount of agar were added to the bacterial solution to increase viscosity for easier colonization. The concentration of the mixed bacterial solution was 2000 CFU / mL.

[0059] 3) After the bleeding fluid flows out of the wells, apply 8 mL of the mixed bacterial solution to each well opening and into the bleeding fluid.

[0060] 4) Observe the colonization and growth of the fungus, replant 1 to 3 times, and after about 3 months, collect the fungal complex (containing the fungus and its fermentation products) and dry it. 18.1 to 29.4 g of bionic jasmine can be obtained from each bamboo section.

[0061] 5) In this example, a total of 5.5 kg of bionic dahliae was obtained.

[0062] The present invention discovered Apiospora reed The fungus can decompose the cellulose inside the bamboo body, facilitate the secretion of wound fluid, and increase the yield of each section. Example 4

[0063] 1) Drill holes in the middle of the upper segments of 4-8cm diameter Huasilao bamboo. The diameter of the holes should be 0.8-1.5mm, depending on the thickness of the bamboo.

[0064] 2) Fungi Shiraia bambusicola Henn.、 Pestalotiopsis clavata 、 Apiospora reed 、 Apiospora guiyangensis 、 Fusarium sporotrichioides A mixed bacterial solution was prepared in a ratio of 1:1:3:1:1. PDA, peptone medium, and an appropriate amount of agarwood powder extract were added to the bacterial solution to increase viscosity for easier colonization. The concentration of the mixed bacterial solution was 3000 CFU / mL.

[0065] 3) After the bleeding fluid flows out of the wells, apply 8 mL of the mixed bacterial solution to each well opening and into the bleeding fluid.

[0066] 4) Observe the colonization and growth of the fungus, replant 1 to 3 times, and after about 3 months, collect the fungal complex (containing the fungus and its fermentation products) and dry it. 14.8 to 27.6 g of bionic jasmine can be obtained from each bamboo section.

[0067] 5) In this example, a total of 5.1 kg of bionic dahliae was obtained.

[0068] In Hua Si Lao Zhu's example, we also see Apiospora reed The fungus can decompose the cellulose inside the bamboo body and increase the yield of each section. Example 5

[0069] Take 2kg of the biomimetic Radix Glehniae obtained in Example 1, crush it into coarse particles, add 8 times the amount of 70% ethanol, heat and reflux extraction, each time for 3 hours, extract twice, filter, combine the extracts, recover ethanol, and obtain an alcohol extract. After the residue is soaked in 10 times the amount of water for 3 hours, heated and extracted, each time for 2.5 hours, extract twice, filter, and concentrate to obtain an aqueous extract. The alcohol and aqueous extracts obtained above are mixed, dried under reduced pressure, and pulverized to obtain an extract or a formula granule slice prepared by pressing a dry method. The paste rate is measured to be 33.7%. Example 6

[0070] 2 kg of the biomimetic Radix Glehniae obtained in Example 2 was crushed into coarse particles, soaked in 10 times the amount of water for 4 hours, and subjected to three extractions under reflux for 2.5 hours each time. The extract was filtered and concentrated to obtain an aqueous extract. The obtained extract was dried under reduced pressure and pulverized to obtain the biomimetic Radix Glehniae aqueous extract; alternatively, the extract was wet-granulated to prepare a formulated granular slice. The measured paste yield was 30.3%, slightly lower than that of the dual extraction method using alcohol and water, but with lower cost and higher efficiency. Example 7

[0071] The bionic jasmine obtained in Example 1 was dried completely at 80° C., crushed into coarse particles, and then crushed into 160-mesh fine powder using an ultrafine grinder to obtain bionic jasmine ultrafinely crushed wall-broken slices. The powder yield was 93.6%.

[0072] The bionic dahlia obtained by the present invention can be used as natural dahlia. It tastes sweet and is cold in nature. It enters the heart and liver meridians, clears away heat and resolves phlegm, and calms the heart and calms the nerves. Compared with simple bamboo bleeding sap or other artificial products, the bionic dahlia is a complex of the fermented bacteria of a specific fungus and the transformed bleeding sap. After fermentation, its coldness is greatly reduced, which is the shortcoming of other substitutes. It can reduce the medication contraindications caused by excessive coldness and has a precise expectorant effect. Its medical use for exogenous high fever convulsions, coughing up phlegm, lung damage, coma, epilepsy, stroke, fatty liver, and hyperlipidemia can be illustrated by the following test examples.

[0073] Experimental Example 1 Study on the antipyretic effect of biomimetic dahliae

[0074] Animals: 70 male SD rats, 8 weeks old, weighing 180±20 g.

[0075] Drugs: the bionic Radix Glehniae decoction pieces of Example 1, the bionic Radix Glehniae extract of Example 5, and the bionic Radix Glehniae ultrafinely pulverized and wall-broken decoction pieces of Example 7.

[0076] Positive medicine: acetaminophen tablets.

[0077] Methods: Rats were randomly divided into 10 groups: blank group, model group, positive drug (acetaminophen) group, high-dose group (1.4 g / kg), low-dose group (0.7 g / kg) of Example 1, Example 5 group (0.468 g / kg), and Example 7 group (1.324 g / kg). Rats were fasted for 12 hours prior to the experiment. Body temperature was measured three times on the day of the experiment, and the mean value was used as the initial body temperature. A fever model was established in the control group with normal saline (10 mL / kg) administered subcutaneously to the back of the rats, while the remaining rats received a 20% dry yeast suspension subcutaneously to the back of the rats. The acetaminophen group and the biomimetic Tianzhuhuang group were administered once 30 minutes before and 3.5 hours after model establishment, respectively. The control group and model group received an equal volume of normal saline (10 mL / kg) intragastrically. Administration was via gavage. Eight hours after rectal temperature measurement, blood was drawn from the abdominal aorta for inflammatory cytokine analysis. The results are shown in Tables 2 and 3.

[0078]

[0079]

[0080] Results: 4 hours after modeling, the body temperature of rats in the model group increased significantly (P < 0.01), indicating that this study successfully replicated the dry yeast-induced fever model in rats. Oral administration of the bionic Tianzhuhuang samples from Examples 1, 5, and 7 significantly reduced the rectal temperature of the rats (P < 0.01). Inflammatory cytokine assays showed that the bionic Tianzhuhuang slices, extracts, and ultrafinely crushed slices significantly reversed the elevated levels of IL-6, IL-1β, TNF-α, PGE2, cAMP, and CRH induced by subcutaneous injection of dry yeast on the back (P < 0.01). This suggests that the antipyretic mechanism of the bionic Tianzhuhuang slices, extracts, and ultrafinely crushed slices is related to their ability to inhibit inflammatory responses.

[0081] Conclusion: Bionic Radix Glehniae has a significant antipyretic effect, which is a reflection of its heat-clearing efficacy.

[0082] Experimental Example 2 Study on the Anti-epileptic Effect of Bionic Daphne Animals: 70 male SD rats, 8 weeks old, weighing 180±20 g.

[0083] Medicines: the bionic Radix Gastrodiae decoction pieces of Example 3, the bionic Radix Gastrodiae formula granule decoction pieces of Example 6, and the bionic Radix Gastrodiae ultrafine grinding and wall-broken decoction pieces of Example 7.

[0084] Positive drug: sodium valproate oral solution Methods: Male SD rats were caged and acclimated for 7 days. A control group received an intraperitoneal injection of an equal dose of 0.9% sodium chloride solution, while the remaining rats received an intraperitoneal injection of 50 mg / kg PTZ for a total of 7 days. Post-injection observations included seizure severity, the incidence of tonic spasms, and mortality. Within 30 minutes after each PTZ injection, the rats' behavior was observed and assessed according to the Racine scale. Seizure severity was recorded; three consecutive episodes of grade IV or higher were considered complete ignition. Administration was via oral gavage. The positive drug group (sodium valproate) received a dose of 200 mg / kg; the high-dose group (1.4 g / kg) and low-dose group (0.7 g / kg) of Example 3, the Example 6 group (0.468 g / kg), and the Example 7 group (1.324 g / kg). After 21 days of dosing, the rats were deprived of food but not water for 12 hours, anesthetized with 3% sodium pentobarbital, and blood was collected from the abdominal aorta. The results are shown in Tables 4 and 5.

[0085]

[0086]

[0087] Results: 7-18 minutes after intraperitoneal injection of PTZ, model rats developed forelimb spasms accompanied by varying degrees of erectile dysfunction, tonic spasms, and falls. Some rats experienced severe grade V convulsions, characterized by generalized tonic spasms, sustained standing, loss of balance, and falls. The positive drug sodium valproate, as well as the biomimetic Tianzhuhuang decoction pieces, formulated granular decoction pieces, and ultrafinely crushed decoction pieces, significantly improved the tonic spasms in the rats. Furthermore, neurotransmitter levels in the hippocampus of rats in each group were measured, revealing that intraperitoneal injection of PTZ significantly decreased GABA levels and increased Glu levels in the brain (P < 0.01). Administration of sodium valproate and the biomimetic Tianzhuhuang decoction groups significantly reversed these changes.

[0088] Conclusion: Bionic Tianzhuhuang exerts anti-epileptic effect by improving symptoms of spasticity and regulating the content of neurotransmitters in hippocampus.

[0089] Experimental Example 3: Anti-febrile convulsion effect of biomimetic dandruff Animals: 70 male SD rats, 3 weeks old, weighing 50±10 g.

[0090] Drugs: high-dose group (1.4 g / kg) and low-dose group (0.7 g / kg) of the bionic Radix Glehniae decoction slices of Example 3, the bionic Radix Glehniae formula granule decoction slices of Example 6 (0.468 g / kg), and the bionic Radix Glehniae ultrafine crushed decoction slices of Example 7 (1.324 g / kg).

[0091] Positive drug: sodium valproate oral solution 200 mg / kg.

[0092] Methods: A febrile seizure model was established in SD rats using a hot water bath combined with intraperitoneal injection of lipopolysaccharide. For three days, 1 hour before the last oral gavage, 200 μg / kg of lipopolysaccharide was administered intraperitoneally. The drug volume administered was 10 mL / kg for both oral and intraperitoneal injections, respectively. Two hours after oral gavage, the rats were placed in a 3-L beaker maintained at 45°C in a waterbath, where they were allowed to swim freely. If seizures occurred, such as head clonus, head shaking, or forelimb spasms, that impaired swimming, the rats were immediately removed. Seizures observed within 5 minutes were considered successful; otherwise, no seizures occurred. Seizure latency and seizure scores were recorded according to the Racine scale. Three hours after the last dose, the rats were anesthetized with 3% sodium pentobarbital, and blood was collected from the abdominal aorta.

[0093]

[0094] Results: Except for the normal control group, rats in all other groups experienced febrile seizures within 5 minutes, with a model establishment success rate of 100%. Compared with the normal control group, the model group had a seizure latency of approximately 2 minutes, a score of 4-5, and a statistically significant increase in rectal temperature to approximately 42°C (P < 0.01). Compared with the model group, all groups treated with bionic dandelion significantly prolonged the seizure latency and reduced the severity of seizures in rats, with a significant decrease in rectal temperature (P < 0.01 or P < 0.05).

[0095] Conclusion: Bionic Tianzhuhuang exerts a significant anti-febrile seizure effect by ameliorating symptoms of tonic spasm and reducing rectal temperature. Except for the normal control group, rats in all other groups experienced febrile seizures within 5 minutes, with a 100% model establishment success rate. Compared with the normal control group, the model group had a seizure latency of approximately 2 minutes, a score of 4-5, and a statistically significant increase in rectal temperature to approximately 42°C (P < 0.01). Compared with the model group, all groups treated with bionic Tianzhuhuang significantly prolonged the seizure latency, reduced the severity of seizures, and decreased rectal temperature (P < 0.01 or P < 0.05).

[0096] Conclusion: Bionic Radix Glehniae exerts a significant anti-febrile convulsion effect by improving symptoms of spasticity and reducing rectal temperature.

[0097] Experimental Example 4 Study on the therapeutic effect of biomimetic Radix Glehniae on stroke Animals: 70 male SD rats, weighing 300±20 g.

[0098] Drugs: high-dose group (1.4 g / kg) and low-dose group (0.7 g / kg) of the bionic Radix Glehniae decoction pieces of Example 4, the bionic Radix Glehniae extract of Example 6 (0.468 g / kg), and the ultrafinely crushed decoction pieces of Example 7 (1.324 g / kg.

[0099] Positive drug: nimodipine solution.

[0100] Methods: A modified Longa suture occlusion method was used to establish an ischemic stroke model in rats. Seventy male Sprague-Dawley rats were acclimated for one week and then randomly divided into a control group, a sham-operated group, a model group, a positive drug group, and various drug-treated groups. Drugs were administered orally for four consecutive days with free water access. On the evening of the fourth day, the rats were fasted but not allowed to drink water. Drugs were administered orally once 1 hour before modeling on the fifth day. All rats, except the sham-operated group, were anesthetized with an intraperitoneal injection of 3% sodium pentobarbital. Blunt dissection was performed to expose the left common carotid artery, external carotid artery, and internal carotid artery. The distal end of the external carotid artery and the proximal end of the common carotid artery were ligated with sutures, and the distal end of the internal carotid artery was clamped with a micro-arterial clamp. A small 0.2 mm incision was made at the bifurcation of the common carotid artery. The suture was gently advanced through the common and internal carotid arteries to the origin of the middle cerebral artery, approximately 18 mm from the bifurcation, to occlude the left middle cerebral artery. After 2 hours of ischemia, the suture was gently removed to allow reperfusion. Rats were scored on a 5-point scale 12 hours after reperfusion. The criteria were as follows: 0, no neurological signs; 1, inability to fully extend the contralateral forepaw; 2, turning in circles toward the contralateral side; 3, collapsing toward the contralateral side; 4, inability to walk spontaneously and loss of consciousness; and 5, death. The results are shown in Table 7.

[0101]

[0102] Results: Except for the sham-operated group, rats in all other groups exhibited slowed movement and inability to straighten their right forepaw. Some rats crawled in circles, and in severe cases, rats were unable to walk spontaneously and lost consciousness. The model group exhibited the most severe neurological impairment and the largest cerebral infarction area ratio, which was statistically significant compared with the sham-operated group (P < 0.01). Compared with the model group, the bionic Tianzhuhuang slices, extract, and ultrafinely crushed slices significantly improved postoperative behavioral symptoms and reduced the cerebral infarction area ratio in rats (P < 0.01).

[0103] Conclusion: Bionic Tianzhuhuang slices, extracts and ultrafine crushed slices play a significant anti-stroke effect by improving neurological damage and reducing cerebral infarction area ratio.

[0104] Experimental Example 5 Study on the lipid-lowering effect of biomimetic dahliae Animals: 70 male SD rats, 8 weeks old, weighing 200 ± 20 g. High-fat diet was purchased from Beijing Xiaoshu Youtai (Beijing) Biotechnology Co., Ltd.

[0105] Drugs: high-dose group (1.4 g / kg) and low-dose group (dose 0.7 g / kg) of the bionic Radix Glehniae decoction slices of Example 4, the bionic Radix Glehniae formula granule decoction slices of Example 6 (0.468 g / kg), and the bionic Radix Glehniae ultrafine crushed decoction slices of Example 7 (1.324 g / kg).

[0106] Positive drug: fenofibrate tablets 40 mg / kg.

[0107] Methods: After one week of adaptive feeding, 70 male SD rats were randomly divided into a blank group (maintenance diet) and a high-fat diet modeling group. After four consecutive weeks of feeding, rats were randomly sampled from both the blank and modeling groups. Blood was drawn from the eyelid vein under fasting conditions to measure triglyceride (TG), total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C). Modeling was successful if TG, TC, and LDL-C levels were significantly higher than those in the blank group and statistically significant. After successful modeling, the modeling rats were randomly divided into a model group, a positive drug group, the high- and low-dose groups of Example 4, Example 6, and Example 7 groups, and the rats were gavage-treated for four weeks. Twelve hours after the last dose, the rats were anesthetized with 3% sodium pentobarbital and blood was drawn from the abdominal aorta. The results are shown in Table 8.

[0108]

[0109] Results: TG, TC, and LDL-C levels in rats fed a high-fat diet were significantly higher than those in the blank control group, indicating successful model establishment. After 4 weeks of administration, TG, TC, and LDL-C levels in the model group were significantly higher than those in the blank control group, while HDL-C levels were significantly lower than those in the blank control group (P < 0.01). Compared with the model group, the bionic Tianzhuhuang decoction pieces, the formulated granular decoction pieces, and the ultrafinely crushed decoction pieces all significantly reduced TG, TC, and LDL-C levels in rats fed a high-fat diet, while increasing HDL-C levels (P < 0.01).

[0110] Conclusion: Bionic Radix Glehniae has a significant effect on lowering blood lipids.

[0111] Test Example 6 Study on the expectorant effect of biomimetic rhizoma jasminoides Animals: 60 Kunming mice, male, 8 weeks old, weighing 20±2 g.

[0112] Drugs: high-dose group (1.4 g / kg) and low-dose group (dose 0.7 g / kg) of the bionic Radix Glehniae decoction slices of Example 3, the bionic Radix Glehniae formula granule decoction slices of Example 5 (0.468 g / kg), and the bionic Radix Glehniae ultrafine crushed decoction slices of Example 7 (1.324 g / kg).

[0113] Positive drug: Ambroxol hydrochloride 180 mg / kg.

[0114] Methods: A phenol red excretion experiment was conducted in mice to evaluate the expectorant effect of biomimetic dandelion. Mice were randomly divided into a blank group, a positive drug group, the high- and low-dose groups of Example 3, Example 5, and Example 7, with 10 mice in each group. Administration was by gavage twice daily for 7 consecutive days. Thirty minutes after the last dose, 5% phenol red solution was injected intraperitoneally at a rate of 10 mL / kg. Thirty minutes later, the mice were sacrificed by cervical dislocation. The trachea was isolated, and the tracheal segment from the thyroid cartilage to the tracheal bifurcation was removed and placed in 2 mL of normal saline. The solution was sonicated for 5 minutes, shaken for 20 minutes, and centrifuged at 4°C for 5 minutes. The supernatant was collected. The absorbance (A) was measured at 546 nm in a 96-well plate using a microplate reader. The phenol red content was calculated using the regression equation. The results are shown in Table 9.

[0115]

[0116] Results: Compared with the blank control group, the phenol red excretion in each drug-treated group was significantly increased (P < 0.01).

[0117] Conclusion: Bionic Radix Glehniae has a significant expectorant effect.

[0118] Experimental Example 7 Study on the Anti-Acute Lung Injury Effect of Bionic Daphne Animals: 70 ICR mice, male, 8 weeks old, weighing 20 ± 2 g.

[0119] Materials: Lipopolysaccharide (purchased from Sigma, USA).

[0120] Drugs: high-dose group (1.4 g / kg) and low-dose group (dose 0.7 g / kg) of the bionic Radix Glehniae decoction slices of Example 3, the bionic Radix Glehniae formula granule decoction slices of Example 5 (0.468 g / kg), and the bionic Radix Glehniae ultrafine crushed decoction slices of Example 7 (1.324 g / kg).

[0121] Positive drug: dexamethasone 40 mg / kg.

[0122] Methods: An acute lung injury mouse model was established by intraperitoneal injection of lipopolysaccharide (LPS). Seventy ICR male mice were randomly divided into a blank group, a model group, a positive drug group, the high- and low-dose groups of Example 3, Example 5, and Example 7, with 10 mice in each group. Each drug-treated group received oral administration once daily on days 1-3. On day 4, the model group and each drug-treated group received an intraperitoneal injection of 20 mg / kg LPS to establish an acute lung injury mouse model. The control group received an equal volume of PBS. The results are shown in Table 10.

[0123]

[0124] Results: After modeling, no mice in each group died. Compared with the control group, the W / D ratio of lung tissue in the model group was significantly increased (P<0.01). Compared with the model group, the bionic dahliae groups significantly reduced the W / D ratio of lung tissue in mice with acute lung injury (P<0.01). ELISA results showed that compared with the control group, the serum levels of IFN-γ, TNF-α, IL-4, and IL-12 in the model group were significantly increased (P<0.01). Compared with the model group, the bionic dahliae groups significantly reduced the levels of inflammatory factors in the serum of mice with acute lung injury (P<0.01).

[0125] Conclusion: Bionic Radix Glehniae has significant anti-acute lung injury effect.

Claims

1. A preparation method of bionic Shiraia bambusicola, characterized in that, Inoculate the strain on the wound of fresh Schizostachyum sanguineum or Sinocalamus vario-striatus, and use the bamboo bleeding sap as the culture medium for in vivo fermentation culture by imitating the natural environment to obtain the complex of fungi and their fermentation transformation products, which is the bionic bamboo shavings; the inoculated strain includes at least fungi of the genus Shiraia in the order Hypocreales of the phylum Ascomycota and / or the genus Pestalotiopsis of the phylum Ascomycota and / or the genus Apiospora of the phylum Ascomycota and / or the genus Fusarium of the order Tuberculariales of the subphylum Deuteromycota.

2. The preparation method according to claim 1, characterized in that, The preparation method includes the following steps: S1. Drill holes on the stems of fresh Schizostachyum sanguineum or Sinocalamus vario-striatus with the boring size of natural bamboo wasps; S2. Implant into the hole at a concentration of 10 2 ~10 10 CFU / mL, including at least fungi of the genera Shiraia in the order Hypocreales of the class Ascomycetes and / or Pestalotiopsis in the class Ascomycetes and / or Arthrinium phaeospermum in the class Ascomycetes and / or Fusarium in the order Tuberculariales of the class Deuteromycetes. The injection volume is 1 mL to 10 mL per incision, and the number of inoculations is 1 to 5 times; S3. Wait for the fungal complex to grow, collect and dry it in the sun, which is the bionic bamboo shavings.

3. The preparation method according to claim 2, characterized in that, When inoculating, a culture solution that is beneficial to the colonization of the strain can be added or not.

4. The preparation method according to claim 1 or 2, characterized in that, The fungus of the genus Shiraia is Shiraia bambusicola Henn., the fungus of the genus Pestalotiopsis is Pestalotiopsis clavata , the fungus of the genus Arthrinium is Apiospora arundinis and Apiospora guiyangensis , the fungus of the genus Fusarium is Fusarium sporotrichioides .

5. The method according to claim 4, wherein The Shiraia bambusicola Henn., Pestalotiopsis clavata , Apiospora arundinis , Apiospora guiyangensis and Fusarium sporotrichioides are in any ratio.

6. The bionic bamboo shavings prepared by the preparation method according to any one of claims 1 to 5.

7. A bionic Shiraia bambusicola extract or formula granule decoction piece, characterized in that, Prepared by the following preparation method: S1. Crush the bionic bamboo shavings according to claim 6 into coarse particles; S2. Add 6 to 9 times the amount of 60% to 80% ethanol, heat under reflux for extraction, each time for 2 to 3.5 hours, extract 2 to 3 times, filter, combine the extracts, recover the ethanol to obtain an alcohol extract; soak the residue in 8 to 10 times the amount of water for 1 to 4 hours, then heat for extraction, each time for 1.5 to 3 hours, extract 2 to 3 times, filter, concentrate to obtain a water extract, and mix the above-obtained alcohol and water extracts to obtain an extract; or soak in 8 to 10 times the amount of water for 1 to 4 hours, then heat for extraction, each time for 1.5 to 3 hours, extract 2 to 3 times, filter, concentrate to obtain an extract; S3. Dry and crush the extract obtained in step S2 to obtain the water extract of bionic bamboo shavings, or further granulate it by dry method or wet method to make formula granule decoction pieces.

8. A superfine pulverized and wall-broken decoction piece of bionic bamboo shavings, which is obtained by completely drying the bionic bamboo shavings according to claim 6, crushing them into coarse particles, and then superfine pulverizing them into fine powder of 120 to 250 meshes.

9. Use of the bionic bamboo shavings according to claim 6, the extract or formula granule decoction piece of the bionic bamboo shavings according to claim 7, or the superfine pulverized and wall-broken decoction piece of the bionic bamboo shavings according to claim 8 in the preparation of drugs for treating exogenous high fever convulsion, expectoration, lung injury, coma, epilepsy, stroke, fatty liver, and hyperlipidemia.

10. A drug, characterized in that, Containing the bionic bamboo shavings according to claim 6, the extract or formula granule decoction piece of the bionic bamboo shavings according to claim 7, or the superfine pulverized and wall-broken decoction piece of the bionic bamboo shavings according to claim 8.

Images