Bio-organic fertilizer containing Burkholderia parvata and application of bio-organic fertilizer

Abstract

The invention relates to a bio-organic fertilizer containing Burkholderia graminicola and application thereof, and belongs to the technical field of biology, the bio-organic fertilizer comprises Burkholderia graminicola, decomposed cow dung, rice husk, fish protein fertilizer and chitin, and can be used for increasing the content of microbial carbon and microbial nitrogen in rhizosphere soil of plants and increasing the content of microbial carbon and microbial nitrogen in the rhizosphere soil of the plants. The proline content and the root activity of plant roots are improved, the nitrogen absorption and utilization rate, the potassium absorption amount and the plant rhizosphere soil enzyme activity of the plants are improved, and crop diseases are prevented and treated. Wherein the burkholderia paragallinarum is a natural strain and can be planted in soil more easily, and the burkholderia paragallinarum is wide in raw material source, low in cost, simple in preparation method, free of adverse effects on environmental safety and capable of promoting sustainable development of agricultural production.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to a bio-organic fertilizer containing Paraburkholderia graminis and its application. Background Art

[0002] In recent years, with the continuous planting of crops, soil-borne diseases have been intensifying year by year. If no immediate measures are taken, in severe cases, it may cause complete crop failure. Especially fungal diseases among soil-borne diseases, which can significantly affect plant growth, such as causing cell necrosis, leaf withering, inflorescence malformation, etc., and even leading to plant death. However, in terms of disease prevention and control, in the face of soil-borne diseases, simply relying on specific chemical agents for prevention and control is not only difficult to achieve the expected control effect, but may also lead to the generation of drug resistance in pathogens.

[0003] In the past decade, the improvement of environmental awareness has made green agriculture the mainstream. When preventing and controlling soil-borne diseases, the goal is to minimize the negative impact on the environment and ecosystem while ensuring the improvement of economic benefits. Compared with chemical pesticides, the use of biological pesticides has received increasing attention. It relies on microbial and plant-derived preparations to control pathogens and is currently the focus of research. Microbial preparations help to increase the diversity of soil microorganisms, enhance soil fertility and crop quality, and at the same time improve the resistance of plants. Bio-organic fertilizers contain active microorganisms and can promote crop growth. Compared with traditional chemical fertilizers, bio-organic fertilizers have a higher carbon-nitrogen ratio and comprehensive fertilizer effects, significantly improve the physical and chemical properties of the soil, can enhance the activity of soil microorganisms, improve soil fertility, and increase the yield and quality of agricultural crops. Bio-organic fertilizers play a crucial role in environmental protection and promoting soil material cycling.

[0004] In addition, the currently commonly used bio-organic fertilizers mostly rely on microbial strains that have undergone gene mutations or directional breeding. These strains are often restricted by environmental conditions during actual use and are not easy to survive, reproduce, and exert their expected functions in the soil or plants. Therefore, the research on bio-organic fertilizers based on natural microbial strains has become a research focus in this field.

[0005] In summary, when conducting biological control of crop diseases, the interference with the environment and ecosystem should be minimized while ensuring the maximization of economic benefits. As a new type of fertilizer, the research and application of bio-organic fertilizers should be based on natural strains and continuously deepened to improve the preparation process and application efficiency. Summary of the Invention

[0006] To overcome the problems existing in the background art, the present invention provides Paraburkholderia graminis and its biological organic fertilizer and their applications. The Paraburkholderia graminis provided by the present invention is a natural plant rhizosphere bacterium. Compared with genetically engineered bacteria, this strain has better colonization ability in soil and plant rhizosphere. The bacterial agent and biological organic fertilizer containing this bacterium have advantages such as preventing and controlling crop root rot, increasing the proline content and root activity of plant roots after application.

[0007] To achieve the above object, the present invention provides the application of Paraburkholderia graminis ( Paraburkholderia graminis ), with the preservation number: CCTCC NO: M 20242399, in preventing and controlling root rot of Dutch beans ( Fusarium oxysporum ), root rot of chayote ( Pythium aphanidermatum ), and black root disease of purple cabbage ( Rhizoctonia solani ), increasing the content of microbial carbon and microbial nitrogen in the rhizosphere soil of plants, increasing the proline content and root activity of plant roots, increasing the nitrogen absorption utilization rate, potassium uptake amount of plants, and the enzyme activity of plant rhizosphere soil.

[0008] The present invention also provides a biological organic fertilizer, which comprises the following components: decomposed cow dung, rice husk, fish protein, chitin and Paraburkholderia graminis bacterial agent with a weight ratio of 140 - 210:75 - 110:24 - 45:11.5 - 17.1:3; the effective viable bacteria count in the Paraburkholderia graminis bacterial agent is not less than 2×10 10 cfu / g; wherein, the preservation number of the Paraburkholderia graminis is CCTCC NO: M20242399; The present invention further provides the application of the biological organic fertilizer in preventing and controlling root rot of Dutch beans ( Fusarium oxysporum ), root rot of chayote ( Pythium aphanidermatum ), and black root disease of purple cabbage ( Rhizoctonia solani ), increasing the content of microbial carbon and microbial nitrogen in the rhizosphere soil of plants, increasing the proline content and root activity of plant roots, increasing the nitrogen absorption utilization rate, potassium uptake amount of plants, and the enzyme activity of plant rhizosphere soil.

[0009] Advantages of the present invention: (1) The Paraburkholderia graminis ( Paraburkholderia graminis ) provided by the present invention is a natural strain with better colonization ability. Compared with genetically engineered strains or induced mutant strains, it is more conducive to exerting the biocontrol characteristics of the strain, thus achieving excellent disease control effects.

[0010] (2) The biological organic fertilizer provided by the present invention can effectively regulate the metabolism of plants, improve the nitrogen absorption and utilization rate of plants, the potassium uptake amount, and increase the proline content and root activity in the roots of plants, thereby effectively solving problems such as severe disease occurrence or decreased plant resistance during plant growth, and can also increase the microbial carbon and microbial nitrogen contents in the rhizosphere soil of plants and the enzyme activity of the rhizosphere soil of plants.

[0011] (3) The biological organic fertilizer provided by the present invention has the characteristics of wide raw material sources, low cost, and environmental friendliness. At the same time, the preparation method of this fertilizer is also very simple and has high storage stability. Through the selection of the types and dosages of raw materials in the fertilizer, the viable count reaches a relatively high level when adding Burkholderia parafirmus.

[0012] (4) The methods provided by the present invention for preventing and controlling root rot of Dutch beans ( Fusarium oxysporum ), root rot of chayote ( Pythium aphanidermatum ), and black root disease of purple cabbage ( Rhizoctonia solani are simple and easy to implement, will not have an adverse impact on environmental safety, and can promote the sustainable development of agricultural production.

[0013] Biological preservation The Burkholderia parafirmus provided by the present invention ( Paraburkholderia graminis ), classified and named as: Paraburkholderia graminis YNK PB0001, was deposited at the China Center for Type Culture Collection on October 31, 2024. The address is Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and the deposit number is CCTCC NO: M20242399. This strain has been disclosed in the invention patent with the application number: CN202510152906.3. Specific implementation manners

[0014] In the ranges disclosed herein, the endpoints and any values are not limited to the exact ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, between the endpoint values of each range, between the endpoint values of each range and individual point values, and between individual point values, they can be combined with each other to obtain one or more new numerical ranges, and these numerical ranges should be regarded as specifically disclosed herein.

[0015] In the present invention, Burkholderia parafirmus YNK PB0001 and Burkholderia parafirmus CCTCC NO: M 20242399 are the same strain, and their meanings are the same, and their names (numbers) can be used interchangeably.

[0016] The inventor of the present invention isolated a strain of Burkholderia parafirmus ( Paraburkholderia graminis ) during the research process, and classified and named it as: Paraburkholderia graminisYNK PB0001 was deposited at the China Center for Type Culture Collection on October 31, 2024. The address is Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and the deposit number is CCTCC NO: M20242399.

[0017] Through further research by the inventors, it was found that the above-mentioned Burkholderia parafungorum YNK PB0001 mixed with well-rotted cow dung, rice husks, fish protein fertilizer and chitin can be used to prepare a bio-organic fertilizer containing Burkholderia parafungorum, which can be used to control root rot of Dutch beans, root rot of chayote, and black root disease of purple cabbage, improve the content of microbial carbon and microbial nitrogen in the rhizosphere soil of plants, increase the proline content and root activity of plant roots, improve the nitrogen absorption utilization rate, potassium uptake of plants, and the enzyme activity of plant rhizosphere soil, etc.

[0018] Based on the above findings, the present application provides a bio-organic fertilizer containing Burkholderia parafungorum, and the bio-organic fertilizer comprises: well-rotted cow dung, rice husks, fish protein, chitin and a Burkholderia parafungorum bacterial agent with a weight ratio of 140 - 210:75 - 110:24 - 45:11.5 - 17.1:3; the effective viable bacteria count in the Burkholderia parafungorum bacterial agent is not less than 2×10 10 cfu / g.

[0019] The present invention provides a bio-organic fertilizer containing Burkholderia parafungorum, including well-rotted cow dung, rice husks, fish protein fertilizer, chitin grass and Burkholderia parafungorum CCTCC NO: M 20242399 (or a bacterial agent prepared based on this strain).

[0020] In the well-rotted cow dung, the moisture content is 10 - 16% by weight, calculated on a dry matter basis, the crude protein content is 10 - 16% by weight, the crude fiber content is 8 - 15% by weight, the crude fat content is 0.1 - 1% by weight, the nitrogen-free extract is 40 - 60% by weight, and the calcium content is 1 - 10% by weight; In the rice husks, the moisture content is 5 - 10%, calculated on a dry matter basis, the crude fiber content is 30 - 40% by weight, the lignin content is 20 - 30% by weight, the crude protein content is 1 - 5% by weight, the crude fat content is 0.5 - 2% by weight, and the ash content is 10 - 20% by weight.

[0021] The present invention has no particular restrictions on the specific composition and source of the selected auxiliary materials. It can be directly obtained through commercial purchase or can be related products prepared according to existing technologies.

[0022] In the research, the inventors of the present invention found that when chitin is used as a fertilizer synergist and applied to the composition provided by the present invention, not only can the control effect be further improved, but also the activity of defense proteins in crops, especially plant plants, and the enzyme activity in rhizosphere soil can be enhanced. In addition, in the bio-organic fertilizer containing Burkholderia paramultivorans in the rhizosphere of grass, using fish protein fertilizer as a synergist can further increase the viable bacteria count in the organic fertilizer.

[0023] The present invention provides the above-mentioned bio-organic fertilizer containing Burkholderia paramultivorans in the rhizosphere of grass for preventing and treating root rot of Dutch beans ( Fusarium oxysporum ), root rot of chayote ( Pythium aphanidermatum ), and black root rot of purple cabbage ( Rhizoctonia solani ), and for increasing the contents of microbial carbon and microbial nitrogen in the rhizosphere soil of plants, increasing the proline content and root activity of plant roots, increasing the nitrogen absorption utilization rate, potassium absorption amount of plants, and the enzyme activity in the rhizosphere soil of plants.

[0024] In the present invention, preventing and treating diseases means reducing the incidence of diseases and regulating soil nutrients (such as increasing the contents of microbial carbon and microbial nitrogen in the soil, the nitrogen absorption utilization rate and potassium absorption amount of plants, and increasing the soil enzyme activity), and enhancing the systemic resistance of plants (such as increasing the proline content and root activity of plant roots, etc.).

[0025] A method for preventing and treating root rot of Dutch beans ( Fusarium oxysporum ), root rot of chayote ( Pythium aphanidermatum ), and black root rot of purple cabbage ( Rhizoctonia solani ), increasing the contents of microbial carbon and microbial nitrogen in the rhizosphere soil of plants, increasing the proline content and root activity of plant roots, increasing the nitrogen absorption utilization rate, potassium absorption amount of plants, and the enzyme activity in the rhizosphere soil of plants, the method comprising applying the bio-organic fertilizer containing Burkholderia paramultivorans in the rhizosphere of grass to the rhizosphere soil of crop plants.

[0026] In the present invention, there is no particular limitation on the application method, and any common fertilization method in the soil in the art can be applied to the present invention.

[0027] In the present invention, there is no particular limitation on the specific dosage of Burkholderia paramultivorans and the bio-organic fertilizer, as long as it can play the role of reducing the incidence of diseases and enhancing the systemic resistance of plant roots.

[0028] According to a preferred embodiment of the present invention, for the above application method, the application amount of the bio-organic fertilizer containing Burkholderia paramultivorans in the rhizosphere of grass is based on the dosage of Burkholderia paramultivorans not less than 1×10 10 cfu / plant / time. Preferably 1×10 10 -3×10 12cfu / strain / time. More preferably, it is 3×10 10 -3×10 12 cfu / strain / time. For example, it can be 3×10 10 cfu / strain / time, 4×10 10 cfu / strain / time, 5×10 10 cfu / strain / time, 6×10 10 cfu / strain / time, 8×10 10 cfu / strain / time, 1×10 11 cfu / strain / time, 5×10 11 cfu / strain / time, 8×10 11 cfu / strain / time, 1×10 12 cfu / strain / time, 2×10 12 cfu / strain / time, 3×10 12 cfu / strain / time, or it can also be any intermediate value between any two of the above values.

[0029] Preferably, the application frequency of the organic fertilizer or biological organic fertilizer containing Paraburkholderia radicincitans is 1 time as base fertilizer applied 15 - 20 days before planting.

[0030] In order to make the objectives, technical solutions and beneficial effects of the present invention clearer, the preferred embodiments of the present invention will be described in detail below to facilitate understanding by those skilled in the art.

[0031] Example 1 Preparation of biological organic fertilizer This example is used to illustrate the preparation process of the biological organic fertilizer provided by the present invention.

[0032] The formula of the biological organic fertilizer is shown in Table 2 in detail, and the detection results of the material components of the decomposed cow dung and rice husks are shown in Table 1 (where the water content is calculated based on the total weight of the material, and the other components are calculated based on the dry matter in the material). The crude protein content is determined by the Kjeldahl method, the crude fiber content is determined by the acid hydrolysis - anthrone colorimetric method, the crude fat content is determined by the Soxhlet extraction method, the nitrogen - free extract content is determined by the near - infrared analysis method, the calcium content is determined by the flame atomic absorption spectrometry method. The lignin content is determined by the acid dissolution method, and the ash content is determined by the slow ashing method. The decomposed cow dung is purchased from Shaanxi Yiruinong Biotechnology Co., Ltd., the rice husks are purchased from Xinqiyuanjia Trading Firm in Xinwu District, the fish protein fertilizer is purchased from Jinan Xinchenxu Chemical Co., Ltd., and the chitin is purchased from Henan Bangrun Chemical Products Co., Ltd.

[0033] Preparation of Paraburkholderia radicincitans inoculant: It includes the following steps: (1) Solid - culture the above - mentioned Paraburkholderia radicincitans in a solid medium to obtain a test - tube strain; (2) Prepare a liquid seed medium and inoculate it with a test tube culture for liquid culture to obtain liquid seeds; (3) Prepare a liquid fermentation medium and inoculate it with the liquid seeds for fermentation.

[0034] In step (1), the Paraburkholderia graminis is inoculated by the method of slant inoculation, and the solid culture is carried out at a temperature of 25 - 30 °C for 40 - 50 h; the solid medium includes: glucose 10 - 12 g / L, agar 15 - 20 g / L, beef extract 3 - 5 g / L, yeast extract 1 - 3 g / L, peptone 10 - 15 g / L, pH = 6.5 - 7.5.

[0035] In step (2), the test tube culture is inoculated into the liquid seed medium, and the liquid culture is carried out at a temperature of 25 - 30 °C and a rotation speed of 200 - 250 r / min for 45 - 50 h; the liquid seed medium includes: peptone 10 - 15 g / L, beef extract 3 - 5 g / L, sodium chloride 10 - 12 g / L, pH = 6.5 - 7.5.

[0036] In this step, the liquid seed medium is preferably sterilized at 120 - 125 °C for 20 - 30 min, and after cooling, a 0.5 - 1.5 cm 2 test tube culture is inoculated into 100 mL of the liquid seed medium, and it is cultured on a shaker at 28 - 30 °C and a rotation speed of 220 - 250 r / min for 45 - 50 h to obtain liquid seeds.

[0037] In step (3), the liquid seeds are inoculated into the liquid fermentation medium at an inoculation amount of 0.05 - 0.1:1 by volume, and are treated at a temperature of 25 - 30 °C and a rotation speed of 200 - 250 r / min for 45 - 50 h; the liquid fermentation medium includes: sucrose 20 - 23 g / L, peptone 10 - 15 g / L, yeast extract 5 - 8 g / L, potassium dihydrogen phosphate 3 - 5 g / L, ammonium sulfate 5 - 8 g / L, calcium carbonate 2 - 4 g / L, pH = 6.5 - 7.5.

[0038] In this step, the liquid fermentation medium is preferably sterilized at 120 - 125 °C for 20 - 30 min, and after cooling, the liquid seeds are inoculated, and it is preferably cultured on a shaker at 28 - 30 °C and a rotation speed of 220 - 250 r / min for 45 - 50 h to obtain a fermentation broth.

[0039] The above preparation steps further include: After the culture is completed, the obtained culture solution is diluted with an appropriate amount of fresh NB medium to obtain a Paraburkholderia graminis liquid bacterium agent with a viable count of about 2×10 10 cfu / mL, and after drying it, a viable count of about 2×1010 Burkholderia parafirmus solid bacterial agent with cfu / g

[0040] Specific preparation method of bio-organic fertilizer: Weigh the raw materials according to the ratio in Table 2 below, then mix and heap the above materials, and seal them tightly with mud after piling up. During the composting period, control the moisture content in the composting materials to be 35±5 wt%, and the temperature to be 55±5 °C. Turn the pile once on the 20th day and the 30th day of composting to obtain the bio-organic fertilizer.

[0041] Table 1 Composition of bio-organic fertilizer materials

[0042] Table 2 Bio-organic fertilizer formula

[0043] Example 2 Bio-organic fertilizer containing Burkholderia parafirmus and its application effect on plants This example is used to illustrate the bio-organic fertilizer containing Burkholderia parafirmus provided by the present invention and its application effect on plants.

[0044] (1) The bio-organic fertilizer used in this example was prepared from Example 1. According to the dosage in Table 3, the bio-organic fertilizer prepared in Example 1 was applied to the rhizosphere soil of plants, and then cultivated under the condition that other conditions were kept the same. Specific fertilization method: 15 - 20 days before crop planting, apply the bio-organic fertilizer as base fertilizer. The dosage is such that the dosage of Burkholderia parafirmus is not less than 1×10 10 cfu / plant / time; The application frequency of Burkholderia parafirmus or bio-organic fertilizer is to apply it once as base fertilizer 15 - 20 days before planting.

[0045] (2) The control group was not treated, and the chemical fertilizer group was conventional fertilization. Among them, urea, superphosphate and potassium sulfate were prepared by themselves, and the weight ratio of N, P, and K was 15.3:9.8:22.8.

[0046] After fertilization, investigate the disease incidence at the harvest stage, record and calculate the control effect, collect the rhizosphere soil of plants and collect the plant roots. Specifically measure the microbial carbon, microbial nitrogen content and soil enzyme activity in the rhizosphere soil of each group of crops, determine the nitrogen absorption utilization rate and potassium absorption amount of plants, and determine the proline content and root activity of plant roots, and determine the prevention and control effect of diseases.

[0047] Disease investigation method: Grade 0: Asymptomatic Grade 1: A small amount of disease spots appear on the roots, 0 - 10%.

[0048] Level 3: 10 - 25% of the root shows partial lesions.

[0049] Level 5: The root is completely infected.

[0050] Level 7: The plant dies.

[0051] The control effect is calculated using the following two formulas: Disease index = [(∑(number of diseased plants at each level × representative level)) / (total number of plants × highest representative level value)] × 100 Control effect (%) = [(disease index of control group - disease index of treatment group) / disease index of control group] × 100%.

[0052] Disease identification: Samples of typical root and stem diseases caused by the infection of Fusarium ( Fusarium oxysporum ), Pythium aphanidermatum ( Pythium aphanidermatum ), and Rhizoctonia solani ( Rhizoctonia solani ) were collected respectively. Using the tissue isolation method, the pathogenic bacteria were isolated and purified to obtain pure cultures of the pathogenic bacteria; according to Koch's postulates, the pure cultures were inoculated in vivo to verify pathogenicity; the pathogenic bacteria were isolated again from the diseased tissues to obtain the same pure cultures as the original inoculum. The pathogenicity of the isolates to the crops was demonstrated through the above verification. On the basis of morphological identification of the isolates, the ITS gene was further used for molecular identification to finally determine the taxonomic status of the pure cultures.

[0053] ITS gene sequence of Fusarium ( Fusarium oxysporum ) (SEQ ID NO.1): CCTGTGAACATACCACTTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACAGCTTGGTGTTGGGACTCGCGTTAATTCGCGTTCCTCAAATTGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAGTAAAACCCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTAAACCCCAACTTCTGAAT Pythium aphanidermatum ( Pythium aphanidermatum ) ITS gene sequence (SEQ ID NO.2): GGGCTGCTTAATTGTAGTCTGCCGATGTATTTTTCAAACCCATTTACCTAATACTGATCTATACTCCAAAAACGAAAGTTTATGGTTTTAATCTATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGTTATGCCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTCTGTGTAGTCAGGGAGAGAGATGGCAGAATGTGAGGTGTCTCGCTGGCTCCCTTTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTAAGATGAAGTGTGATTCTCGAATCGCGGTGATCTGTTTGGATCGCTTTGCGCATTTGGGCGACTTCGGTTAGGACATTAAAGGAAGCAACCTCTATTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGACAGAGTGTGGTTTTCTGTTCTTTCCTTGAGGTGTACCTGAATTGTGTGAGG Rhizoctonia solani Rhizoctonia solani ITS gene sequence (SEQ ID NO.3): AAGTGCACACCTTTCTCTTTCAATCCATACACACCTGTGCACCTGTGAGACCGAAGTTTTCTAGGGGGGGAAGGAACTTTATTGGACCTACTCTCTTTGGACTTCTGTCTACTTAATCTATATAAACTCAATTTATTTTAAAATGAATGTAATGGATGTAACACATCTAATACTAAGTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCTTGGAGCATGCCTGTTTGAGTATCATGAAATCTTCAAAGTCAAACCTTTTGTTAACTCAATTGGTTCTGCTTTGGTATTGGAGGTCTATTGCAGCTTCACACCTGCTCCTCTTTGTGCATTAGCTGGATCTCAGTGTTATGCTTGGTTCCACTCAGCGTGATAAGTTATCTATCGCTGAGGACACCCTGTTAAAAAGGGGTGGCCAAGGTAAATGCAGATGAACTGCTTCTAACAGTCCATTGACTTGGACAAATATTCATTTATGATCTGTCTCAATCAGGAGACACCCAC The determination of microbial biomass carbon (MBC) (mg / kg) in the rhizosphere soil of plants was carried out by the chloroform fumigation incubation method, and the determination of microbial nitrogen content (MBN) (mg / kg) was carried out by the chloroform fumigation-K2SO4 extraction method. The content of proline (μg / g) and root activity (mg / g / h) in plant roots were both determined using a kit purchased from Suzhou Grees Biotechnology Co., Ltd., and the usage method was referred to the instruction manual. The determination method of nitrogen recovery efficiency (NRE) of plants: The nitrogen uptake of crop roots in the experimental treatment group (G N ), and the control treatment group (G O ), and the fertilization amount (N N ) of each treatment was recorded and determined by the Kjeldahl method, and the nitrogen recovery efficiency of plants was calculated using the following formula: NRE (%) = (G N - G O ) / N N × 100. The determination method of potassium uptake (kg / hm -2 ) of plants: Determined by inductively coupled plasma atomic emission spectrometry.

[0054] Determination method for enzyme activity in rhizosphere soil of plants: Cellulase (S-CL) (mg 10g -1 72h -1 ), invertase (S-SC) (mg g -1 d -1 ) were all determined using test kits purchased from Suzhou Grees Biotechnology Co., Ltd., and the usage method was referred to the instruction manual.

[0055] From the data in Tables 4, 5, 6, 7, and 8, it can be seen that when applying the bio-organic fertilizer provided by the present invention, the prevention and control effect on crop diseases, as well as the improvement effects on the content of microbial carbon, microbial nitrogen, proline content of plant roots, root activity, nitrogen uptake and utilization rate of plants, and soil enzyme activity in the rhizosphere soil of plants, are stronger than those of the control.

[0056] Table 3 Test conditions and results of the experiment on the disease prevention and control effect of bio-organic fertilizer

[0057] Table 4 Effects of applying bio-organic fertilizer on the content of microbial carbon and microbial nitrogen in the rhizosphere soil of crops

[0058] Table 5 Effects of applying bio-organic fertilizer on the proline content and root activity of crop roots

[0059] Table 6 Effects of applying bio-organic fertilizer on the nitrogen uptake and utilization rate of plants

[0060] Table 7 Effects of applying bio-organic fertilizer on the potassium uptake amount of plants

[0061] Table 8 Effects of applying bio-organic fertilizer on the enzyme activity in the rhizosphere soil of plants

[0062] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention and are not restrictive. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made in terms of form and details without departing from the scope defined by the claims of the present invention.

Claims

1. A biological organic fertilizer containing Paraburkholderia radicincitans, characterized in that, The biological organic fertilizer contains decomposed cow dung, rice husks, fish protein, chitin and Paraburkholderia graminis ( Paraburkholderia graminis ) bacterial agent in a weight ratio of 140-210:75-110:24-45:11.5-17.1:3; the effective viable count in the Paraburkholderia graminis bacterial agent is not less than 2×10 10 cfu / g; wherein, the preservation number of the Paraburkholderia graminis is CCTCC NO: M20242399.

2. The bio-organic fertilizer containing Paraburkholderia radicincitans according to claim 1, wherein: In the decomposed cow dung, the water content is 10-16% by weight, and based on dry matter, the crude protein content is 10-16% by weight, the crude fiber content is 8-15% by weight, the crude fat content is 0.1-1% by weight, the nitrogen-free extract is 40-60% by weight, and the calcium content is 1-10% by weight; and / or, in the rice husk, the water content is 5-10%, and based on dry matter, the crude fiber content is 30-40% by weight, the lignin content is 20-30% by weight, the crude protein content is 1-5% by weight, the crude fat content is 0.5-2% by weight, and the ash content is 10-20% by weight.

3. Use of the bio-organic fertilizer containing Paraburkholderia graminis according to any one of claims 1-2 in increasing the microbial carbon content and microbial nitrogen content in the rhizosphere soil of plants, increasing the proline content and root activity of plant roots, increasing the nitrogen absorption utilization rate, potassium uptake amount of plants, and the enzyme activity in the rhizosphere soil of plants, and preventing crop diseases.

4. The application according to claim 3, characterized in that: The plant is one or more of snow pea, chayote, and red cabbage. The types of crop diseases to be controlled are: snow pea root rot, chayote root rot, and red cabbage black root disease. The pathogen of snow pea root rot is Fusarium ( Fusarium oxysporum ), the pathogen of chayote root rot is Pythium aphanidermatum ( Pythium aphanidermatum ), and the pathogen of the red cabbage black root disease is Rhizoctonia solani ( Rhizoctonia solani ).

5. A method for increasing the contents of microbial carbon and microbial nitrogen in the rhizosphere soil of plants, increasing the proline content and root activity of plant roots, increasing the nitrogen absorption and utilization rate and potassium uptake of plants, as well as the enzyme activity in the rhizosphere soil of plants, and preventing and controlling crop diseases, characterized in that The method is: applying the bio-organic fertilizer containing Paraburkholderia graminis according to claim 1 or 2 to the soil, with a dosage of 50-60 kg / mu / time, and the application frequency of the bio-organic fertilizer is more than once per crop.

Images