MdAGL11 gene for regulating and controlling size of apple fruit and application of MdAGL11 gene

The MdAGL11 gene addresses the slow apple breeding cycle by regulating fruit size through overexpression or silencing, enabling early prediction of fruit size differences and accelerating the breeding process.

CN120309707AActive Publication Date: 2025-07-15黑龙江省农业科学院牡丹江分院
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510477986.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-16
Publication Date
2025-07-15
Estimated Expiration
2045-04-16

AI Technical Summary

Technical Problem

Existing apple breeding methods are slow due to the long cycle from hybridization to fruiting, and there is a lack of efficient methods to predict or detect apple fruit size differences, hindering rapid fruit size trait identification and accelerating the breeding process.

Method used

Utilization of the MdAGL11 gene to regulate apple fruit size by overexpression or silencing, allowing early prediction of fruit size differences through detecting its expression levels.

Benefits of technology

The MdAGL11 gene effectively regulates apple fruit size, enabling early prediction of fruit size differences and accelerating the breeding process by distinguishing large and small fruit types, thus speeding up the apple breeding process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120309707A_ABST
    Figure CN120309707A_ABST
Patent Text Reader

Abstract

The invention provides an MdAGL11 gene for regulating and controlling the size of an apple fruit and application of the MdAGL11 gene. The nucleotide sequence of the MdAGL11 gene is as shown in SEQ ID NO. 1. By constructing an overexpression vector and a silence vector of the gene MdAGL11, it is proved that the overexpression MdAGL11 gene significantly reduces the size of the apple fruit, the silence MdAGL11 gene significantly increases the size of the apple fruit, and the gene can be used for apple fruit size regulation and control and apple fruit size character related molecular breeding. The MdAGL11 gene can also be used for early prediction of the size of the apple fruit, the size difference of the apple fruit can be judged by detecting the expression level of the report gene MdAGL11, large-fruit-type varieties and small-fruit-type varieties can be distinguished, the purpose of rapidly distinguishing the size of the fruit can be achieved, identification of resources of different fruit sizes is achieved, the breeding process is accelerated, and the breeding efficiency is improved. The method has an important application value for apple breeding development.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biological breeding, and particularly relates to an MdAGL11 gene for regulating apple fruit size and its application. Background Art

[0002] The apple cultivation area and output in China rank first in the world. Apples are rich in nutrients, containing various vitamins and dietary fibers, etc. There is a saying in the West that "an apple a day keeps the doctor away", which fully proves the nutritional value of apples. Apples are perennial deciduous fruit trees. During the breeding process, the period from cross-breeding to fruiting is relatively long, generally taking 5 - 8 years, which restricts the development of apple breeding. The size of apple fruits determines the market value of apples. Usually, for the same variety, the larger the fruit, the higher the price. As an important trait in apple breeding, traditional methods are difficult to quickly identify or predict the difference in fruit size.

[0003] Therefore, in this situation, it is urgently necessary to use molecular breeding means to screen candidate genes for apple fruit size differences, realize the prediction of early fruit size traits, and accelerate the breeding process. This is also the main way for breeders to seek breakthroughs at present. In addition, the existing detection of apple fruit size is still at a blank level. Judging the difference in apple fruit size by detecting the expression changes of related genes is an important way, which is beneficial to realizing the early judgment of the fruit size traits of hybrid offspring and accelerating the apple breeding process. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide an MdAGL11 gene for regulating apple fruit size and its application in view of the deficiencies of the above-mentioned prior art. Overexpression and silencing of the MdAGL11 gene in apples respectively reduce and increase the apple fruit size. Therefore, the MdAGL11 gene can regulate apple fruit size, and the difference in apple fruit size can be judged by detecting the expression changes of the MdAGL11 gene, so as to realize early prediction and accelerate the apple breeding process.

[0005] To solve the above technical problem, the technical solution adopted by the present invention is: an MdAGL11 gene for regulating apple fruit size, the nucleotide sequence of the MdAGL11 gene is shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2.

[0006] The present invention also provides an application of the MdAGL11 gene for regulating apple fruit size. Overexpression of the MdAGL11 gene significantly reduces the transverse diameter, longitudinal diameter and single fruit weight of apple fruits, while silencing the MdAGL11 gene significantly increases the transverse diameter, longitudinal diameter and single fruit weight of apple fruits.

[0007] The present invention also provides another application of the MdAGL11 gene, which is used for molecular breeding related to apple fruit size traits.

[0008] The present invention also provides another application of the MdAGL11 gene, which is used for early prediction of apple fruit size. Taking MdAGL11 as a reporter gene, the expression level of the MdAGL11 gene in apple fruits is detected to judge the difference in apple fruit size, so as to achieve early prediction and accelerate the apple breeding process.

[0009] Due to the adoption of the above technical solutions, the present invention has significant technical effects:

[0010] 1. The present invention provides an MdAGL11 gene for regulating apple fruit size. By constructing an overexpression vector MdAGL11-OE and a silencing vector MdAGL11-AN of MdAGL11, it is proved that overexpression of the MdAGL11 gene significantly reduces the apple fruit size, while silencing of the MdAGL11 gene significantly increases the apple fruit size, which can be used for regulating apple fruit size and molecular breeding related to apple fruit size traits.

[0011] 2. The MdAGL11 gene of the present invention can also be used for early prediction of apple fruit size. By detecting the expression level of the reporter gene MdAGL11 in early apple fruits, the difference in apple fruit size can be judged, and large-fruit varieties and small-fruit varieties can be distinguished, which can achieve the purpose of quickly distinguishing fruit sizes, realize the identification of resources with different fruit sizes, accelerate the breeding process, and has important application value for the development of apple breeding.

[0012] The present invention will be further described in detail below with reference to the drawings and embodiments. Description of the Drawings

[0013] Figure 1 It is the acquisition and expression analysis of the MdAGL11 gene in Example 1 of the present invention. Among them, (a) is the phenotypic appearance during the development of Longfeng (LF) and Longshuohong (GLF) apples, and (b) is the relative expression level of the MdAGL11 gene during the fruit development of Longfeng and Longshuohong apples;

[0014] Figure 2 It is the relative expression level of MdAGL11 in the fruits of overexpressing the MdAGL11 gene (MdAGL11-OE) in Longshuohong (GLF) apples and silencing the MdAGL11 gene (MdAGL11-AN) in Longfeng (LF) apples in Example 3 of the present invention;

[0015] Figure 3This is the fruit phenotype of overexpressing the MdAGL11 gene (MdAGL11-OE) in Longshuo (GLF) apples and silencing the MdAGL11 gene (MdAGL11-AN) in Longfeng (LF) apples in Example 3 of the present invention, bar = 10 mm;

[0016] Figure 4 This is the transverse diameter, longitudinal diameter and single fruit weight of the fruits of overexpressing the MdAGL11 gene (MdAGL11-OE) in Longshuo (GLF) apples and silencing the MdAGL11 gene (MdAGL11-AN) in Longfeng (LF) apples in Example 3 of the present invention;

[0017] Figure 5 This is the analysis of the expression level of the reporter gene MdAGL11 in different apple cultivars in Example 4 of the present invention. Detailed implementation mode

[0018] Example 1

[0019] This example is for the acquisition and identification of the MdAGL11 gene.

[0020] Through the transcriptome analysis of Longfeng (LF) and its large-fruit bud sport Longshuo (GLF), the differentially expressed MdAGL11 gene was found.

[0021] Through fluorescence quantitative PCR (qRT-PCR) to analyze the relative expression levels of the MdAGL11 gene during the fruit development of Longfeng (LF) and Longshuo (GLF) apples, the detection method is as follows: taking MdAGL11 as the reporter gene, using fluorescence quantitative PCR to analyze the expression level of the MdAGL11 gene in apple fruits, and selecting MdAction as the internal reference gene to calculate the relative gene expression levels, which specifically include the following steps:

[0022] (1) RNA extraction and reverse transcription

[0023] Extract RNA from apple fruits using the CTAB method. Put 0.2 g of the fruit sample ground in liquid nitrogen into a 2-mL centrifuge tube. Add 600 μL of 4% CTAB (10 mL of 1 M Tris-HCl buffer, 8.182 g of NaCl, 2 g of CTAB, 4 mL of EDTA) to the centrifuge tube, and then add 20 μL of β-mercaptoethanol. Place the centrifuge tube in a 65°C water bath and heat for 20 min. Add 600 μL of isoamyl alcohol and chloroform (1:24) to the centrifuge tube, and centrifuge at 12,000 rpm and 4°C for 10 min; after sucking out the supernatant, add an equal volume of isoamyl alcohol and chloroform (1:24) liquid, and centrifuge at 12,000 rpm and 4°C for 10 min; suck out the supernatant and add 1 / 4 volume of LiCl, and let it stand at -20°C for 12 h; after taking it out, centrifuge at 12,000 rpm and 4°C for 15 min; remove the liquid, put 600 μL of 75% ethanol into the centrifuge tube, mix well, and centrifuge at 12,000 rpm and 4°C for 10 min; remove the supernatant, put 600 μL of absolute ethanol into the centrifuge tube, mix well, and centrifuge at 12,000 rpm and 4°C for 10 min; remove the supernatant, place the centrifuge tube on ice for 2 min to allow the alcohol to evaporate, add 10 μL of DEPC water with a concentration of 1 g / L to the centrifuge tube to dissolve the RNA, and measure the RNA concentration using NanoDrop2000. Reverse transcribe 1 μg of RNA into cDNA using the M-MLV RTase cDNA Synthesis kit (D6130; TaKaRa, Shiga, Japan), and the operation is carried out according to the instructions.

[0024] (2) Fluorescent quantitative PCR reaction

[0025] Design gene expression primers online using Primer-BLAST of NCBI, the primers for the reporter gene MdAGL11 and the internal reference gene MdAction, as shown in Table 1.

[0026] Table 1 Names and sequences of fluorescent quantitative PCR primers

[0027] Primer Name Primer (5'-3') MdAGL11-F TTCAAATGCTGCAGAACTCT MdAGL11-R GACCTGATTCTAGTAATGCC MdActin-F GGCTGGATTTGCTGGTGATG MdActin-R TGCTCACTATGCCGTGCTCA

[0028] The reaction system for fluorescent quantitative PCR is 10 μL, and the SYBR Green qPCR Master Mix enzyme used is purchased from Beijing TransGen Biotech Co., Ltd.:

[0029] Table 2 Fluorescent quantitative PCR reaction system

[0030]

[0031]

[0032] The fluorescence quantitative PCR reaction program is as follows:

[0033] Table 3 Fluorescence quantitative PCR reaction program

[0034]

[0035] Figure 1 (a) shows the phenotypes during the development of Longfeng (LF) and Longshuohong (GLF) apples. Figure 1 (b) shows the relative expression levels of the MdAGL11 gene during the fruit development of Longfeng (LF) and Longshuohong (GLF) apples. ** indicates extremely significant differences (p < 0.01), and the error bars represent the standard deviation (SD) of three biological replicates. It was found that the expression level of the MdAGL11 gene during the development of Longshuohong and Longfeng apples was significantly lower in Longshuohong than in Longfeng apples, and the trend was opposite to that of the fruit differences, indicating that the MdAGL11 gene may negatively regulate apple fruit size.

[0036] Example 2

[0037] This example is about the cloning of the MdAGL11 gene and the MdAGL11 promoter.

[0038] 1. Primer design for the MdAGL11 gene and the MdAGL11 promoter

[0039] Total RNA was extracted from apple fruits, and cDNA was obtained after reverse transcription using a reverse transcription kit. The full-length sequence of the MdAGL11 gene was found through the transcriptome results (PRJNA551702), and the MdAGL11 promoter sequence was found from the apple genome (https: / / iris.angers.inra.fr / gddh13 / ). Primer Premier 6 was used to design the full-length primers for the MdAGL11 gene and the promoter primers.

[0040] Table 4 Names and sequences of MdAGL11 nucleotide primers

[0041] Primer Name Primer (5'-3') MdAGL11-w-F ATGGGGAGGGGAAAGATTGAAAT MdAGL11-w-R TTACCCAAGATGGAGGTTCTTCT

[0042] Table 5 Names and sequences of MdAGL11 promoter primers

[0043] Primer Name Primer (5'-3') MdAGL11-pro-F CTTGAAGGGCATTTTAGTCAGG MdAGL11-pro-R CTTAATATCTGATTACTTTGAT

[0044] 2. PCR reaction

[0045] The PCR reaction system was 50 μL:

[0046] Table 6 PCR reaction system

[0047]

[0048] The PCR reaction procedure is as follows:

[0049] Table 7 PCR reaction procedure

[0050]

[0051] After the reaction, add 0.5 μL of r Tap and 3 μL of dNTP Mixture to the product, and place it in a 72 °C metal bath for 20 min. The amplified fragments were analyzed by agarose gel electrophoresis.

[0052] 3. Purification and transformation of PCR products

[0053] Using a PCR product purification kit (EG101-01, TransGen Biotech, Beijing), purify the full-length sequence of the above MdAGL11 gene and the MdAGL11 promoter product, and ligate them to the pEASY-T1 vector (TransgenBiotech, Beijing). After transforming Escherichia coli, after colony PCR, the positive colonies were cultured in liquid medium and then sequenced by Shanghai Sangon Biotech Co., Ltd. (Shanghai, China). The full-length sequence of the MdAGL11 gene was obtained as shown in SEQ ID NO.1, and the MdAGL1 promoter sequence was obtained as shown in SEQ ID NO.3.

[0054] Example 3

[0055] This example is for the verification of the expression function of the MdAGL11 gene.

[0056] 1. Construction of overexpression and silencing vectors

[0057] (1) Construction of overexpression vector

[0058] Using a seamless cloning kit (cat.no.D7010M, Beyotime, Shanghai), ligate the full-length fragment of the cloned MdAGL11 gene to the pRI101 vector (driven by the 35S promoter) containing NdeI and SacI restriction endonuclease sites according to the instructions to obtain the MdAGL11 gene overexpression vector MdAGL11-OE.

[0059] (2) Construction of silencing vector

[0060] The silencing vector was obtained by reverse connection. The full-length fragment of the cloned MdAGL11 gene was ligated to the pRI101 vector (driven by the 35S promoter) containing SacI and NdeI restriction endonuclease sites using a seamless cloning kit (cat.no.D7010M, Beyotime, Shanghai) according to the instructions, resulting in the MdAGL11 gene silencing vector MdAGL11-AN.

[0061] The primers used for the construction of overexpression and silencing vectors are shown in Table 8.

[0062] Table 8 Primer names and sequences

[0063]

[0064]

[0065] 2. Apple genetic transformation

[0066] The constructed MdAGL11 gene overexpression vector MdAGL11-OE and silencing vector MdAGL11-AN were separately transformed into Agrobacterium. The pRI101 empty vector (Empty vector) was used as a control and coated on YEP solid medium (containing Rif 50 μg mL -1 and Kana 50 μg mL -1 ), and cultured in an incubator at 28 °C for 2 - 3 d. After the strains grew, the positive monoclonal colonies were dissolved in 5 mL of YEP liquid medium (containing 50 μg mL -1 Kana and 50 μg mL -1 Rif), cultured overnight at 28 °C with 200 rpm for 12 h. 100 μL of the bacteria was taken and transferred to 50 mL of YEP liquid medium (Rif concentration 50 μgmL -1 ), cultured at 28 °C. When the OD of the bacterial liquid 600 = 0.8, it was centrifuged at 7000 rpm for 5 min at 4 °C, and the supernatant was removed. The bacteria were resuspended with 5 mL of H2O, then the centrifuge tube was placed in a 4 °C centrifuge and centrifuged at 7000 rpm for 5 min to remove the supernatant, and injection suspension was added [1 mL of 1 M MgCl2, 1 mL of 1 M MES, and 100 μL of 100 mM acetosyringone were added to every 100 mL] until the OD 600= 0.8, injected into apple fruits 30 d after full bloom. The MdAGL11 gene (MdAGL11-OE) was overexpressed in Longshuo (GLF) apples, and the MdAGL11 gene (MdAGL11-AN) was silenced in Longfeng (LF) apples. After 25 d, qRT-PCR was used to detect the relative expression levels of the MdAGL11 gene in the overexpressed and silenced fruits, and the transverse diameter, longitudinal diameter, and single fruit weight of the fruits were investigated.

[0067] The results of detecting the relative expression levels of MdAGL11 in fruits overexpressing the MdAGL11 gene (MdAGL11-OE) in Longshuo (GLF) apples and silencing the MdAGL11 gene (MdAGL11-AN) in Longfeng (LF) apples by qRT-PCR are as Figure 2 shown; the fruit phenotypes of overexpressing the MdAGL11 gene (MdAGL11-OE) in Longshuo (GLF) apples and silencing the MdAGL11 gene (MdAGL11-AN) in Longfeng (LF) apples are as Figure 3 shown, bar = 10 mm; the transverse diameter, longitudinal diameter, and single fruit weight of fruits overexpressing the MdAGL11 gene (MdAGL11-OE) in Longshuo (GLF) apples and silencing the MdAGL11 gene (MdAGL11-AN) in Longfeng (LF) apples were measured with a digital display vernier caliper and an electronic balance, and the results are as Figure 4 shown, ** indicates extremely significant difference (p < 0.01), and the error bars are the standard deviations (SD) of 10 biological replicates; the results show that overexpression of the MdAGL11 gene significantly reduced the apple fruit size, and silencing of the MdAGL11 gene significantly increased the apple fruit size.

[0068] Example 4

[0069] This example is the expression analysis of the MdAGL11 gene in different apple varieties.

[0070] The experimental materials of apple varieties with different fruit sizes were collected from the Liaoning Institute of Pomology in Xiongyue Town, Yingkou City, Liaoning Province and Shenyang Agricultural University, as follows:

[0071] Table 9 Germplasm resources of apples

[0072] Number Name of Small-Fruit Variety Number Name of Large-Fruit Variety 1 Jinhong 1 Wangshanhong 2 Zixiang 2 Liangxiang 3 Kulun Shaguo 3 Dongguang 4 Honglingdang 4 Hanfu 5 Saiwaihong 5 Golden Delicious 6 Longguan 6 Orin

[0073] The expression levels of 6 large apple varieties and 6 small apple varieties were analyzed using the reporter gene MdAGL11, and the results are as Figure 5 shown. It was found that the expression levels of the MdAGL11 gene in 6 small fruit varieties were significantly higher than those in 6 large apple varieties, and large-fruited and small-fruited apple varieties could be effectively distinguished.

[0074] The present invention provides an MdAGL11 gene for regulating fruit size. It has been verified through transient function that the MdAGL11 gene can regulate apple fruit size. By detecting the expression level of the reporter gene MdAGL11 in early apple fruits, the difference in apple fruit size can be judged, large-fruit varieties and small-fruit varieties can be distinguished, the purpose of quickly distinguishing fruit size can be achieved, the prediction of early fruit size traits can be realized, and the breeding process can be accelerated.

[0075] As mentioned above, it is only a preferred embodiment of the present invention and does not impose any limitation on the present invention. Any simple modification, change and equivalent change made to the above embodiments according to the technical essence of the invention still fall within the protection scope of the technical solution of the present invention.

Claims

1. An MdAGL11 gene for regulating apple fruit size, characterized in that, The nucleotide sequence of the MdAGL11 gene is shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.

2.

2. Use of the MdAGL11 gene according to claim 1, characterized in that, The MdAGL11 gene is used for regulating apple fruit size.

3. The application according to claim 2, characterized in that, Overexpression of the MdAGL11 gene significantly reduced the transverse diameter, longitudinal diameter and single fruit weight of apple fruits, while silencing the MdAGL11 gene significantly increased the transverse diameter, longitudinal diameter and single fruit weight of apple fruits.

4. Use of the MdAGL11 gene according to claim 1, characterized in that, The MdAGL11 gene is used for molecular breeding related to apple fruit size traits.

5. Use of the MdAGL11 gene according to claim 1, characterized in that The MdAGL11 gene is used for early prediction of apple fruit size.

6. The application according to claim 5, characterized in that, Using MdAGL11 as a reporter gene, the difference in apple fruit size is judged by detecting the expression level of the MdAGL11 gene in apple fruits, so as to achieve early prediction and accelerate the apple breeding process.

Citation Information

Patent Citations

  • Gene for regulating and controlling shape and size of apple and application

    CN113278627A

  • Application of apple MdAP2-like gene in simultaneous regulation and control of fruit softening and fruit size

    CN117721144A

  • Application of gene in enlarging tomato fruits

    WO2022052381A1