Development and application of molecular markers for the gene BnaGH related to 1000-grain weight in rapeseed

By developing the molecular marker BnaGH related to the thousand-grain weight of rapeseed and its primer pair, and using PCR amplification technology to identify the thousand-grain weight of Brassica napus, the problem of unclear genetic mechanism in rapeseed breeding was solved, and rapid screening and improved breeding efficiency were achieved.

CN120310959BActive Publication Date: 2025-09-12YAZHOUWAN NATIONAL LABORATORY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510820774.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-19
Publication Date
2025-09-12
Estimated Expiration
2045-06-19

AI Technical Summary

Technical Problem

In the existing technology, the genetic mechanism of rapeseed 1000-grain weight is unclear, and there is a lack of effective molecular markers for assisted selection and breeding, resulting in a slow progress in the breeding of rapeseed with high 1000-grain weight.

Method used

The molecular marker BnaGH and its primer pair related to the 1000-grain weight of Brassica napus were developed. The 1000-grain weight was identified by PCR amplification technology. The primer pairs were designed to amplify specific fragments of electrophoresis bands of 134bp and 127bp for screening and breeding.

Benefits of technology

It has achieved rapid and accurate identification of the thousand-grain weight of Brassica napus, improved breeding efficiency, screened out high-quality varieties with high thousand-grain weight, and improved rapeseed germplasm resources. It is easy to operate and low-cost.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120310959B_ABST
    Figure CN120310959B_ABST
Patent Text Reader

Abstract

The present invention relates to the field of molecular biology technology, and in particular to the development and application of a molecular marker for the BnaGH gene related to the thousand-grain weight of rapeseed. The present invention develops a dedicated molecular marker and primer pair based on the BnaA09.GH gene. In a specific embodiment of the present invention, the molecular marker and primer pair are used to identify the thousand-grain weight of Brassica napus. The results show that if only a 134bp molecular marker electrophoresis band can be amplified using the primer pair, the Brassica napus to be tested is identified as a Brassica napus with low thousand-grain weight; if only a 127bp molecular marker electrophoresis band can be amplified using the primer pair, the Brassica napus to be tested is identified as a Brassica napus with low thousand-grain weight. This shows that the molecular marker and primer pair can quickly identify differences in the thousand-grain weight of rapeseed, can be directly used to screen high-quality varieties with high thousand-grain weight, and can greatly improve breeding efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and in particular to the development and application of a BnaGH molecular marker, a gene related to rapeseed 1000-grain weight. Background Art

[0002] Thousand-grain weight is a core component of crop yield, and understanding its genetic regulatory network is crucial for overcoming yield bottlenecks. In-depth studies in model plants such as Arabidopsis thaliana and rice have revealed the coordinated role of multiple pathways, including hormone signaling, ubiquitin modification, and G protein interactions, in regulating seed weight. Within the hormone signaling pathway, auxin (e.g., OsSK41 / BG1) and brassinosteroids (e.g., GS5 / GW5) dynamically coordinate to control cell division and expansion. In the ubiquitin-proteasome system, dynamic regulation of protein degradation (e.g., GW2) influences the cell cycle and cell proliferation. Furthermore, G protein signaling (e.g., GS3 / DEP1) forms a core regulatory network with the MAPK cascade (e.g., OsMKKK10), acting in concert with transcription factors such as ANT, AP2, and TTG2 to precisely control seed weight by regulating processes such as cell division, elongation, and differentiation. Rapeseed oil is a major source of edible vegetable oil. As a key factor influencing rapeseed yield, thousand-grain weight is a key improvement area for the selection and breeding of new rapeseed varieties.

[0003] Thousand-grain weight in rapeseed is a typical quantitative trait whose genetic mechanisms remain unclear. Previous studies have mapped multiple QTLs for 1000-grain weight in Brassica napus, but only a few genes have been cloned and functionally characterized. Therefore, there is an urgent need to develop new molecular markers related to 1000-grain weight to enrich their application. Summary of the Invention

[0004] The present invention aims to develop and apply a molecular marker for the BnaGH gene, which is associated with 1000-grain weight in rapeseed, to address the aforementioned problems in the prior art. The molecular marker and primer pairs provided by the present invention can detect high and low 1000-grain weight in Brassica napus, thereby assisting in the selection and breeding of varieties with high 1000-grain weight, and accelerating the breeding process for Brassica napus varieties with high 1000-grain weight.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides a molecular marker related to the 1000-grain weight trait of Brassica napus. The molecular marker comprises a molecular marker I whose nucleotide sequence is shown as SEQ ID NO.1 and a molecular marker II whose nucleotide sequence is shown as SEQ ID NO.2; wherein, the molecular marker I is related to the low 1000-grain weight trait of Brassica napus, and the molecular marker II is related to the high 1000-grain weight trait of Brassica napus.

[0007] The present invention provides a primer pair for amplifying the above-mentioned molecular marker, wherein the primer pair comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO.3 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.4.

[0008] The present invention provides a reagent or kit for detecting molecular markers, wherein the reagent or kit comprises the above-mentioned primer pair.

[0009] The present invention provides the use of the above-mentioned molecular marker, the above-mentioned primer pair or the above-mentioned reagent or kit in identifying the high and low 1000-grain weight of Brassica napus.

[0010] The present invention provides a method for identifying the 1000-grain weight of Brassica napus, the method comprising the following steps:

[0011] The genomic DNA of the Brassica napus to be tested is used as a template, and the template is amplified by PCR using the primer pair mentioned above. The 1000-grain weight of the Brassica napus to be tested is determined by the PCR amplification result.

[0012] Preferably, if only a 134bp molecular marker electrophoresis band can be amplified using the primer pair, the Brassica napus to be tested is identified as Brassica napus with low 1000-grain weight; if only a 127bp molecular marker electrophoresis band can be amplified using the primer pair, the Brassica napus to be tested is identified as Brassica napus with high 1000-grain weight.

[0013] Preferably, the PCR amplification reaction system is: 5 μL 2×Taq Plus Master Mix, 0.25 μL forward primer, 0.25 μL reverse primer, 2 μL DNA template, 2.5 μL ddH2O;

[0014] The PCR amplification reaction program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 56°C or 58°C for 15 s, and extension at 72°C for 1 min, for 35 cycles; and finally extension at 72°C for 5 min.

[0015] The present invention provides the use of the above-mentioned molecular marker, the above-mentioned primer pair or the above-mentioned reagent or kit in screening Brassica napus with high 1000-grain weight.

[0016] The present invention provides the use of the above-mentioned molecular marker, the above-mentioned primer pair or the above-mentioned reagent or kit in molecular marker-assisted breeding of Brassica napus.

[0017] The present invention provides the use of the above-mentioned molecular marker, the above-mentioned primer pair or the above-mentioned reagent or kit in improving Brassica napus germplasm resources.

[0018] The present invention discloses the following technical effects:

[0019] The present invention provides a molecular marker and primer pair related to the 1000-grain weight trait of Brassica napus. The molecular marker and primer pair can detect the high and low 1000-grain weight of Brassica napus, thereby assisting in the selection and breeding of varieties with high 1000-grain weight, and accelerating the process of breeding Brassica napus with high 1000-grain weight. A specific embodiment of the present invention utilizes the molecular marker and primer pair to identify the 1000-grain weight of Brassica napus. The results show that if only a 134bp molecular marker electrophoresis band is amplified using the primer pair, the Brassica napus to be tested is identified as a Brassica napus with low 1000-grain weight; if only a 127bp molecular marker electrophoresis band is amplified using the primer pair, the Brassica napus to be tested is identified as a Brassica napus with high 1000-grain weight. This shows that the molecular marker and primer pair can quickly identify the difference in the 1000-grain weight of rapeseed, and can be directly used to screen high-1000-grain weight excellent varieties. It can also be used for molecular marker-assisted breeding of Brassica napus and improvement of Brassica napus germplasm resources, which can greatly improve breeding efficiency. The invention provides resource materials for improving the thousand-grain weight of rapeseed.

[0020] At the same time, the present invention also provides a method for identifying the 1000-grain weight of Brassica napus. The method is simple to operate, has the advantages of rapid detection, accurate results, low cost, etc., is not affected by the planting environment, and is suitable for large-scale application. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0022] Figure 1 This is a schematic diagram of the 1000-grain weight distribution results of the Brassica napus associated population over multiple years and multiple locations in the present invention;

[0023] Figure 2 This is a Manhattan plot of the genome-wide association analysis using the thousand-grain weight phenotype of the associated population of Brassica napus combined with genomic variation in the present invention;

[0024] Figure 3 Schematic diagram of haplotype analysis using molecular markers of the 1000-grain weight gene BnaA09.GH of Brassica napus in the present invention;

[0025] Figure 4 These are the molecular marker gel electrophoresis images of different rapeseed varieties; among them, HapA is for 8 rapeseed germplasms with low 1000-grain weight (numbered 1-8); HapB is for 9 rapeseed germplasms with high 1000-grain weight (numbered 9-17). DETAILED DESCRIPTION

[0026] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0027] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0028] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0029] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0030] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0031] Example 1

[0032] 1. Planting of related populations and determination of thousand-grain weight

[0033] A total of 505 Brassica napus accessions were planted in the experimental fields of the Rapeseed Engineering Research Center at Huazhong Agricultural University in 2012-2013, 2013-2014, 2015-2016, and 2016-2017 (codes WH2013, WH2014, WH2016, and WH2017), in the experimental fields of the Anhui Academy of Agricultural Sciences in Hefei in 2016-2017 and 2017-2018 (codes HF2017 and HF2018), and in the experimental fields of the Sichuan Academy of Agricultural Sciences in Chengdu in 2016-2017 (code CD2017). Each accession was planted in two rows, with 12 plants per row, a plant spacing of 21 cm, and a row spacing of 30 cm. Field management followed standard field practices.

[0034] After maturity, 6 open-pollinated plants with uniform growth were selected for each material. After harvesting, the whole plant was hung in a hanging storage room to dry naturally. The whole plant was threshed and weeded. About 800 seeds were selected from each plant and the thousand-grain weight was measured on the SC-G seed tester of Wanshen Testing Technology Co., Ltd. The instrument was provided by our laboratory. The average value of the 6 repeated measurements for each material was used as the thousand-grain weight value. Figure 1 shown.

[0035] 2. Genome Resequencing Data Analysis

[0036] The Brassica napus Darmor reference genome was downloaded (http: / / www.genoscope.cns.fr / brassicanapus / ) (Chalhoub et al. 2014). Sequence alignment was performed using BWA software (Li, 2013). Duplicate PCR fragments were removed and sequences were filtered using SAMTools (Li et al. 2009). Sequence variants were identified and merged among 505 Brassica napus accessions using GATK (McKenna et al. 2010). SNPs and indels with low mapping quality (MQ < 20) or low sequencing depth (DP < 50) were also filtered. After genotypes were obtained, missing genotypes were supplemented using the LD-KNN algorithm (Chen et al. 2014). The resulting sequencing data had an accuracy of >99.7%.

[0037] 3. Genome-wide association analysis

[0038] 1. A total of 10,620,048 high-quality SNPs (MAF>0.05) were identified, and the significance threshold for association was calculated using GEC software (Li et al., 2011). Subsequently, a mixed linear model was employed using the GEMMA software package (Zhou et al., 2012) to identify genome-wide QTLs associated with 1000-grain weight.

[0039] 2. A major QTL locus for 1000-seed weight (qTSW.A09) was identified on the A09 chromosome of Brassica napus, and the 100 kb before and after the lead SNP was defined as the QTL interval ( Figure 2 ).

[0040] 3. Haplotype analysis was performed on the candidate genes, among which the haplotype differences of the BnaA09.GH gene were significant in different varieties of the population. Therefore, this gene was selected as the key candidate gene in this QTL interval for subsequent functional verification.

[0041] 4. Haplotype Identification and Molecular Marker Development of the Candidate Gene BnaA09.GH

[0042] 1. Analysis of the BnaA09.GH promoter, 3'-UTR, and coding region sequences in the associated population identified two haplotypes (HapA and HapB). The nucleotide sequences of HapA and HapB are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively. The average 1000-grain weight of the materials with the HapA haplotype was 3.3g±0.3g, and the average 1000-grain weight of the materials with the HapB haplotype was 3.6g±0.4g. The 1000-grain weight phenotypes of the haplotypes differed significantly ( Figure 3 ).

[0043] 2. Based on the sequence of the BnaA09.GH haplotype, the linked marker for the BnaA09.GH gene, BnaA09g39750D, was named 9750. Related molecular markers were designed and developed based on the HapA and HapB haplotypes. The nucleotide sequences of the primer pairs used to amplify the molecular markers are shown below:

[0044] Sequence of molecular marker:

[0045] HapA: CTCAAGGAAAGATGTGATCAAG AATTGCATATTATGTACTTATCCGTTTTTTTTGCTCTCACACTATACACACAACAATCAACAGTTTGTACACAAAATTGTAATCACATATTA CAAGCACGCATAATATACAC , SEQID NO.1;

[0046] HapB: CTCAAGGAAAGATGTGATCAAG AATTGCATATACTTATCCGTTTTTTTTTCTCTC ACTATACACACAACAATCAACAGTTTGTACACAAAATTGTAATCAACATAATA CAAGCACGCATAATATACAC , SEQ ID NO.2;

[0047] Note: The underlined primers are designed and developed molecular markers.

[0048] Nucleotide sequences of primer pairs used to amplify molecular markers:

[0049] Forward primer (9750-F): CTCAAGGAAAGATGTGATCAAG, SEQ ID NO. 3;

[0050] Reverse primer (9750-R): GTGTATATTATGCGTGCTTG, SEQ ID NO.4.

[0051] Example 2

[0052] A method for identifying the 1000-grain weight of a test Brassica napus plant (a method for genotyping the test Brassica napus plant using primers 9750-F (SEQ ID NO. 3) and 9750-R (SEQ ID NO. 4)) is provided, comprising the following steps:

[0053] (1) Extraction of rapeseed leaf DNA using the CTAB method

[0054] a. Take 1 cm thick young leaves from each plant 2 Place in a 2 mL centrifuge tube, add steel beads, add 250 μL of 2% CTAB, grind on a grinder for 5 min, and then add 500 μL of CTAB to the centrifuge tube;

[0055] b. Place in a 65°C water bath for 60 minutes, shaking every 15 minutes;

[0056] c. Cool the homogenate to room temperature after water bathing, and add a 24:1 volume ratio of chloroform to isoamyl alcohol mixture to the centrifuge tube. Gently mix by inversion for 15 minutes, and then centrifuge at 12,000 rpm for 10 minutes.

[0057] d. Place the centrifuged tubes in order on the operating plate and aspirate 500 μL of the supernatant into a new 1.5 mL centrifuge tube.

[0058] e. Add 50 μL of potassium acetate (KAc) solution to the supernatant, followed by 500 μL of ice-cold ethanol. Cover the centrifuge tube and gently shake it a few times to thoroughly mix the ice-cold ethanol and supernatant. Place the tube in a -20°C refrigerator for 20-30 minutes to allow the genomic DNA to precipitate.

[0059] f. Centrifuge the tube at 12,000 rpm for 6 minutes, discard the supernatant, add 500 μL of 75% ethanol, let it stand for another 5 minutes, discard the supernatant, and repeat this process. The precipitate is genomic DNA.

[0060] g. The centrifuge tube containing the DNA was placed in a fume hood to dry, thereby obtaining genomic DNA from each plant;

[0061] h. Add 200 μL of ddH2O to the air-dried centrifuge tube containing DNA to dissolve the DNA. After dissolution, store at -20°C.

[0062] (2) PCR amplification of molecular markers

[0063] PCR amplification was performed using the aforementioned forward and reverse primers as primer pairs, using genomic DNA from the Brassica napus plants to be tested, extracted using the CTAB method, as a template. The PCR amplification reaction system was 10 μL. Each PCR amplification system is shown in Table 1.

[0064] Table 1 PCR amplification system

[0065] Components Volume (μL) Vazyme 2×Taq Plus Master Mix 5 DNA template 2 10 μM forward primer (9750-F, SEQ ID NO. 3) 0.25 10 μM reverse primer (9750-R, SEQ ID NO. 4) 0.25 <![CDATA[Ultra-pure water (ddH2O)]]> 2.5

[0066] The PCR reaction program was as follows: pre-denaturation at 94°C for 5 min, 1 cycle; denaturation at 94°C for 30 s, annealing at 56°C or 58°C for 30 s, extension at 72°C for 1 min, for a total of 35 cycles; extension at 72°C for 5 min, 1 cycle; and finally storage at 4°C.

[0067] (3) Amplification products and electrophoresis analysis

[0068] The PCR products were analyzed by polyacrylamide gel electrophoresis. The primer pair used for the DNA template of Brassica napus with low 1000-grain weight germplasm could amplify a band of about 134 bp, while the primer pair used for the DNA template of Brassica napus with high 1000-grain weight germplasm could amplify a band of about 127 bp.

[0069] Example 3

[0070] In this example, haplotype materials with extreme 1000-grain weight phenotypes were screened from 505 resequenced natural populations (505 Brassica napus samples in Example 1), wherein materials numbered 1-8 were low 1000-grain weight recombinant materials, and materials numbered 9-17 were high 1000-grain weight materials.

[0071] The genotypes of the materials numbered 1-17 were identified using the method in Example 2, and the PCR products were analyzed using polyacrylamide gel electrophoresis. The results were as follows: Figure 4The results showed that the primer pair used as a template for DNA from rapeseed germplasm with low 1000-grain weight (2.65g ± 0.05g) amplified a band of approximately 134bp (numbered 1-8), while the primer pair used as a template for DNA from rapeseed germplasm with high 1000-grain weight (4.87g ± 0.15g) amplified a band of approximately 127bp (numbered 9-17). This indicates that the molecular markers and primer pairs provided by the present invention can effectively distinguish between rapeseed germplasm with low and high 1000-grain weights. Furthermore, the molecular markers and primer pairs can also be used for molecular marker-assisted breeding of Brassica napus and improvement of Brassica napus germplasm resources, significantly improving breeding efficiency.

[0072] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A molecular marker associated with the 1000-grain weight trait of Brassica napus, characterized in that: The molecular markers include a molecular marker I whose nucleotide sequence is shown in SEQ ID NO.1 and a molecular marker II whose nucleotide sequence is shown in SEQ ID NO.2; wherein, the molecular marker I is associated with the low thousand-grain weight trait of Brassica napus, and the molecular marker II is associated with the high thousand-grain weight trait of Brassica napus.

2. Use of a primer pair for amplifying the molecular marker according to claim 1 or a reagent or kit for detecting the molecular marker according to claim 1 in identifying high and low 1000-grain weight of Brassica napus, characterized in that: The primer pair includes a forward primer having a nucleotide sequence as shown in SEQ ID NO.3 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.4; the reagent or kit includes the primer pair; If only a 134bp molecular marker electrophoresis band can be amplified using the primer pair, the Brassica napus to be tested is a Brassica napus with a low 1000-grain weight; if only a 127bp molecular marker electrophoresis band can be amplified using the primer pair, the Brassica napus to be tested is a Brassica napus with a high 1000-grain weight.

3. A method for identifying the 1000-grain weight of Brassica napus, characterized in that: The method comprises the following steps: Using the genomic DNA of the Brassica napus to be tested as a template, PCR amplification is performed on the template using the primer pair for amplifying the molecular marker according to claim 1, and the 1000-grain weight of the Brassica napus to be tested is determined using the PCR amplification result; the primer pair comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO. 3 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO. 4; If only a 134bp molecular marker electrophoresis band can be amplified using the primer pair, the Brassica napus to be tested is identified as Brassica napus with low 1000-grain weight; if only a 127bp molecular marker electrophoresis band can be amplified using the primer pair, the Brassica napus to be tested is identified as Brassica napus with high 1000-grain weight.

4. The method according to claim 3, characterized in that The PCR amplification reaction system was as follows: 5 μL 2× TaqPlus Master Mix, 0.25 μL forward primer, 0.25 μL reverse primer, 2 μL DNA template, and 2.5 μL ddH2O; The PCR amplification reaction program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 56°C or 58°C for 15 s, extension at 72°C for 1 min, 35 cycles; and extension at 72°C for 5 min.

5. Use of a primer pair for amplifying the molecular marker according to claim 1 or a reagent or kit for detecting the molecular marker according to claim 1 in screening Brassica napus with high 1000-grain weight, characterized in that: The primer pair includes a forward primer having a nucleotide sequence as shown in SEQ ID NO.3 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.4; the reagent or kit includes the primer pair; If only a 134bp molecular marker electrophoresis band can be amplified using the primer pair, the Brassica napus to be tested is a Brassica napus with a low 1000-grain weight; if only a 127bp molecular marker electrophoresis band can be amplified using the primer pair, the Brassica napus to be tested is a Brassica napus with a high 1000-grain weight.

6. Use of a primer pair for amplifying the molecular marker according to claim 1 or a reagent or kit for detecting the molecular marker according to claim 1 in molecular marker-assisted breeding of Brassica napus, characterized in that: The primer pair includes a forward primer having a nucleotide sequence as shown in SEQ ID NO.3 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.4; the reagent or kit includes the primer pair; If only a 134bp molecular marker electrophoresis band can be amplified using the primer pair, the Brassica napus to be tested is a Brassica napus with a low 1000-grain weight; if only a 127bp molecular marker electrophoresis band can be amplified using the primer pair, the Brassica napus to be tested is a Brassica napus with a high 1000-grain weight.

7. Use of a primer pair for amplifying the molecular marker according to claim 1 or a reagent or kit for detecting the molecular marker according to claim 1 in improving Brassica napus germplasm resources, characterized in that: The primer pair includes a forward primer having a nucleotide sequence as shown in SEQ ID NO.3 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.4; the reagent or kit includes the primer pair; If only a 134bp molecular marker electrophoresis band can be amplified using the primer pair, the Brassica napus to be tested is a Brassica napus with a low 1000-grain weight; if only a 127bp molecular marker electrophoresis band can be amplified using the primer pair, the Brassica napus to be tested is a Brassica napus with a high 1000-grain weight.