ATP7B gene therapy

Abstract

Provided herein are improved expression constructs for the expression of ATP7B, vectors and pharmaceutical compositions comprising such constructs. Also provided are methods of treating diseases, including but not limited to Wilson's disease.

Description

[0001] Cross - reference to related applications

[0002] This application claims the benefit of the earlier filing date of U.S. Provisional Patent No. 63 / 379,113, filed Oct. 11, 2022, under 35 U.S.C. § 119(e), and the U.S. Provisional Patent is hereby incorporated by reference in its entirety.

[0003] Reference to electronic sequence listing

[0004] The content of the electronic sequence listing (SeqList - 162027.53176.xml; size: 479,210 bytes; and creation date: Oct. 10, 2023) is hereby incorporated by reference in its entirety herein. Technical field

[0005] This disclosure generally relates to the fields of molecular biology and medicine. More particularly, the methods and compositions herein can be used to treat Wilson's Disease. Background art

[0006] Wilson's disease (WD) is caused by an autosomal recessive loss - of - function mutation in the ATPase copper - transporting beta (ATP7B) gene, which leads to the pathological accumulation of copper in the liver, brain, and other tissues. Symptoms of WD include Parkinson's - like neurological deficits (including dystonia / bradykinesia) and liver defects associated with cirrhosis. The prevalence of Wilson's disease is approximately 1 in 30,000 people.

[0007] ATP7B is a transmembrane copper ion transporter. When cellular copper concentration increases, ATP7B translocates to lysosomes and pumps copper into vesicles so that copper can be excreted through bile ducts in the liver. Due to its large size (1465 amino acids), ATP7B is too large to be effectively packaged into adeno - associated virus (AAV), which makes ATP7B gene therapy difficult.

[0008] Therefore, there is an urgent need for enhanced ATP7B expression constructs to treat Wilson's disease. Summary of the invention

[0009] This disclosure provides improved expression constructs for expressing ATP7B, vectors and pharmaceutical compositions comprising such constructs, and methods of using such constructs, vectors, and pharmaceutical compositions.

[0010] In one aspect, there is provided an expression construct comprising:

[0011] (a) a promoter;

[0012] (b) a sequence encoding (ATPase copper transporting β) ATP7B, operably linked to the promoter; and

[0013] (c) a polyadenylation signal.

[0014] In some embodiments, the promoter comprises a sequence that is at least 80% identical to a sequence selected from the group consisting of: SEQ ID NO: 4 - 33. In some embodiments, the promoter comprises a sequence that is at least 90% identical to a sequence selected from the group consisting of: SEQ ID NO: 4 - 33. In some embodiments, the promoter comprises a sequence that is at least 95% identical to a sequence selected from the group consisting of: SEQ ID NO: 4 - 33. In some embodiments, the promoter comprises a sequence selected from the group consisting of: SEQ ID NO: 4 - 33. In some embodiments, the promoter comprises a sequence that is at least 80% identical to any one of SEQ ID NO: 4, SEQ ID NO: 10, or SEQ ID NO: 11. In some embodiments, the promoter comprises a sequence that is at least 90% identical to any one of SEQ ID NO: 4, 10, or 11. In some embodiments, the promoter comprises a sequence that is at least 95% identical to any one of SEQ ID NO: 4, 10, or 11. In some embodiments, the promoter comprises any one of SEQ ID NO: 4, 10, or 11.

[0015] In some embodiments, the sequence encoding ATP7B is codon-optimized. In some embodiments, the sequence encoding ATP7B comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 35-48. In some embodiments, the sequence encoding ATP7B comprises a sequence that is at least 90% identical to any one of SEQ ID NOs: 35-48. In some embodiments, the sequence encoding ATP7B comprises a sequence that is at least 95% identical to any one of SEQ ID NOs: 35-48. In some embodiments, the sequence encoding ATP7B comprises a sequence selected from the group consisting of SEQ ID NOs: 35-48. In some embodiments, the sequence encoding ATP7B comprises a sequence that is at least 80% identical to SEQ ID NO: 39 or SEQ ID NO: 41. In some embodiments, the sequence encoding ATP7B comprises a sequence that is at least 90% identical to SEQ ID NO: 39 or SEQ ID NO: 41. In some embodiments, the sequence encoding ATP7B comprises a sequence that is at least 95% identical to SEQ ID NO: 39 or SEQ ID NO: 41. In some embodiments, the sequence encoding ATP7B comprises SEQ ID NO: 39 or SEQ ID NO: 41.

[0016] In some embodiments, the sequence encoding ATP7B encodes a protein comprising a sequence that is at least 80% identical to any one of SEQ ID NOs: 118-128. In some embodiments, the sequence encoding ATP7B encodes a protein comprising a sequence that is at least 90% identical to any one of SEQ ID NOs: 118-128. In some embodiments, the sequence encoding ATP7B encodes a protein comprising a sequence that is at least 95% identical to any one of SEQ ID NOs: 118-128. In some embodiments, the sequence encoding ATP7B encodes a protein comprising any one of SEQ ID NOs: 118-128. In some embodiments, the sequence encoding ATP7B encodes a protein comprising a sequence that is at least 80% identical to SEQ ID NO: 118 or SEQ ID NO: 123. In some embodiments, the sequence encoding ATP7B encodes a protein comprising a sequence that is at least 90% identical to SEQ ID NO: 118 or SEQ ID NO: 123. In some embodiments, the sequence encoding ATP7B encodes a protein comprising a sequence that is at least 95% identical to SEQ ID NO: 118 or SEQ ID NO: 123. In some embodiments, the sequence encoding ATP7B encodes a protein comprising SEQ ID NO: 118 or SEQ ID NO: 123.

[0017] In some embodiments, the expression construct further comprises a post-transcriptional regulatory element. In some embodiments, the post-transcriptional regulatory element comprises a sequence that is at least 80% identical to SEQ ID NO:49 or SEQ ID NO:50. In some embodiments, the post-transcriptional regulatory element comprises a sequence that is at least 90% identical to SEQ ID NO:49 or SEQ ID NO:50. In some embodiments, the post-transcriptional regulatory element comprises a sequence that is at least 95% identical to SEQ ID NO:49 or SEQ ID NO:50. In some embodiments, the post-transcriptional regulatory element comprises SEQ ID NO:49 or SEQ ID NO:50. In some embodiments, the post-transcriptional regulatory element comprises a sequence that is at least 80% identical to SEQ ID NO:49. In some embodiments, the post-transcriptional regulatory element comprises a sequence that is at least 90% identical to SEQ ID NO:49. In some embodiments, the post-transcriptional regulatory element comprises a sequence that is at least 95% identical to SEQ ID NO:49. In one embodiment, the post-transcriptional regulatory element comprises SEQ ID NO:49.

[0018] In some embodiments, the polyadenylation signal comprises a sequence that is at least 80% identical to SEQ ID NO:51 or SEQ ID NO:52. In some embodiments, the polyadenylation signal comprises a sequence that is at least 90% identical to SEQ ID NO:51 or SEQ ID NO:52. In some embodiments, the polyadenylation signal comprises a sequence that is at least 95% identical to SEQ ID NO:51 or SEQ ID NO:52. In some embodiments, the polyadenylation signal comprises SEQ ID NO:51 or SEQ ID NO:52. In some embodiments, the polyadenylation signal comprises a sequence that is at least 80% identical to SEQ ID NO:51. In some embodiments, the polyadenylation signal comprises a sequence that is at least 90% identical to SEQ ID NO:51. In some embodiments, the polyadenylation signal comprises a sequence that is at least 95% identical to SEQ ID NO:51. In one embodiment, the polyadenylation signal comprises SEQ ID NO:51.

[0019] In some embodiments, the expression construct further comprises a microRNA (miR) binding site (miRBS). In some embodiments, the miRBS comprises a sequence that is at least 80% identical to SEQ ID NO:53. In some embodiments, the miRBS comprises a sequence that is at least 90% identical to SEQ ID NO:53. In some embodiments, the miRBS comprises a sequence that is at least 95% identical to SEQ ID NO:53. In one embodiment, the miRBS comprises SEQ ID NO:53.

[0020] In some embodiments, there is provided a construct comprising:

[0021] (a) a promoter comprising a sequence that is at least 80% identical to SEQ ID NO:11;

[0022] (b) a sequence encoding ATP7B, operably linked to the promoter, comprising a sequence that is at least 80% identical to SEQ ID NO:41;

[0023] (c) a post-transcriptional regulatory element comprising a sequence that is at least 80% identical to SEQ ID NO:49; and

[0024] (d) a polyadenylation signal comprising a sequence that is at least 80% identical to SEQ ID NO:51.

[0025] In some embodiments, there is provided a construct comprising:

[0026] (a) a promoter comprising a sequence that is at least 90% identical to SEQ ID NO:11;

[0027] (b) a sequence encoding ATP7B, operably linked to the promoter, comprising a sequence that is at least 90% identical to SEQ ID NO:41;

[0028] (c) a post-transcriptional regulatory element comprising a sequence that is at least 90% identical to SEQ ID NO:49; and

[0029] (d) a polyadenylation signal comprising a sequence that is at least 90% identical to SEQ ID NO:51.

[0030] In some embodiments, there is provided a construct comprising:

[0031] (a) a promoter comprising a sequence that is at least 95% identical to SEQ ID NO:11;

[0032] (b) A sequence encoding ATP7B, operably linked to the promoter, comprising a sequence that is at least 95% identical to SEQ ID NO: 41;

[0033] (c) A post-transcriptional regulatory element comprising a sequence that is at least 95% identical to SEQ ID NO: 49; and

[0034] (d) A polyadenylation signal comprising a sequence that is at least 95% identical to SEQ ID NO: 51.

[0035] In some embodiments, a construct is provided, the construct comprising:

[0036] (a) A promoter comprising SEQ ID NO: 11;

[0037] (b) A sequence encoding ATP7B, operably linked to the promoter, comprising SEQ ID NO: 41;

[0038] (c) A post-transcriptional regulatory element comprising SEQ ID NO: 49; and

[0039] (d) A polyadenylation signal comprising SEQ ID NO: 51.

[0040] In some embodiments, a construct is provided, the construct comprising:

[0041] (a) A promoter comprising a sequence that is at least 80% identical to SEQ ID NO: 10;

[0042] (b) A sequence encoding ATP7B, operably linked to the promoter, comprising a sequence that is at least 80% identical to SEQ ID NO: 39;

[0043] (c) A miRBS comprising a sequence that is at least 80% identical to SEQ ID NO: 53;

[0044] (d) A post-transcriptional regulatory element comprising a sequence that is at least 80% identical to SEQ ID NO: 49; and

[0045] (e) A polyadenylation signal comprising a sequence that is at least 80% identical to SEQ ID NO: 51.

[0046] In some embodiments, a construct is provided, the construct comprising:

[0047] (a) A promoter comprising a sequence that is at least 90% identical to SEQ ID NO: 10;

[0048] (b) A sequence encoding ATP7B, operably linked to the promoter, comprising a sequence that is at least 90% identical to SEQ ID NO:39;

[0049] (c) A miRBS comprising a sequence that is at least 90% identical to SEQ ID NO:53;

[0050] (d) A post-transcriptional regulatory element comprising a sequence that is at least 90% identical to SEQ ID NO:49; and

[0051] (e) A polyadenylation signal comprising a sequence that is at least 90% identical to SEQ ID NO:51.

[0052] In some embodiments, a construct is provided, the construct comprising:

[0053] (a) A promoter comprising a sequence that is at least 95% identical to SEQ ID NO:10;

[0054] (b) A sequence encoding ATP7B, operably linked to the promoter, comprising a sequence that is at least 95% identical to SEQ ID NO:39;

[0055] (c) A miRBS comprising a sequence that is at least 95% identical to SEQ ID NO:53; and

[0056] (d) A post-transcriptional regulatory element comprising a sequence that is at least 95% identical to SEQ ID NO:49; and

[0057] (e) A polyadenylation signal comprising a sequence that is at least 95% identical to SEQ ID NO:51.

[0058] In some embodiments, a construct is provided, the construct comprising:

[0059] (a) A promoter comprising SEQ ID NO:10;

[0060] (b) A sequence encoding ATP7B, operably linked to the promoter, comprising SEQ ID NO:39;

[0061] (c) A miRBS comprising SEQ ID NO:53;

[0062] (d) A post-transcriptional regulatory element comprising SEQ ID NO:49; and

[0063] (e) A polyadenylation signal comprising SEQ ID NO:51.

[0064] In some embodiments, a construct is provided, the construct comprising:

[0065] (a) A promoter comprising a sequence that is at least 80% identical to SEQ ID NO:4;

[0066] (b) A sequence encoding ATP7B, operably linked to said promoter, comprising a sequence that is at least 80% identical to SEQ ID NO:41;

[0067] (c) A post - transcriptional regulatory element comprising a sequence that is at least 80% identical to SEQ ID NO:49; and

[0068] (d) A polyadenylation signal comprising a sequence that is at least 80% identical to SEQ ID NO:51.

[0069] In some embodiments, a construct is provided, the construct comprising:

[0070] (a) A promoter comprising a sequence that is at least 90% identical to SEQ ID NO:4;

[0071] (b) A sequence encoding ATP7B, operably linked to said promoter, comprising a sequence that is at least 90% identical to SEQ ID NO:41;

[0072] (c) A post - transcriptional regulatory element comprising a sequence that is at least 90% identical to SEQ ID NO:49; and

[0073] (d) A polyadenylation signal comprising a sequence that is at least 90% identical to SEQ ID NO:51.

[0074] In some embodiments, a construct is provided, the construct comprising:

[0075] (a) A promoter comprising a sequence that is at least 95% identical to SEQ ID NO:4;

[0076] (b) A sequence encoding ATP7B, operably linked to said promoter, comprising a sequence that is at least 95% identical to SEQ ID NO:41;

[0077] (c) A post - transcriptional regulatory element comprising a sequence that is at least 95% identical to SEQ ID NO:49; and

[0078] (d) A polyadenylation signal comprising a sequence that is at least 95% identical to SEQ ID NO:51.

[0079] In some embodiments, a construct is provided, the construct comprising:

[0080] (a) A promoter comprising SEQ ID NO:4;

[0081] (b) A sequence encoding ATP7B, operably linked to the promoter, comprising SEQ ID NO:41;

[0082] (c) A post-transcriptional regulatory element comprising SEQ ID NO:49; and

[0083] (d) A polyadenylation signal comprising SEQ ID NO:51.

[0084] On the one hand, a vector is provided, the vector comprising the expression construct disclosed herein. In one embodiment, the vector is a viral vector. In one embodiment, the vector is an AAV vector. On the one hand, a vector comprising a nucleic acid sequence is provided, the nucleic acid sequence comprising (i) the expression construct disclosed herein and (ii) one or more inverted terminal repeats (ITRs). In one embodiment, the nucleic acid sequence comprises a 5 ′ ITR and a 3 ′ ITR. In one embodiment, the 5 ′ ITR and the 3 ′ ITR are derived from the adeno-associated virus (AAV) serotype AAV2. In some embodiments, the sequence of the 5 ′ ITR is at least 80% identical to SEQ ID NO:116. In some embodiments, the sequence of the 5 ′ ITR is at least 90% identical to SEQ ID NO:116. In some embodiments, the sequence of the 5 ′ ITR is at least 95% identical to SEQ ID NO:116. In some embodiments, the sequence of the 5 ′ ITR comprises SEQ ID NO:116. In some embodiments, the sequence of the 3 ′ ITR is at least 80% identical to SEQ ID NO:117. In some embodiments, the sequence of the 3 ′ ITR is at least 90% identical to SEQ ID NO:117. In some embodiments, the sequence of the 3 ′ ITR is at least 95% identical to SEQ ID NO:117. In some embodiments, the sequence of the 3 ′ ITR comprises SEQ ID NO:117.

[0085] On the one hand, a vector comprising an expression construct is provided, wherein the vector comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 54-115. In some embodiments, the vector comprises a sequence that is at least 90% identical to any one of SEQ ID NOs: 54-115. In some embodiments, the vector comprises a sequence that is at least 95% identical to any one of SEQ ID NOs: 54-115. In some embodiments, the vector comprises any one of SEQ ID NOs: 54-115. In some embodiments, the vector comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 65, 73 or 92. In some embodiments, the vector comprises a sequence that is at least 90% identical to any one of SEQ ID NOs: 65, 73 or 92. In some embodiments, the vector comprises a sequence that is at least 95% identical to SEQ ID NOs: 65, 73 or 92. In some embodiments, the vector comprises SEQ ID NOs: 65, 73 or 92. In some embodiments, the vector comprises a capsid that comprises or is derived from AAV7m8, AAV9, AAV2-retro or AAVrh.10.

[0086] On the one hand, a cell is provided, the cell comprising the expression construct or vector disclosed herein.

[0087] On the one hand, a pharmaceutical composition is provided, the pharmaceutical composition comprising (i) the expression construct or vector disclosed herein, and (ii) a pharmaceutically acceptable carrier.

[0088] On the one hand, a method of increasing ATP7B activity in a subject in need thereof is provided, the method comprising administering to the subject an expression construct, vector or pharmaceutical composition disclosed herein. On the one hand, a method of increasing copper secretion in a subject in need thereof is provided, the method comprising administering to the subject an expression construct, vector or pharmaceutical composition disclosed herein. On the one hand, a method of treating a disorder in a subject in need thereof caused by ATP7B deficiency or dysfunction is provided, the method comprising administering to the subject an expression construct, vector or pharmaceutical composition disclosed herein. On the one hand, a method of treating Wilson's disease in a subject in need thereof is provided, the method comprising administering to the subject an expression construct, vector or pharmaceutical composition disclosed herein. On the one hand, a method of reducing dystonia or bradykinesia in a subject suffering from Wilson's disease is provided, the method comprising administering to the subject an expression construct, vector or pharmaceutical composition disclosed herein. On the one hand, a method of reducing the incidence of leukopenia or anemia in a subject suffering from Wilson's disease is provided, the method comprising administering to the subject an expression construct, vector or pharmaceutical composition disclosed herein. On the one hand, a method of reducing the incidence of liver cirrhosis in a subject suffering from Wilson's disease is provided, the method comprising administering to the subject an expression construct, vector or pharmaceutical composition disclosed herein. In some embodiments, the subject is human. BRIEF DESCRIPTION OF THE DRAWINGS

[0089] Figure 1 illustrates the structure of ATP7B.

[0090] Figure 2A and Figure 2B illustrates how the activity of the liver-specific promoters disclosed herein was compared with that of commonly used reference promoters in human Huh7 cells. Figure 2A . Plasmids for dual reporter gene-based flow assays. Figure 2B . Relative protein expression of different liver-specific promoters (compared to expression using the control promoter CAG). Arrows indicate that among the tested promoters, the L15 and L13 promoters particularly drove high expression of miniATP7B in vitro. AAT, LP1, HLP, TBG, and HCB were used as additional reference promoters.

[0091] Figure 3A 、 Figure 3B and Figure 3C illustrates how the expression of the ATP7B minigene was examined and its associated copper ion efflux function. Figure 3A . Figure 3B and Figure 3CSchematic diagram of the copper-responsive reporter gene construct used for experiments. The reporter gene in this construct is driven by a copper-responsive promoter. The expression level of the reporter gene directly reflects the amount of copper ions found in the cell, and the amount of copper ions is regulated by the copper pumping activity of ATP7B. Using the copper reporter gene in combination with flow cytometry, the copper ion efflux activity of the ATP7B minigene in ATP7B knockout (KO) cells was tested. After treatment with copper sulfate, the mClover3 fluorescence increased. Figure 3B . Expression of full-length (FL) ATP7B or ATP7B minigenes (TG1-TG3) attenuated the increase in mClover3 fluorescence. TG1 = miniATP7Bv_v2. TG2 = miniATP7B-s1co. TG3 = miniATP7AB. TG = transgene. MFI = median fluorescence intensity. The labeling in this figure is the same as Figure 3C in. Figure 3C . The efficacy of the transgene (TG) was evaluated by measuring the copper reporter gene activity of different concentrations of the ATP7B transgene plasmid used for transfection. Ctrl = control.

[0092] Figure 4A 、 Figure 4B 、 Figure 4C and Figure 4D show that combinations of various different genetic elements, including the promoter, TISU sequence, 3 ′ UTR elements (miRNA site, WPRE, polyA) and the ATP7B minigene, can increase ATP7B expression. Figure 4A . Western blot shows ATP7B expression in HEK293 ATP7B - / - cells that have been transfected with the indicated expression constructs (see Table 7). AAT-miniATP7B-sPolyA was used as a reference construct (REF). Figure 4B 、 Figure 4C and Figure 4D . Western blot shows ATP7B expression in Huh7 cells ( Figure 4B ), primary murine hepatocytes ( Figure 4C ), and primary human hepatocytes ( Figure 4D ) that have been transduced with AAV8 particles containing the indicated expression constructs. In construct A39 (labeled AAT-A12), the L15 promoter in A12 was replaced with the standard AAT promoter. Human ACTB (β-actin) was used as a control.

[0093] Figure 5A 、 Figure 5B 、 Figure 5C and Figure 5DNote: Overexpression of the ATP7B minigene rescued the alanine aminotransferase (ALT) and splenomegaly phenotypes in ATP7B - / - mice. AAV8 (5e12 GC / kg i.v.) was injected into 7-week-old ATP7B - / - male mice. Eight weeks after injection, the ALT activity in the serum was measured. Twelve weeks later, the organs were weighed and the expression in the liver was measured. Figure 5A and Figure 5B . Western blot ([[]] Figure 5A [[]]) and quantification ([[]] Figure 5B [[]]) of ATP7B protein expression in the liver of ATP7B mice 12 weeks later. Figure 5A ) and quantification ([[]] Figure 5B [[]]) of ATP7B protein expression in the liver of ATP7B mice 12 weeks later. Figure 5B ) of ATP7B protein expression in the liver of ATP7B mice 12 weeks later. Figure 5C . ALT activity in the serum of ATP7B mice 8 weeks later. Figure 5D . Spleen weight of ATP7B mice 12 weeks later. DETAILED DESCRIPTION

[0094] Provided herein are improved expression constructs for expressing ATP7B, vectors and pharmaceutical compositions comprising such constructs, and methods of using such constructs, vectors, and pharmaceutical compositions. In some embodiments, the expression constructs disclosed herein exhibit enhanced ATP7B expression, thereby allowing for the use of a lower viral MOI (multiplicity of infection) clinically, which in turn can improve patient safety outcomes and reduce manufacturing hurdles including cost. In embodiments, the expression constructs disclosed herein exhibit improved liver function and reduced immune response.

[0095] Expression Constructs

[0096] In one aspect, provided is an expression construct comprising:

[0097] (a) a promoter;

[0098] (b) a sequence encoding ATP7B, operably linked to the promoter; and

[0099] (c) a polyadenylation signal.

[0100] As used herein, "operably linked" means that a first molecule is joined to a second molecule, where the molecules are arranged such that the first molecule affects the function of the second molecule. The two molecules may or may not be part of a single contiguous molecule and may or may not be adjacent. For example, if a promoter regulates the transcription of a transcribable polynucleotide molecule of interest in a cell, the promoter is operably linked to the transcribable polynucleotide molecule. Additionally, if two portions of a transcriptional regulatory element are joined such that the transcriptional activation function of one portion is not adversely affected by the presence of the other portion, they are operably linked to each other. Two transcriptional regulatory elements can be operably linked to each other by an intervening nucleic acid (e.g., intervening non-coding nucleic acid), or can be operably linked to each other in the absence of intervening nucleotides.

[0101] In one aspect, there is provided an expression construct comprising:

[0102] (a) a promoter;

[0103] (b) a sequence encoding ATP7B, operably linked to the promoter;

[0104] (c) a miRNA binding site (miRBS);

[0105] (d) a post-transcriptional regulatory element; and / or

[0106] (e) a polyadenylation signal.

[0107] In one aspect, there is provided an expression construct that, from 5 ′ to 3 ′ comprises:

[0108] (a) a promoter;

[0109] (b) a sequence encoding ATP7B, operably linked to the promoter;

[0110] (c) a miRNA binding site (miRBS);

[0111] (d) a post-transcriptional regulatory element; and

[0112] (e) a polyadenylation signal.

[0113] In one aspect, there is provided an expression construct:

[0114] (a) a promoter;

[0115] (b) a sequence encoding ATP7B, operably linked to the promoter;

[0116] (c) Post-transcriptional regulatory elements; and / or

[0117] (d) Polyadenylation signal.

[0118] On the one hand, an expression construct is provided, the expression construct from 5 ′ to 3 ′ :

[0119] (a) Promoter;

[0120] (b) A sequence encoding ATP7B, operably linked to the promoter;

[0121] (c) Post-transcriptional regulatory elements; and

[0122] (d) Polyadenylation signal.

[0123] As used herein, the term "from 5 ′ to 3 ′ " refers to the order of specific genetic elements in a nucleic acid sequence. In some embodiments, the specific genetic elements are linked to each other by a linker nucleic acid (e.g., intervening non-coding nucleic acid). In some embodiments, the specific genetic elements are linked to each other in the absence of intervening nucleotides. In some embodiments, some specific genetic elements are linked to each other by a linker nucleic acid, while other specific genetic elements are linked to each other in the absence of intervening nucleotides.

[0124] In some embodiments, the expression construct comprises a promoter sequence that comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to any one of SEQ ID NOs: 4-33. In some embodiments, the expression construct comprises a promoter sequence that comprises any one of SEQ ID NOs: 4-33. In some embodiments, the expression construct comprises a promoter sequence that comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to any one of SEQ ID NO: 4, SEQ ID NO: 10 or SEQ ID NO: 11. In some embodiments, the expression construct comprises a promoter sequence that comprises any one of SEQ ID NO: 4, SEQ ID NO: 10 or SEQ ID NO: 11.

[0125] In some embodiments, the expression construct comprises a promoter sequence that comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:4. In some embodiments, the expression construct comprises a promoter sequence that comprises SEQ ID NO:4.

[0126] In some embodiments, the expression construct comprises a promoter sequence that comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:10. In some embodiments, the expression construct comprises a promoter sequence that comprises SEQ ID NO:10.

[0127] In some embodiments, the expression construct comprises a promoter sequence that comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:11. In some embodiments, the expression construct comprises a promoter sequence that comprises SEQ ID NO:11.

[0128] In some embodiments, the expression construct comprises a Kozak sequence for initiating protein translation. In some embodiments, the expression construct comprises a short 5′UTR translation initiation factor (TISU) sequence for initiating protein translation. See, e.g., Elfakess et al., Nucleic Acids Res. September 1, 2011; 39(17):7598-609.

[0129] In some embodiments, the expression construct comprises a sequence encoding ATP7B, wherein the ATP7B coding sequence is codon-optimized.

[0130] In some embodiments, the expression construct comprises a sequence encoding ATP7B, wherein the ATP7B encoding sequence is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to any one of SEQ ID NOs: 35-48. In some embodiments, the expression construct comprises any one of SEQ ID NOs: 35-48.

[0131] In some embodiments, the expression construct comprises a sequence encoding ATP7B, wherein the ATP7B encoding sequence is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 39 or SEQ ID NO: 41. In some embodiments, the expression construct comprises SEQ ID NO: 39 or SEQ ID NO: 41.

[0132] In some embodiments, the expression construct comprises a sequence encoding ATP7B, wherein the sequence encodes an ATP7B protein, and the ATP7B protein comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to any one of SEQ ID NOs: 118-128. In some embodiments, the expression construct comprises a sequence encoding ATP7B, wherein the sequence encodes an ATP7B protein, and the ATP7B protein comprises any one of SEQ ID NOs: 118-128.

[0133] In some embodiments, the expression construct comprises a sequence encoding ATP7B, wherein the sequence encodes an ATP7B protein, and the ATP7B protein comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 118 or SEQ ID NO: 123. In some embodiments, the expression construct comprises a sequence encoding ATP7B, wherein the sequence encodes an ATP7B protein, and the ATP7B protein comprises SEQ ID NO: 118 or SEQ ID NO: 123.

[0134] In some embodiments, the expression construct comprises a microRNA binding site (miRBS). In an embodiment, the miRBS comprises one or more (e.g., 1 to 6) binding sites for a microRNA. In an embodiment, the miRBS comprises one or more binding sites for miR142 (TCCATAAAGTAGGAAACACTACA; SEQ ID NO:6). In an embodiment, the miRBS comprises 4 binding sites for miR142. In embodiments where the miRBS comprises 2 or more binding sites for miR142, the miR142 binding sites may be linked by a nucleotide linker of 1 to 10 nucleotides.

[0135] In some embodiments, the expression construct comprises a miRBS that comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO:53. In some embodiments, the expression construct comprises a miRBS that comprises SEQ ID NO:53.

[0136] In some embodiments, the expression construct comprises a post-transcriptional regulatory element. In some embodiments, the expression construct comprises a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE).

[0137] In some embodiments, the expression construct comprises a post-transcriptional regulatory element that comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO:49 or SEQ ID NO:50. In some embodiments, the expression construct comprises a post-transcriptional regulatory element that comprises SEQ ID NO:49 or SEQ ID NO:50.

[0138] In some embodiments, the expression construct comprises a post-transcriptional regulatory element that comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO:49. In some embodiments, the expression construct comprises a post-transcriptional regulatory element that comprises SEQ ID NO:49.

[0139] In some embodiments, the expression construct comprises a polyadenylation signal that comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:51 or SEQ ID NO:52. In some embodiments, the expression construct comprises a polyadenylation signal that comprises SEQ ID NO:51 or SEQ ID NO:52.

[0140] In some embodiments, the expression construct comprises a polyadenylation signal that comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:51. In some embodiments, the expression construct comprises a polyadenylation signal that comprises SEQ ID NO:51.

[0141] In one embodiment, the expression construct comprises:

[0142] (a) a promoter that comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:11;

[0143] (b) a sequence encoding ATP7B, operably linked to the promoter, that comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:41;

[0144] (c) a post-transcriptional regulatory element that comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:49; and

[0145] (d) A polyadenylation signal, which comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 51.

[0146] In one embodiment, the expression construct comprises:

[0147] (a) A promoter comprising SEQ ID NO: 11;

[0148] (b) A sequence encoding ATP7B, operably linked to the promoter, comprising SEQ ID NO: 41;

[0149] (c) A post-transcriptional regulatory element comprising SEQ ID NO: 49; and

[0150] (d) A polyadenylation signal comprising SEQ ID NO: 51.

[0151] In one embodiment, the expression construct comprises:

[0152] (a) A promoter, which comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 10;

[0153] (b) A sequence encoding ATP7B, operably linked to the promoter, comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 39;

[0154] (c) A miRBS, which comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 53;

[0155] (d) A post-transcriptional regulatory element, which comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 49; and

[0156] (e) A polyadenylation signal, said polyadenylation signal comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 51.

[0157] In one embodiment, the expression construct comprises:

[0158] (a) A promoter comprising SEQ ID NO: 10;

[0159] (b) A sequence encoding ATP7B, operably linked to the promoter, comprising SEQ ID NO: 39;

[0160] (c) A miRBS comprising SEQ ID NO: 53;

[0161] (d) A post-transcriptional regulatory element comprising SEQ ID NO: 49; and

[0162] (e) A polyadenylation signal comprising SEQ ID NO: 51.

[0163] In one embodiment, the expression construct comprises:

[0164] (a) A promoter, said promoter comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 4;

[0165] (b) A sequence encoding ATP7B, operably linked to the promoter, comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 41;

[0166] (c) A post-transcriptional regulatory element, said post-transcriptional regulatory element comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 49; and

[0167] (d) A polyadenylation signal, said polyadenylation signal comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO:51.

[0168] In one embodiment, the expression construct comprises:

[0169] (a) A promoter comprising SEQ ID NO:4;

[0170] (b) A sequence encoding ATP7B, operably linked to said promoter, comprising SEQ ID NO:41;

[0171] (c) A post-transcriptional regulatory element comprising SEQ ID NO:49; and

[0172] (d) A polyadenylation signal comprising SEQ ID NO:51.

[0173] The expression constructs of Table 7 are provided herein. Expression constructs comprising one or more of the genetic elements shown in Table 7 are provided herein.

[0174] Vector

[0175] In one aspect, recombinant vectors and their use for introducing a transgene or expression construct into a cell are provided. In some embodiments, the recombinant vector comprises a recombinant DNA construct, said recombinant DNA construct comprising additional DNA elements, including DNA segments that provide for DNA replication in a host cell and expression of the target gene at an appropriate level in a target cell. One of ordinary skill in the art will understand that expression control sequences (promoters, enhancers, etc.) are selected based on the ability to promote expression of the target gene in a target cell.

[0176] As used herein, "vector" means an agent that contains a polynucleotide to be delivered to a host cell in vitro or in vivo. Non-limiting examples of vectors include recombinant plasmids, yeast artificial chromosomes (YACs), minichromosomes, DNA microcircles or viruses (including virus-derived sequences). A vector can also refer to a virus particle that contains a nucleic acid to be delivered to a host cell in vitro or in vivo. In some embodiments, a vector refers to a virus particle that contains a recombinant viral genome, wherein said viral genome contains one or more ITRs and a transgene.

[0177] In one embodiment, the recombinant vector is a viral vector or a combination of multiple viral vectors. In one aspect, a vector is provided, said vector comprising any of the expression constructs disclosed herein.

[0178] Viral vector

[0179] Viral vectors for expressing a target gene in a target cell, tissue, or organism are known in the art and include, for example, AAV vectors, adenoviral vectors, lentiviral vectors, retroviral vectors, poxviral vectors, baculoviral vectors, herpes simplex virus vectors, vaccinia virus vectors, or synthetic viral vectors (e.g., chimeric viruses, mosaic viruses, or pseudotyped viruses and / or viruses containing exogenous proteins, synthetic polymers, nanoparticles, or small molecules).

[0180] AAV vector

[0181] Adeno-associated virus (AAV) is a small single-stranded DNA virus that requires a helper virus to facilitate efficient replication. The 4.7 kb genome of AAV is characterized by two inverted terminal repeats (ITRs) and two open reading frames that encode the Rep and Cap proteins, respectively. The Rep reading frame encodes four proteins with molecular weights of 78 kD, 68 kD, 52 kD, and 40 kD. The functions of these proteins are mainly to regulate AAV replication and rescue AAV and integrate it into the host cell chromosome. The Cap reading frame encodes three structural proteins with molecular weights of 85 kD (VP1), 72 kD (VP2), and 61 kD (VP3), which form the viral particle capsid. More than 80% of the total protein in the AAV viral particle contains VP3. Flanking the rep and cap open reading frames at the 5′ and 3′ ends are inverted terminal repeats (ITRs) approximately 145 bp in length. The two ITRs are the only cis-elements necessary for AAV replication, rescue, packaging, and integration of the AAV genome. The entire rep and cap domains can be excised and replaced with a therapeutic or reporter gene transgene.

[0182] Recombinant adeno-associated virus "rAAV" vectors include any vector derived from any adeno-associated virus serotype. The rAAV vector may have one or more of the AAV wild-type genes partially or completely deleted, preferably the Rep and / or Cap genes, but retains the functional flanking ITR sequences.

[0183] In some embodiments, the viral vector is an rAAV viral particle that contains an rAAV genome and one or more capsid proteins. In some embodiments, the rAAV genome contains the expression construct disclosed herein.

[0184] In some embodiments, the viral vectors disclosed herein comprise a nucleic acid that contains AAV 5′ ITR and 3′ ITR located 5′ and 3′, respectively, of the sequence encoding ATP7B. However, in certain embodiments, it may be desirable for the nucleic acid to contain 5′ ITR and 3′ ITR sequences arranged in tandem, such as 5′ to 3′ or head-to-tail or in another alternative configuration. In other embodiments, it may be desirable for the nucleic acid to contain multiple copies of the ITR, or to have 5′ ITRs (or conversely, 3′ ITRs) located both 5′ and 3′ of the sequence encoding ATP7B. The ITR sequences may be located immediately upstream and / or downstream of the heterologous molecule, or intervening sequences may be present. The ITRs need not be wild-type nucleotide sequences and may be altered (e.g., by insertion, deletion, or substitution of nucleotides) so long as the sequences provide for functional rescue, replication, and packaging. The ITRs may be selected from AAV2, or from other AAV serotypes as described herein.

[0185] In some embodiments, a vector is provided that comprises a nucleic acid sequence that contains (i) an expression construct disclosed herein and (ii) one or more inverted terminal repeats (ITRs). In one embodiment, the nucleic acid sequence contains 5 ′ ITR and 3 ′ ITR. In one embodiment, the 5 ′ ITR and 3 ′ ITR are derived from the adeno-associated virus (AAV) serotype AAV2.

[0186] In one embodiment, the 5′ ITR sequence contains a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 116-177. In one embodiment, the 5′ ITR sequence contains any one of SEQ ID NOs: 116-177.

[0187] In one embodiment, the 3′ ITR sequence contains a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 178-239. In one embodiment, the 3′ ITR sequence contains any one of SEQ ID NOs: 178-239.

[0188] The present disclosure provides a vector comprising a nucleic acid sequence that comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 54 - 115. The present disclosure provides a vector that comprises any one of SEQ ID NOs: 54 - 115.

[0189] The present disclosure provides a vector comprising a nucleic acid sequence that comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NO: 65, SEQ ID NO: 73, or SEQ ID NO: 92. The present disclosure provides a vector that comprises any one of SEQ ID NO: 65, SEQ ID NO: 73, or SEQ ID NO: 92.

[0190] In some embodiments, the viral vector is an AAV vector, such as AAV1 (i.e., AAV containing AAV1 ITR and AAV1 capsid protein), AAV2 (i.e., AAV containing AAV2 ITR and AAV2 capsid protein), AAV3 (i.e., AAV containing AAV3 ITR and AAV3 capsid protein), AAV4 (i.e., AAV containing AAV4 ITR and AAV4 capsid protein), AAV5 (i.e., AAV containing AAV5 ITR and AAV5 capsid protein), AAV6 (i.e., AAV containing AAV6 ITR and AAV6 capsid protein), AAV7 (i.e., AAV containing AAV7 ITR and AAV7 capsid protein), AAV8 (i.e., AAV containing AAV8 ITR and AAV8 capsid protein), AAV9 (i.e., AAV containing AAV9 ITR and AAV9 capsid protein), AAVrh74 (i.e., AAV containing AAVrh74 ITR and AAVrh74 capsid protein), AAVrh.8 (i.e., AAV containing AAVrh.8 ITR and AAVrh.8 capsid protein), or AAVrh.10 (i.e., AAV containing AAVrh.10 ITR and AAVrh.10 capsid protein).

[0191] In some embodiments, the viral vector is a pseudotyped AAV vector that contains ITRs from one AAV serotype and capsid proteins from a different AAV serotype. In some embodiments, the pseudotyped AAV is AAV2 / 9 (i.e., an AAV that contains AAV2 ITRs and AAV9 capsid proteins). In some embodiments, the pseudotyped AAV is AAV2 / 10 (i.e., an AAV that contains AAV2 ITRs and AAV10 capsid proteins). In some embodiments, the pseudotyped AAV is AAV2 / 8 (i.e., an AAV that contains AAV2 ITRs and AAV8 capsid proteins).

[0192] In some embodiments, the pseudotyped AAV is AAV2 / 7m8 (i.e., an AAV that contains AAV2 ITRs and AAV7m8 capsid proteins).

[0193] In some embodiments, the AAV vector contains a recombinant capsid protein, such as a capsid protein that is a chimera containing one or more capsid proteins from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh74, AAVrh.8, or AAVrh.10. In an embodiment, the capsid is a variant AAV capsid, such as the AAV2 variant rAAV2-retro (SEQ ID NO: 44, from WO 2017 / 218842, incorporated herein by reference). In one embodiment, the capsid protein is derived from AAV8.In some embodiments, the capsid is derived from AAV-3B, AAV-S3, AAV3B-DE5, AAV-GT5, AAV-KP1, AAV-LK03, AAV-208 (an AAVrh10 / AAV8 hybrid, see Charbel et al., Assessment of tropism and effectiveness of new primate-derived hybrid recombinant AAV serotypes in the mouse and primate retina. PLoS One. April 9, 2013; 8(4):e60361), AAV-Anc80, AAV-CMRI_30 (AAV2 with T503A and N596D mutations, see PCT publication WO2021 / 000,024), AAV 2-N496D, AAV2-N582S, AAV-NP59 (see Paulk et al., Bioengineered AAV Capsids with Combined High Human Liver Transduction In Vivo and Unique Humoral Seroreactivity. Mol Ther. January 3, 2018; 26(1):289-303), AAV-hu.T88 (see Chen et al., Molecular characterization of adeno-associated viruses infecting children. J Virol. December 2005; 79(23):14781-92), AAV-hu.S17 (see Chen et al., 2005), AAV-2TT (see Tordo et al., A novel adeno-associated virus capsid with enhanced neurotropism corrects a lysosomal transmembrane enzyme deficiency. Brain. July 1, 2018; 141(7):2014-2031) or AAV-2.htT88-MEAS (an AAV2 / hu.T88 chimera).

[0194] Other viral vectors

[0195] Other viral vectors include adenoviral (AV) vectors, such as those based on human adenovirus type 2 and human adenovirus type 5, which have been rendered replication-defective by deletions in the E1 and E3 regions. A transcription cassette can be inserted into the E1 region, thereby generating a recombinant E1 / E3-deleted AV vector. Adenoviral vectors also include helper-dependent high-capacity adenoviral vectors (also referred to as high-capacity "gutless" or "gutted" vectors), which do not contain viral coding sequences. These vectors contain the cis-acting elements required for viral DNA replication and packaging, mainly the inverted terminal repeats (ITRs) and the packaging signal (Ψ). These helper-dependent AV vector genomes have the potential to carry exogenous DNA ranging from a few hundred base pairs to approximately 36 kb.

[0196] Alternatively, other systems such as lentiviral vectors can be used. Lentivirus-based systems can transduce both non-dividing and dividing cells, making them useful for applications targeting non-dividing cells such as those in the CNS. Lentiviral vectors are derived from the human immunodeficiency virus and, like the virus, integrate into the host genome, thus providing the potential for very long-term gene expression.

[0197] Cationic lipids, polymers, or both can also be used as vectors to introduce polynucleotides (including plasmids, YACs, minichromosomes, and microcircles) carrying a target gene containing an expression cassette into cells or organisms by non-viral vector systems. Conjugated poly-L-lysine (PLL) polymers and polyethyleneimine (PEI) polymer systems can also be used to deliver the vectors to cells. Other methods for delivering vectors to cells include hydrodynamic injection and electroporation, as well as the use of ultrasound, both for cell culture and for organisms. For a review of viral and non-viral delivery systems for gene delivery, see Nayerossadat, N. et al. (Adv Biomed Res. 2012; 1:27), which is incorporated herein by reference.

[0198] rAAV virion production

[0199] The rAAV viral particles disclosed herein can be constructed and produced using the materials and methods described herein and those known to those of skill in the art. Such engineering methods for constructing any embodiment of the present disclosure are known to those skilled in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et al., “Molecular Cloning. A Laboratory Manual”, 2nd ed., Cold Spring Harbor Laboratory, New York (1989), and Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989); and International Patent Publication No. WO 95 / 13598. In addition, methods suitable for generating rAAV cassettes in an adenovirus capsid have been described in U.S. Patent Nos. 5,856,152 and 5,871,982.

[0200] Briefly, to package the rAAV genome into rAAV viral particles, a host cell containing sequences necessary for expressing AAV rep and AAV cap or functional fragments thereof and helper genes necessary for AAV production is used. The AAV rep and cap sequences are obtained from AAV sources as identified herein. The AAV rep and cap sequences can be introduced into the host cell in any manner known to those of skill in the art, including but not limited to transfection, electroporation, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection, and protoplast fusion. In one embodiment, the rep and cap sequences can be transfected into the host cell by one or more nucleic acid molecules and stably exist in the cell as episomes. In another embodiment, the rep and cap sequences are stably integrated into the genome of the cell. Another embodiment has rep and cap sequences that are transiently expressed in the host cell. For example, a nucleic acid molecule useful for such transfection contains, from 5′ to 3′, a promoter, an optional spacer inserted between the start site of the promoter and the rep gene sequence, the AAV rep gene sequence, and the AAV cap gene sequence.

[0201] The rep and cap sequences, along with their expression control sequences, can be provided on a single vector, or each sequence can be provided on its own vector. Preferably, the rep and cap sequences are provided on the same vector. Alternatively, the rep and cap sequences can be provided on a vector containing other DNA sequences to be introduced into the host cell. Preferably, the promoter used in such constructs can be any suitable constitutive, inducible, or native promoter known to those skilled in the art. The molecule providing the rep and cap proteins can be in any form that transfers these components into the host cell. Ideally, such a molecule is in the form of a plasmid, which can contain other non-viral sequences, such as those of marker genes. Such a molecule does not contain the AAV ITR, and generally does not contain the AAV packaging sequence. To avoid the occurrence of homologous recombination, other viral sequences, especially those of adenovirus, are avoided in such plasmids. The plasmid is ideally constructed such that it can be stably transfected into cells.

[0202] Although the molecule providing the rep and cap can be transiently transfected into the host cell, it is preferred to stably transform the host cell with the sequences necessary for expressing functional rep / cap proteins in the host cell, such as as an episome or by integration into the host cell's chromosome. Depending on the promoter controlling the expression of such stable transfection in the host cell, the rep / cap proteins can be transiently expressed (e.g., by using an inducible promoter).

[0203] The methods for constructing the embodiments of the present disclosure are conventional genetic engineering or recombinant engineering techniques, such as those described in the above references. For example, rAAV can be produced using the triple transfection method with the calcium phosphate method (Clontech) or Effectene reagent (Qiagen, Valencia, Calif.) according to the manufacturer's instructions. See also Herzog et al., 1999, Nature Medic., 5(1):56 - 63, for the methods used in the following examples, using a plasmid with a transgene, a helper plasmid containing AAV rep and cap, and a plasmid providing the adenovirus helper functions of E2A, E4 Orf6, and VA. Although this specification provides illustrative examples of specific constructs, using the information provided herein, those skilled in the art can select and design other suitable constructs using the selection of spacers, promoters, and other elements (including at least one translation start and stop signal) and optionally adding polyadenylation sites.

[0204] Next, rAAV viral particles are produced by culturing host cells containing an rAAV virus as described herein, said host cells containing an rAAV genome to be packaged into the rAAV viral particles, an AAV rep sequence and an AAV cap sequence under the control of regulatory sequences directing expression. Suitable viral helper genes (such as adenovirus E2A, E4Orf6, and VA, and other possible helper genes) can be provided to the culture in a variety of ways known in the art, preferably on separate plasmids. Thereafter, recombinant AAV viral particles directing the expression of the ATP7B transgene are isolated from the cells or cell culture in the absence of contaminating helper virus or wild-type AAV.

[0205] Expression of the ATP7B transgene can be measured in a manner known in the art. For example, target cells can be infected in vitro, and the copy number of the transgene in the cells can be monitored by Southern blotting or quantitative polymerase chain reaction (PCR). RNA expression levels can be monitored by Northern blotting or quantitative reverse transcriptase (RT)-PCR; and protein expression levels can be monitored by Western blotting, immunohistochemistry, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), or by specific methods detailed in the examples below.

[0206] Pharmaceutical compositions

[0207] Provided herein are pharmaceutical compositions comprising any of the vectors disclosed herein and a pharmaceutically acceptable excipient.

[0208] In some embodiments, rAAV containing a gene encoding ATP7B is assayed by conventional methods and then formulated into a pharmaceutical composition suitable for storage and / or administration to a patient.

[0209] Formulation of the vectors disclosed herein involves the use of a pharmaceutically and / or physiologically acceptable medium or carrier, particularly a medium or carrier suitable for subretinal injection, such as buffered saline or other buffers (e.g., HEPES), to maintain the pH at an appropriate physiological level.

[0210] The carriers of the present disclosure can be formulated into pharmaceutical compositions. In addition to the carriers, these compositions can also contain pharmaceutically and / or physiologically acceptable excipients, carriers, buffers, stabilizers, antioxidants, preservatives, or other additives well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. The exact nature of the carrier or other materials can be determined by a skilled person according to the route of administration. The pharmaceutical compositions are generally in liquid form. Liquid pharmaceutical compositions generally include liquid carriers such as water, petroleum, animal or vegetable oils, mineral oils or synthetic oils. Additional carriers are provided in International Patent Publication No. WO 00 / 15822, which is incorporated herein by reference. It can include physiological saline solutions, magnesium chloride, dextrose or other sugar solutions, or glycols such as ethylene glycol, propylene glycol or polyethylene glycol. In some cases, surfactants such as Pluronic acid (PF68) 0.001% can be used. In some cases, Ringer's injection solution, lactated Ringer's injection solution or Hartmann's solution are used. Preservatives, stabilizers, buffers, antioxidants and / or other additives can be included as needed. For delayed release, the carrier can be included in a pharmaceutical composition formulated for slow release, such as in microcapsules formed from biocompatible polymers or in a liposome carrier system according to methods known in the art.

[0211] If the carrier is intended for long-term storage, it can be frozen in the presence of glycerol.

[0212] Therapeutic methods

[0213] Methods for treating a disease in a subject in need thereof using the expression constructs, carriers, and pharmaceutical compositions disclosed herein are provided.

[0214] In some embodiments, the subject is a mammal. As used herein, the term "mammal" is intended to include, but is not limited to, humans, laboratory animals, domestic pets, and farm animals. Mammals include, but are not limited to, human or non-human mammals such as cattle, equines, canines, sheep, or felines, etc. An individual and a patient are also subjects herein.

[0215] As used herein, the term "treat / treated / treating / treatment" refers to a therapeutic treatment in which the goal is to slow down (alleviate) an undesired physiological disorder, condition or disease, or to obtain a beneficial or desired clinical outcome. For the purposes of this disclosure, beneficial or desired clinical outcomes include, but are not limited to, alleviation of symptoms; reduction in the degree of a disorder, condition or disease; stabilization (i.e., non-worsening) of the state of a disorder, condition or disease; delay in the onset or slowing of the progression of a disorder, condition or disease; improvement in one or more symptoms of the state of a disorder, condition or disease; and remission (whether partial or total) or enhancement or improvement of a disorder, condition or disease. Treatment includes eliciting a clinically significant response without undue side effects. Treatment also includes prolonging survival as compared to expected survival in the absence of receiving treatment.

[0216] The terms "prevent / prevention", etc. refer to acting prior to the onset of an apparent disease or condition to prevent the development of the disease or condition or to minimize the degree of the disease or condition, or to slow its progression.

[0217] Provided herein is a method of increasing ATP7B activity in a subject in need thereof, the method comprising administering to the subject a vector or pharmaceutical composition disclosed herein.

[0218] Provided herein is a method of increasing copper secretion in a subject in need thereof, the method comprising administering to the subject a vector or pharmaceutical composition disclosed herein.

[0219] Provided herein is a method of treating or preventing a disorder in a subject in need thereof caused by ATP7B deficiency or dysfunction, the method comprising administering to the subject a vector or pharmaceutical composition disclosed herein. Provided herein is a vector or pharmaceutical composition disclosed herein for treating or preventing a disorder in a subject in need thereof caused by ATP7B deficiency or dysfunction. Provided herein is the use of a vector in the manufacture of a medicament for treating or preventing a disorder in a subject in need thereof caused by ATP7B deficiency or dysfunction.

[0220] Provided herein is a method of treating or preventing Wilson's disease in a subject in need thereof, the method comprising administering to the subject a vector or pharmaceutical composition disclosed herein. Provided herein is a vector or pharmaceutical composition disclosed herein for treating or preventing Wilson's disease in a subject in need thereof. Provided herein is a vector or pharmaceutical composition disclosed herein for use in the manufacture of a medicament for treating or preventing Wilson's disease in a subject in need thereof.

[0221] The present disclosure provides a method for treating or preventing dystonia or bradykinesia in a subject suffering from Wilson's disease, the method comprising administering to the subject a carrier or pharmaceutical composition disclosed herein. The present disclosure provides the carrier or pharmaceutical composition disclosed herein for treating or preventing dystonia or bradykinesia in a subject suffering from Wilson's disease. The present disclosure provides the use of a carrier in the manufacture of a medicament for treating or preventing dystonia or bradykinesia in a subject suffering from Wilson's disease.

[0222] The present disclosure provides a method for reducing the incidence of leukopenia or anemia in a subject suffering from Wilson's disease, the method comprising administering to the subject a carrier or pharmaceutical composition disclosed herein. The present disclosure provides the carrier or pharmaceutical composition disclosed herein for reducing the incidence of leukopenia or anemia in a subject suffering from Wilson's disease. The present disclosure provides the use of a carrier in the manufacture of a medicament for reducing the incidence of leukopenia or anemia in a subject suffering from Wilson's disease.

[0223] The present disclosure provides a method for reducing the incidence of liver cirrhosis in a subject suffering from Wilson's disease, the method comprising administering to the subject a carrier or pharmaceutical composition disclosed herein. The present disclosure provides the carrier or pharmaceutical composition disclosed herein for reducing the incidence of liver cirrhosis in a subject suffering from Wilson's disease. The present disclosure provides the use of a carrier in the manufacture of a medicament for reducing the incidence of liver cirrhosis in a subject suffering from Wilson's disease.

[0224] In some embodiments, treatment refers to increasing survival (e.g., survival time). For example, treatment can result in an increase in the patient's life expectancy. In some embodiments, compared to the average life expectancy of one or more untreated control individuals with Wilson's disease, treatment results in an increase in the patient's life expectancy of more than about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, about 105%, about 110%, about 115%, about 120%, about 125%, about 130%, about 135%, about 140%, about 145%, about 150%, about 155%, about 160%, about 165%, about 170%, about 175%, about 180%, about 185%, about 190%, about 195%, about 200% or more. In some embodiments, compared to the average life expectancy of one or more untreated control individuals with Wilson's disease, treatment results in an increase in the patient's life expectancy of more than about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 2 years, about 3 years, about 4 years, about 5 years, about 6 years, about 7 years, about 8 years, about 9 years, about 10 years or longer. In some embodiments, treatment results in long-term survival of the patient. As used herein, the term "long-term survival" refers to a survival time or life expectancy of more than about 40 years, 45 years, 50 years, 55 years, 60 years or longer.

[0225] Combination therapy

[0226] In some embodiments, the expression construct or vector described herein is administered to a subject in combination with one or more additional therapies to treat Wilson's disease. In an embodiment, the expression construct or vector is administered in combination with a chelating agent. In an embodiment, the expression construct or vector can be administered in combination with penicillamine (such as ), trientine (such as ), zinc acetate .

[0227] In some embodiments, the combined administration of the expression construct or vector with a second agent results in an improvement in Wilson's disease or its symptoms to a greater extent than that produced by the expression construct or vector or the second agent alone. The difference between the combined effect and the effect of each agent alone can be a statistically significant difference.

[0228] In some embodiments, compared to the standard dosing regimen approved for the second agent, the combined administration of the expression construct or vector with the second agent allows the second agent to be administered at a reduced dose, a reduced number of doses, and / or a reduced dosing frequency.

[0229] Route and method of administration

[0230] The methods of administration include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, oral, sublingual, intracerebral, intrathecal, intravaginal, transdermal, rectal, by inhalation or topically (especially to the ear, nose, eye or skin). The mode of administration is at the discretion of the practitioner.

[0231] In some cases, the expression constructs or vectors described herein are administered locally. By way of example, this can be achieved by local infusion during surgery, topical application (e.g., in a cream or lotion), by injection, by means of a catheter, by means of a suppository or enema or by means of an implant, which is a porous, non-porous or gel-like material, including membranes, such as silicone rubber membranes or fibers. In some cases, the expression constructs or vectors described herein are introduced into the central nervous system, the circulatory system or the gastrointestinal tract by any suitable route, including intraventricular injection, intrathecal injection, paravertebral injection, epidural injection, enema and injection adjacent to the peripheral nerve.

[0232] The compositions described herein can be administered in a single dose or in multiple doses. Such compositions can be administered at regular time intervals depending on the nature, severity and extent of the disorder of the subject. In some embodiments, a therapeutically effective amount of the expression construct or vector is administered intrathecally at regular time intervals (e.g., once a year, once every six months, once every five months, once every three months, once every two months, monthly / once every month, once every two weeks or once a week).

[0233] Standard clinical techniques known to those of skill in the art can be used to determine the amount of the expression construct or vector described herein that is effective in treating the disease. In addition, in vitro or in vivo assays can optionally be used to assist in identifying the optimal dose range. The exact dose to be employed will also depend on the route of administration, the disorder, the severity of the disorder being treated and various physical factors associated with the individual being treated, and can be determined at the discretion of the healthcare practitioner.

[0234] An effective amount of rAAV carrying a nucleic acid sequence encoding ATP7B under the control of a promoter can be, for example, in the range of about 1×10 9 to 1x 10 13 to about 1.5x 10 17 genomic particles. "Genomic particle" is defined herein as an AAV capsid containing a single-stranded DNA molecule, which can be quantified by sequence-specific methods such as real-time PCR. In some embodiments, about 1x 10 13 to about 1.5x 10 17A viral genome is used for systemic delivery. In some embodiments, about 1x10 11 viral genomes are used per animal. The attending physician may also select other doses within these ranges.

[0235] It should be understood that for any particular subject, the specific dosage regimen may be adjusted over time according to individual needs and the professional judgment of the person administering or supervising the administration of the expression construct or vector, and the dosage ranges described herein are only exemplary and are not intended to limit the scope or practice of the claimed disclosure.

[0236] In some embodiments, it may be necessary to administer multiple "booster" doses of the pharmaceutical compositions disclosed herein. For example, depending on the duration of the transgene within the target cells, booster doses may be delivered at 6-month intervals or annually after the first administration. Other similar tests can be used to determine the status of the treated subject over time. The attending physician may select the appropriate tests.

[0237] Articles and kits

[0238] Kits or articles for the methods described herein are also provided. In various aspects, the kit contains the compositions described herein (e.g., compositions for delivering an ATP7B-encoding transgene) in a suitable package. Suitable packages for the compositions described herein (such as ophthalmic compositions for injection) are known in the art and include, for example, vials (such as sealed vials), containers, ampoules, bottles, jars, flexible packages (e.g., sealed mylar or plastic bags), etc. These articles may be further sterilized and / or sealed.

[0239] Kits containing the compositions described herein are also provided. These kits may also contain instructions regarding methods of using the compositions (such as the uses described herein). The kits described herein may also include other materials that may be required from a commercial and user perspective, including buffers, diluents, filters, needles, syringes, and package inserts having instructions regarding the administration of the compositions or the performance of any method described herein. For example, in some embodiments, the kit contains rAAV for expressing an ATP7B-encoding transgene in target cells, a pharmaceutically acceptable carrier suitable for injection, and one or more of the following: buffer, diluent, filter, needle, syringe, and a package insert having instructions regarding the performance of the injection.

[0240] Unless otherwise indicated herein or otherwise clearly contradicted by the context, all methods described herein are performed in any suitable order. With respect to any method provided, the steps of the method may occur simultaneously or sequentially. When the steps of the method occur sequentially, unless otherwise indicated, the steps may occur in any order.

[0241] In cases where the method comprises a combination of steps, unless otherwise specified herein, each combination or sub-combination of steps is encompassed within the scope of the present disclosure.

[0242] It should be understood that the present invention is not limited to the specific molecules, compositions, methods, or protocols described, as these may vary. Any methods and materials similar or equivalent to those described herein may be used to practice or test embodiments of the present invention. It should also be understood that the disclosure of the present invention in this specification includes all possible combinations of such specific features. For example, in cases where a specific feature is disclosed in the context of a particular aspect or embodiment or particular claim of the present invention, the feature may also be used in combination with and / or in the context of other particular aspects and embodiments of the present invention to the extent possible, and is generally used in the present invention.

[0243] All other cited patents and applications are hereby incorporated by reference in their entirety. Additionally, when the definition or use of a term in the references incorporated by reference herein is inconsistent or contradictory to the definition of the said term provided herein, the definition of the said term provided herein shall prevail and the definition of the said term in the references shall not apply.

[0244] For better understanding of the present invention, the following examples of specific embodiments are given. The following examples should not be construed as limiting or defining the entire scope of the present invention.

[0245] Examples

[0246] Example 1: Method for Examples 1 - 5

[0247] Cell culture

[0248] The Huh-7, AML-12, and HEK 293 immortalized cell lines were maintained at 37 °C in 5% CO2. Cells were transiently transfected with plasmids using BC transfection reagent. After 72 hours, cell lysates were collected for protein analysis. After 20 passages, new cell aliquots were thawed and passaged twice, and then used for subsequent experiments.

[0249] Primary hepatocyte culture

[0250] Thaw Gibco's mouse and human hepatocyte lines and place them in suspension medium, then centrifuge at 100 x g for 10 minutes at 4°C. Aspirate the supernatant and resuspend the cells in maintenance medium (+10% FBS), then seed at 400,000 cells per well on a 24-well plate. Four hours after seeding, gently tap the plate to loosen debris, then aspirate the medium and replace it with maintenance medium without FBS. The cells are maintained at 37°C in 5% CO2. Perform a complete medium change daily to feed the culture.

[0251] Transduction

[0252] For immortalized cells and primary cell cultures, on day 1 and day 3 in vitro respectively, add AAV8 particles to the medium at a multiplicity of infection (MOI) of 50,000. Add medium containing doxorubicin to the cells to accelerate transduction. After 72 hours, change the medium to medium without doxorubicin according to the standard protocol.

[0253] Western blot

[0254] Gently wash the cells with PBS, then add ice-cold lysis buffer (CST) containing nuclease, protease, and phosphatase inhibitors. Allow the cells to lyse on ice on the plate with stirring for 30 minutes and then collect. Lyse liver tissue samples (about 30 mg) in cold RIPA buffer containing nuclease, protease, and phosphatase inhibitors and perform two rounds of sonication. Vortex the samples vigorously to ensure complete lysis and then pellet at 20,000 x g in a microcentrifuge at 4°C for 15 minutes. Collect the supernatant and determine the protein concentration by BCA (bicinchoninic acid) assay. Then, standardize the proteins to a standard concentration using 4X LDS, 10X DTT, and lysis buffer. Denature the samples at 75°C for 10 minutes.

[0255] For the analysis of ATP7B expression, separate 10 μg protein samples on a Bolt 4-12% Bis-Tris denaturing gel (Invitrogen, USA) using MOPS buffer. Then, transfer the gel to a nitrocellulose membrane at a constant 0.4 A for 2 hours. Probe the membrane overnight at 4°C with the first antibodies (ATP7B, GAPDH, CHOP, CD11b, β-actin) diluted in Licor TBS blocking buffer. Then wash the membrane with TBS-T and probe with a fluorescent-conjugated anti-mouse or anti-rabbit IgG secondary antibody for one hour at room temperature. Image the membrane on a LICOR Odyssey imaging system. Normalize the amount of protein using a β-actin or GAPDH control band.

[0256] Animal studies

[0257] Seven-week-old male ATP7B backcrossed to C57BL / 6 were obtained from Baylor College of Medicine and bred by Charles River Laboratories. Mice were housed at a constant temperature (23 °C) on a 12-h light / dark cycle (lights on from 0700 to 1900 h) with five animals per cage and had free access to food and water. All studies were reviewed by the Institutional Animal Care and Use Committee (IACUC). - / - At 7 weeks of age, adeno-associated virus (AAV) serotype 2 / 8 (5 x 10

[0258] GC / kg) was delivered by tail vein injection. Mice were restrained and placed under a warming lamp to increase vasodilation, and a 27G needle was used to target the tail vein. Eight weeks later, after vasodilation with a heating lamp, blood was collected into BD serum microtainers (#02-675-185) by incising the lateral tail vein. Samples were allowed to clot at room temperature for 30 minutes and then spun at 2,000 x g for 10 minutes in a refrigerated centrifuge. Subsequently, ALT activity in the resulting serum was measured according to the manufacturer's protocol (Bioassays #EALT-100). Twelve weeks later, the animals were euthanized and perfused with cold PBS. Organs were collected and snap-frozen in liquid nitrogen and then prepared for molecular analysis. 12 Example 2: Identification of an effective promoter for ATP7B expression

[0259] Example 2: Identification of an effective promoter for ATP7B expression

[0260] Promoters are an integral part of gene therapy, influencing transgene expression levels, timing, persistence, and cell type specificity. A library of tissue-specific and constitutive promoters was developed for the expression of ATP7B. See Table 2-12. This article provides promoters that provide stronger expression in immortalized hepatocytes (Huh7, HepG2, AML-12) compared to commonly used reference promoters, including: the CAG promoter (composed of: (1) the cytomegalovirus (CMV) early enhancer element, (2) the promoter, first exon, and first intron of the chicken β-actin gene, and (3) the splice acceptor of the rabbit β-globin gene), the α-1-antitrypsin (AAT) promoter, and the human thyroxine-binding globulin (TBG) promoter, liver-specific promoter 1 (LP1), hybrid liver promoter (HLP), and hepatic combinatorial bundle promoter (HCB). The promoters in the promoter library have equal or greater strength compared to CAG and are also significantly smaller. A subset of these liver-specific library promoters was selected to examine their use for expressing the miniATP7B microgene. Using a dual reporter flow-based assay in transfected human Huh7 cells, the activity of the liver-specific promoters was compared to the activity of commonly used promoters ( Figure 2A ).

[0261] In both humans (Huh-7) and mice (AML-12), among the promoters tested, the L15 and L13 promoters both drove particularly high expression of miniATP7B in vitro ( Figure 2B and Table 1).

[0262] Example 3: Identification of Effective ATP7B Microgenes

[0263] Meanwhile, different variants of the miniATP7B gene were also developed. See Tables 6 and 9.

[0264] To assess ATP7B microgene activity, the copper pump activity of ATP7B knockout (KO) cells transfected with constructs containing different transgenes was tested using a copper reporter in combination with flow cytometry ( Figure 3A ). After treatment with copper sulfate, the mClover3 fluorescence increased. Expression of full-length ATP7B or the ATP7B microgene blocked this increase ( Figure 3B ). The efficacy of the transgene was assessed by measuring the activity of the copper reporter as the transgene concentration decreased ( Figure 3C ).

[0265] In the copper reporter assay, the microgene was tested against wild-type ATP7B (full-length) by co-transfection with a copper-inducible mClover expression construct ( Figure 3A)。Assess the function of each variant and find that it is comparable to full-length wild-type ATP7B at all tested copper sulfate doses. The potency of each variant was assessed by transfecting different concentrations of ATP7B and miniATP7B transgenes and then measuring copper efflux activity by copper reporter binding flow cytometry ( Figure 3C )。Compared to ATP7B-FL, the miniATP7B variant TG2 (miniATP7B-s1co) showed improved copper pump activity at lower concentrations, indicating increased potency. The transgenes miniATP7B-s1co (TG2) and miniATP7B-s1co3 encode proteins with the same amino acid sequence (SEQ ID NO:246). For Figure 3B and Figure 3C in the activity assay, the promoter and 3 ′ UTR elements remained the same, allowing direct comparison of differences in transgene activity.

[0266] Example 4: ATP7B expression constructs

[0267] Combine the selected promoter candidates with the selected miniATP7B transgene candidates and other regulatory elements (Tables 1 and 7). In different cell models, ATP7B expression was compared to the published reference cassette AAT-miniATP7Bv (Murillo et al., Liver Expression of a MiniATP7B Gene Results in Long-Term Restoration of Copper Homeostasis in a Wilson Disease Model in Mice. Hepatology, July 2019;70(1):108-126). This construct corresponds to construct A2 herein.

[0268] Compared to the reference cassette, constructs A12 and A20 showed particularly high ATP7B expression in both the AML12 and Huh-7 immortalized cell lines and in primary human and mouse hepatocytes after transduction with AAV8 (Figure 4, Table 1). The comparison of construct A12 with A39 highlighted the importance of the promoter element for overall transgene expression. When the L15 promoter in A12 was replaced with the standard L1_v2 promoter (as in A39), in vitro transgene expression was significantly reduced ( Figure 4B ).

[0269] Table 1. Overview of miniATP7B expression of reference constructs and selected promoters in an in vitro cell model. REF = AAT-miniATP7B-sPolyA, disclosed in Murillo et al., 2019. Prim. = primary.

[0270]

[0271] Example 5: ATP7B Expression in Vivo

[0272] Next, the selected expression constructs A12, A20, and A39 were tested in an in vivo model (ATP7B knockout mice) using AAV8-mediated transduction to assess functional and phenotypic rescue.

[0273] The virus was injected via the tail vein of each mouse. Blood was collected at 8 weeks to assess ALT function. Organs were collected at 12 weeks post-injection to assess expression and spleen weight.

[0274] Based on the in vitro data, A12, A20, and A39 showed significantly higher protein expression in the liver of ATP7B mice than A2 ( Figure 5A and Figure 5B ). The expression of A12 and A20 in heterozygous (HET) mice was 100-fold and 200-fold higher than the endogenous ATP7B expression ( Figure 5B ). HET mice were phenotypically identical to wild-type mice but had a 50% reduction in ATP7B expression. Notably, this expression was not accompanied by the expression of the immune marker CD11b or the ER stress marker CHOP ( Figure 5A ). In addition, miniATP7B expression was accompanied by the rescue of the Wilson's disease phenotype (increased alanine transaminase (ALT) activity) due to liver injury and splenomegaly ( Figure 5C and Figure 5D ).

[0275] Sequence Overview

[0276] An overview of the sequences disclosed herein can be found in Tables 2-12.

[0277] Table 2. Overview of promoter sequences. See also Table 8.

[0278]

[0279]

[0280] Table 3. Overview of the ATP7B minigene sequences. See also Table 9.

[0281]

[0282]

[0283] Table 4. Overview of additional genetic elements. See also Table 10.

[0284] SEQ ID NO Element 49 WPRE250 50 WPRE3 51 sPolyA 52 SV40 late pA 53 4xmiR142 116 <![CDATA[5 ′ ITR (for A1 - A62)]]> 117 <![CDATA[3 ′ ITR (for A1 - A62)]]>

[0285] Table 5. Overview of expression construct sequences. See also Tables 7 and 11.

[0286]

[0287]

[0288] Table 6. Overview of protein sequences. See also Table 12.

[0289]

[0290] Table 7. Composition of the expression construct.

[0291]

[0292]

[0293]

[0294]

[0295]

[0296] Table 8. Promoter sequences. SN: = SEQ ID NO.

[0297]

[0298]

[0299]

[0300]

[0301]

[0302]

[0303]

[0304]

[0305]

[0306]

[0307]

[0308]

[0309]

[0310]

[0311]

[0312] Table 9. ATP7B microgene sequence.

[0313]

[0314]

[0315]

[0316]

[0317]

[0318]

[0319]

[0320]

[0321]

[0322]

[0323]

[0324]

[0325]

[0326]

[0327]

[0328]

[0329]

[0330]

[0331]

[0332]

[0333]

[0334]

[0335]

[0336]

[0337]

[0338]

[0339]

[0340]

[0341]

[0342]

[0343]

[0344]

[0345]

[0346]

[0347]

[0348]

[0349] Table 10. Sequences of additional genetic elements.

[0350]

[0351] Table 11. Construct sequences (including 5 ′ and 3 ′ ITR). SN: = SEQ ID NO.

[0352]

[0353]

[0354]

[0355]

[0356]

[0357]

[0358]

[0359]

[0360]

[0361]

[0362]

[0363]

[0364]

[0365]

[0366]

[0367]

[0368]

[0369]

[0370]

[0371]

[0372]

[0373]

[0374]

[0375]

[0376]

[0377]

[0378]

[0379]

[0380]

[0381]

[0382]

[0383]

[0384]

[0385]

[0386]

[0387]

[0388]

[0389]

[0390]

[0391]

[0392]

[0393]

[0394]

[0395]

[0396]

[0397]

[0398]

[0399]

[0400]

[0401]

[0402]

[0403]

[0404]

[0405]

[0406]

[0407]

[0408]

[0409]

[0410]

[0411]

[0412]

[0413]

[0414]

[0415]

[0416]

[0417]

[0418]

[0419]

[0420]

[0421]

[0422]

[0423]

[0424]

[0425]

[0426]

[0427]

[0428]

[0429]

[0430]

[0431]

[0432]

[0433]

[0434]

[0435]

[0436]

[0437]

[0438]

[0439]

[0440]

[0441]

[0442]

[0443]

[0444]

[0445]

[0446]

[0447]

[0448]

[0449]

[0450]

[0451]

[0452]

[0453]

[0454]

[0455]

[0456]

[0457]

[0458]

[0459]

[0460]

[0461]

[0462]

[0463]

[0464]

[0465]

[0466]

[0467]

[0468]

[0469]

[0470]

[0471]

[0472]

[0473]

[0474]

[0475]

[0476]

[0477]

[0478]

[0479]

[0480]

[0481]

[0482]

[0483]

[0484]

[0485]

[0486]

[0487]

[0488]

[0489]

[0490]

[0491]

[0492]

[0493]

[0494]

[0495]

[0496]

[0497]

[0498]

[0499]

[0500]

[0501]

[0502]

[0503] Table 12. Protein Sequence

[0504]

[0505]

[0506]

[0507]

[0508]

[0509]

[0510]

[0511]

[0512]

Claims

1. An expression construct, the expression construct comprising: (a) a promoter; (b) a sequence encoding (copper-transporting ATPase β) ATP7B, operably linked to the promoter; and (c) a polyadenylation signal.

2. The expression construct according to claim 1, wherein the promoter comprises a sequence that is at least 80% identical to a sequence selected from the group consisting of SEQ ID NOs: 4-33.

3. The expression construct according to claim 2, wherein the promoter comprises a sequence that is at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 4-33.

4. The expression construct according to claim 3, wherein the promoter comprises a sequence that is at least 95% identical to a sequence selected from the group consisting of SEQ ID NOs: 4-33.

5. The expression construct according to claim 4, wherein the promoter comprises a sequence selected from the group consisting of SEQ ID NOs: 4-33.

6. The expression construct according to claim 1, wherein the promoter comprises a sequence that is at least 80% identical to any one of SEQ ID NO: 4, SEQ ID NO: 10, or SEQ ID NO:

11.

7. The expression construct according to claim 6, wherein the promoter comprises a sequence that is at least 90% identical to any one of SEQ ID NO: 4, SEQ ID NO: 10, or SEQ ID NO:

11.

8. The expression construct according to claim 7, wherein the promoter comprises a sequence that is at least 95% identical to any one of SEQ ID NO: 4, SEQ ID NO: 10, or SEQ ID NO:

11.

9. The expression construct according to claim 8, wherein the promoter comprises any one of SEQ ID NO: 4, SEQ ID NO: 10, or SEQ ID NO:

11.

10. The expression construct according to any one of claims 1-8, wherein the sequence encoding ATP7B is codon-optimized.

11. The expression construct according to any one of claims 1-8, wherein the sequence encoding ATP7B comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 35-48.

12. The expression construct according to claim 11, wherein the sequence encoding ATP7B comprises a sequence that is at least 90% identical to any one of SEQ ID NOs: 35-48.

13. The expression construct according to claim 12, wherein the sequence encoding ATP7B comprises a sequence that is at least 95% identical to any one of SEQ ID NOs: 35-48.

14. The expression construct according to claim 13, wherein the sequence encoding ATP7B comprises a sequence selected from the group consisting of SEQ ID NOs: 35-48.

15. The expression construct according to any one of claims 1-8, wherein the sequence encoding ATP7B comprises a sequence that is at least 80% identical to SEQ ID NO:39 or SEQ ID NO:

41.

16. The expression construct according to claim 15, wherein the sequence encoding ATP7B comprises a sequence that is at least 90% identical to SEQ ID NO:39 or SEQ ID NO:

41.

17. The expression construct according to claim 16, wherein the sequence encoding ATP7B comprises a sequence that is at least 95% identical to SEQ ID NO:39 or SEQ ID NO:

41.

18. The expression construct according to claim 17, wherein the sequence encoding ATP7B comprises SEQ ID NO:39 or SEQ ID NO:

41.

19. The expression construct according to any one of the preceding claims, wherein the sequence encoding ATP7B encodes a protein comprising a sequence that is at least 80% identical to any one of SEQ ID NOs:118-128.

20. The expression construct according to claim 19, wherein the sequence encoding ATP7B encodes a protein comprising a sequence that is at least 90% identical to any one of SEQ ID NOs:118-128.

21. The expression construct according to claim 20, wherein the sequence encoding ATP7B encodes a protein comprising a sequence that is at least 95% identical to any one of SEQ ID NOs:118-128.

22. The expression construct according to claim 21, wherein the sequence encoding ATP7B encodes a protein comprising any one of SEQ ID NOs:118-128.

23. The expression construct according to claim 19, wherein the sequence encoding ATP7B encodes a protein comprising a sequence that is at least 80% identical to SEQ ID NO:118 or SEQ ID NO:

123.

24. The expression construct according to claim 23, wherein the sequence encoding ATP7B encodes a protein comprising a sequence that is at least 90% identical to SEQ ID NO:118 or SEQ ID NO:

123.

25. The expression construct according to claim 24, wherein the sequence encoding ATP7B encodes a protein comprising a sequence that is at least 95% identical to SEQ ID NO:118 or SEQ ID NO:

123.

26. The expression construct according to claim 25, wherein the sequence encoding ATP7B encodes a protein comprising SEQ ID NO:118 or SEQ ID NO:

123.

27. The expression construct according to any one of the preceding claims, wherein the expression construct further comprises a post-transcriptional regulatory element.

28. The expression construct according to claim 27, wherein the post-transcriptional regulatory element comprises a sequence that is at least 80% identical to SEQ ID NO:49 or SEQ ID NO:

50.

29. The expression construct according to claim 28, wherein the post-transcriptional regulatory element comprises a sequence that is at least 90% identical to SEQ ID NO: 49 or SEQ ID NO:

50.

30. The expression construct according to claim 29, wherein the post-transcriptional regulatory element comprises a sequence that is at least 95% identical to SEQ ID NO: 49 or SEQ ID NO:

50.

31. The expression construct according to claim 30, wherein the post-transcriptional regulatory element comprises SEQ ID NO: 49 or SEQ ID NO:

50.

32. The expression construct according to claim 27, wherein the post-transcriptional regulatory element comprises a sequence that is at least 80% identical to SEQ ID NO:

49.

33. The expression construct according to claim 32, wherein the post-transcriptional regulatory element comprises a sequence that is at least 90% identical to SEQ ID NO:

49.

34. The expression construct according to claim 33, wherein the post-transcriptional regulatory element comprises a sequence that is at least 95% identical to SEQ ID NO:

49.

35. The expression construct according to claim 34, wherein the post-transcriptional regulatory element comprises SEQ ID NO:

49.

36. The expression construct according to any one of claims 1-35, wherein the polyadenylation signal comprises a sequence that is at least 80% identical to SEQ ID NO: 51 or SEQ ID NO:

52.

37. The expression construct according to claim 36, wherein the polyadenylation signal comprises a sequence that is at least 90% identical to SEQ ID NO: 51 or SEQ ID NO:

52.

38. The expression construct according to claim 37, wherein the polyadenylation signal comprises a sequence that is at least 95% identical to SEQ ID NO: 51 or SEQ ID NO:

52.

39. The expression construct according to claim 38, wherein the polyadenylation signal comprises SEQ ID NO: 51 or SEQ ID NO:

52.

40. The expression construct according to any one of claims 1-35, wherein the polyadenylation signal comprises a sequence that is at least 80% identical to SEQ ID NO:

51.

41. The expression construct according to claim 40, wherein the polyadenylation signal comprises a sequence that is at least 90% identical to SEQ ID NO:

51.

42. The expression construct according to claim 41, wherein the polyadenylation signal comprises a sequence that is at least 95% identical to SEQ ID NO:

51.

43. The expression construct according to claim 42, wherein the polyadenylation signal comprises SEQ ID NO:

51.

44. The expression construct according to any one of the preceding claims, wherein the expression construct further comprises a miRNA binding site (miRBS).

45. The expression construct according to claim 44, wherein the miRBS comprises a sequence that is at least 80% identical to SEQ ID NO:

53.

46. The expression construct according to claim 45, wherein the miRBS comprises a sequence that is at least 90% identical to SEQ ID NO:

53.

47. The expression construct according to claim 46, wherein the miRBS comprises a sequence that is at least 95% identical to SEQ ID NO:

53.

48. The expression construct according to claim 47, wherein the miRBS comprises SEQ ID NO:

53.

49. The expression construct according to claim 1, wherein the expression construct comprises: (a) a promoter comprising a sequence that is at least 80% identical to SEQ ID NO: 11; (b) a sequence encoding ATP7B, operably linked to the promoter, comprising a sequence that is at least 80% identical to SEQ ID NO: 41; (c) a post-transcriptional regulatory element comprising a sequence that is at least 80% identical to SEQ ID NO: 49; and (d) a polyadenylation signal comprising a sequence that is at least 80% identical to SEQ ID NO:

51.

50. The expression construct according to claim 49, wherein the expression construct comprises: (a) a promoter comprising a sequence that is at least 90% identical to SEQ ID NO: 11; (b) a sequence encoding ATP7B, operably linked to the promoter, comprising a sequence that is at least 90% identical to SEQ ID NO: 41; (c) a post-transcriptional regulatory element comprising a sequence that is at least 90% identical to SEQ ID NO: 49; and (d) a polyadenylation signal comprising a sequence that is at least 90% identical to SEQ ID NO:

51.

51. The expression construct according to claim 50, wherein the expression construct comprises: (a) a promoter comprising a sequence that is at least 95% identical to SEQ ID NO: 11; (b) a sequence encoding ATP7B, operably linked to the promoter, comprising a sequence that is at least 95% identical to SEQ ID NO: 41; (c) a post-transcriptional regulatory element comprising a sequence that is at least 95% identical to SEQ ID NO: 49; and (d) a polyadenylation signal comprising a sequence that is at least 95% identical to SEQ ID NO:

51.

52. The expression construct according to claim 1, wherein the expression construct comprises: (a) a promoter comprising SEQ ID NO: 11; (b) a sequence encoding ATP7B, operably linked to the promoter, comprising SEQ ID NO: 41; (c) a post-transcriptional regulatory element comprising SEQ ID NO: 49; and (d) a polyadenylation signal comprising SEQ ID NO:

51.

53. The expression construct according to claim 1, wherein the expression construct comprises: (a) a promoter comprising a sequence that is at least 80% identical to SEQ ID NO: 10; (b) A sequence encoding ATP7B, operably linked to said promoter, comprising a sequence that is at least 80% identical to SEQ ID NO:39; (c) A miRBS comprising a sequence that is at least 80% identical to SEQ ID NO:53; (d) A post-transcriptional regulatory element comprising a sequence that is at least 80% identical to SEQ ID NO:49; and (e) A polyadenylation signal comprising a sequence that is at least 80% identical to SEQ ID NO:

51.

54. The expression construct according to claim 53, wherein the expression construct comprises: (a) A promoter comprising a sequence that is at least 90% identical to SEQ ID NO:10; (b) A sequence encoding ATP7B, operably linked to said promoter, comprising a sequence that is at least 90% identical to SEQ ID NO:39; (c) A miRBS comprising a sequence that is at least 90% identical to SEQ ID NO:53; (d) A post-transcriptional regulatory element comprising a sequence that is at least 90% identical to SEQ ID NO:49; and (e) A polyadenylation signal comprising a sequence that is at least 90% identical to SEQ ID NO:

51.

55. The expression construct according to claim 54, wherein the expression construct comprises: (a) A promoter comprising a sequence that is at least 95% identical to SEQ ID NO:10; (b) A sequence encoding ATP7B, operably linked to said promoter, comprising a sequence that is at least 95% identical to SEQ ID NO:39; (c) A miRBS comprising a sequence that is at least 95% identical to SEQ ID NO:53; and (d) A post-transcriptional regulatory element comprising a sequence that is at least 95% identical to SEQ ID NO:49; and (e) A polyadenylation signal comprising a sequence that is at least 95% identical to SEQ ID NO:

51.

56. The expression construct according to claim 1, wherein the expression construct comprises: (a) A promoter comprising SEQ ID NO:10; (b) A sequence encoding ATP7B, operably linked to said promoter, comprising SEQ ID NO:39; (c) A miRBS comprising SEQ ID NO:53; (d) A post-transcriptional regulatory element comprising SEQ ID NO:49; and (e) A polyadenylation signal comprising SEQ ID NO:

51.

57. The expression construct according to claim 1, wherein the expression construct comprises: (a) A promoter comprising a sequence that is at least 80% identical to SEQ ID NO:4; (b) A sequence encoding ATP7B, operably linked to said promoter, comprising a sequence that is at least 80% identical to SEQ ID NO:41; (c) A post-transcriptional regulatory element comprising a sequence that is at least 80% identical to SEQ ID NO:49; and (d) A polyadenylation signal comprising a sequence that is at least 80% identical to SEQ ID NO:

51.

58. The expression construct according to claim 57, wherein the expression construct comprises: (a) a promoter comprising a sequence that is at least 90% identical to SEQ ID NO: 4; (b) a sequence encoding ATP7B, operably linked to the promoter, comprising a sequence that is at least 90% identical to SEQ ID NO: 41; (c) a post-transcriptional regulatory element comprising a sequence that is at least 90% identical to SEQ ID NO: 49; and (d) a polyadenylation signal comprising a sequence that is at least 90% identical to SEQ ID NO:

51.

59. The expression construct according to claim 58, wherein the expression construct comprises: (a) a promoter comprising a sequence that is at least 95% identical to SEQ ID NO: 4; (b) a sequence encoding ATP7B, operably linked to the promoter, comprising a sequence that is at least 95% identical to SEQ ID NO: 41; (c) a post-transcriptional regulatory element comprising a sequence that is at least 95% identical to SEQ ID NO: 49; and (d) a polyadenylation signal comprising a sequence that is at least 95% identical to SEQ ID NO:

51.

60. The expression construct according to claim 59, wherein the expression construct comprises: (a) a promoter comprising SEQ ID NO: 4; (b) a sequence encoding ATP7B, operably linked to the promoter, comprising SEQ ID NO: 41; (c) a post-transcriptional regulatory element comprising SEQ ID NO: 49; and (d) a polyadenylation signal comprising SEQ ID NO:

51.

61. A vector, the vector comprising the expression construct according to any one of claims 1-60.

62. The vector according to claim 57, wherein the vector is a viral vector.

63. The vector according to claim 62, wherein the vector is an AAV vector.

64. A vector comprising a nucleic acid sequence, the nucleic acid sequence comprising (i) the expression construct according to any one of claims 1-60 and (ii) one or more inverted terminal repeats (ITRs).

65. The vector according to claim 64, wherein the nucleic acid sequence comprises a 5' ITR and a 3' ITR.

66. The vector according to claim 65, wherein the 5' ITR and the 3' ITR are derived from adeno-associated virus (AAV) serotype AAV2.

67. The vector according to claim 65, wherein the sequence of the 5' ITR is at least 80% identical to SEQ ID NO:

116.

68. The vector according to claim 66, wherein the sequence of the 5' ITR is at least 90% identical to SEQ ID NO:

116.

69. The vector according to claim 67, wherein the sequence of the 5' ITR is at least 95% identical to SEQ ID NO:

116.

70. The vector according to claim 69, wherein the sequence of the 5' ITR comprises SEQ ID NO:

116.

71. A vector according to any one of claims 65 or 67 - 70, wherein the sequence of the 3′ ITR is at least 80% identical to SEQ ID NO:

117.

72. A vector according to claim 71, wherein the sequence of the 3′ ITR is at least 90% identical to SEQ ID NO:

117.

73. A vector according to claim 72, wherein the sequence of the 3′ ITR is at least 95% identical to SEQ ID NO:

117.

74. A vector according to claim 73, wherein the sequence of the 3′ ITR comprises SEQ ID NO:

117.

75. A vector comprising the expression construct according to claim 1, wherein the expression construct comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 54 - 115.

76. A vector according to claim 75, wherein the vector comprises a sequence that is at least 90% identical to any one of SEQ ID NOs: 54 - 115.

77. A vector according to claim 76, wherein the vector comprises a sequence that is at least 95% identical to any one of SEQ ID NOs: 54 - 115.

78. A vector according to claim 77, wherein the vector comprises any one of SEQ ID NOs: 54 - 115.

79. A vector comprising the expression construct according to claim 1, wherein the vector comprises a sequence that is at least 80% identical to any one of SEQ ID NO: 65, SEQ ID NO: 73 or SEQ ID NO:

92.

80. A vector according to claim 79, wherein the vector comprises a sequence that is at least 90% identical to any one of SEQ ID NO: 65, SEQ ID NO: 73 or SEQ ID NO:

92.

81. A vector according to claim 80, wherein the vector comprises a sequence that is at least 95% identical to SEQ ID NO: 65, SEQ ID NO: 73 or SEQ ID NO:

92.

82. A vector according to claim 81, wherein the vector comprises SEQ ID NO: 65, SEQ ID NO: 73 or SEQ ID NO:

92.

83. A vector according to any one of claims 57 - 82, wherein the vector comprises a capsid derived from AAV7m8, AAV9, AAV2 - retro or AAVrh.

10.

84. A cell comprising the expression construct according to any one of claims 1 - 60 or the vector according to any one of claims 61 - 82.

85. A pharmaceutical composition comprising (i) the expression construct according to claims 1 - 60 or the vector according to any one of claims 61 - 83, and (ii) a pharmaceutically acceptable carrier.

86. A method for increasing the ATP7B activity in a subject in need thereof, the method comprising administering to the subject a vector as described in any one of claims 61 - 82 or a pharmaceutical composition as described in claim 85.

87. A method for increasing copper secretion in a subject in need thereof, the method comprising administering to the subject a vector as described in any one of claims 61 - 82 or a pharmaceutical composition as described in claim 85.

88. A method for treating a disorder in a subject in need thereof caused by ATP7B deficiency or dysfunction, the method comprising administering to the subject a vector as described in any one of claims 61 - 82 or a pharmaceutical composition as described in claim 85.

89. A method for treating Wilson's disease in a subject in need thereof, the method comprising administering to the subject a vector as described in any one of claims 61 - 82 or a pharmaceutical composition as described in claim 85.

90. A method for reducing dystonia or bradykinesia in a subject suffering from Wilson's disease, the method comprising administering to the subject a vector as described in any one of claims 61 - 82 or a pharmaceutical composition as described in claim 85.

91. A method for reducing the incidence of leukopenia or anemia in a subject suffering from Wilson's disease, the method comprising administering to the subject a vector as described in any one of claims 61 - 82 or a pharmaceutical composition as described in claim 85.

92. A method for reducing the incidence of liver cirrhosis in a subject suffering from Wilson's disease, the method comprising administering to the subject a vector as described in any one of claims 61 - 82 or a pharmaceutical composition as described in claim 85.

93. The method as described in any one of claims 86 - 92, wherein the subject is human.

Images