Synthesis method of two chains in DNB double-terminal sequencing, sequencing method and related products

CN120322565APending Publication Date: 2025-07-15MGI TECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202280102350.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2022-12-09
Publication Date
2025-07-15

AI Technical Summary

Technical Problem

The quality of second-strand sequencing in existing DNB paired-end sequencing is poor, characterized by high Lag%, low Q30%, and rapid signal decline, mainly due to the insufficient stability of Phi29 polymerase and the instability of the second-strand synthesis process.

Method used

Second-strand synthetic primers anchored on the surface of the sequencing chip are used for second-strand synthesis, Bst3.0 polymerase is used for second-strand synthesis, and DNB is digested and removed through digestion labeling to ensure the stability and purity of the second-strand template strand.

Benefits of technology

It improves the quality of second-strand sequencing, significantly improves Total Reads, Q30% and ESR%, and reduces Lag%, thus improving the overall sequencing quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120322565A_ABST
    Figure CN120322565A_ABST
Patent Text Reader

Abstract

The invention provides a synthesis method of two chains in DNB double-terminal sequencing, a sequencing method and a related product. Wherein the two-chain synthesis method comprises the following steps: after one-chain sequencing is carried out on DNB, two-chain synthesis is carried out by utilizing a two-chain synthesis primer, and the two-chain synthesis primer is a primer capable of being anchored on the surface of a sequencing chip. According to the present invention, the two-chain synthesis is performed by using the two-chain synthesis primer anchored on the surface of the sequencing carrier, such that the two-chain synthesis process is relatively stable, and the synthesized two-chain template is anchored on the sequencing carrier so as to perform sequencing on the two-chain template chain anchored on the sequencing carrier, such that the relatively high two-chain sequencing quality can be obtained.
Need to check novelty before this filing date? Find Prior Art

Description

Synthesis method, sequencing method and related products of the second strand in DNB double-end sequencing Technical Field

[0001] The present invention relates to the field of gene sequencing technology, and in particular to a method for synthesizing two chains in DNB double-end sequencing, a sequencing method, and related products. Background Art

[0002] Paired-end sequencing based on the DNBSEQ sequencing platform involves adding sequencing primer binding sites to both end adapters during the construction of the DNA library to be tested. After the first round of sequencing, a strand displacement reaction removes the template strand used in the first round, creating a template for the second round of sequencing. Synthesis and sequencing of the complementary strand then proceed. Analysis of the sequencing quality of the second-strand sequencing revealed poor quality, primarily characterized by high Lag%, low Q30%, and rapid signal dropout. Improving the quality of second-strand sequencing is crucial for improving overall sequencing quality.

[0003] The formation of second strands, catalyzed by the strand displacement activity of Phi29 polymerase, requires meticulous control, such as controlling the stability of the Phi29 DNA polymerase. Phi29 polymerase is relatively unstable, and any decrease in enzyme activity can affect second strand synthesis, leading to a high second strand Lag%, a low Q value, and a rapid signal drop. Effective removal of Phi29 DNA polymerase requires the screening of novel elution reagents and increased elution times, both of which are detrimental to efficient sequencing.

[0004] Therefore, residual Phi29 DNA polymerase after the second-strand reaction is complete, blockage by ddNTPs, and excessive strand displacement DNA products can all reduce the quality of second-strand sequencing. Enabling second-strand sequencing to avoid excessive second-strand template generation through strand displacement reactions, like single-strand sequencing, is a key step in improving second-strand sequencing quality.

[0005] Summary of the Invention

[0006] The main purpose of the present invention is to provide a method for synthesizing the second strand in DNB double-end sequencing, a sequencing method and related products to solve the problem of poor second-strand sequencing quality in the prior art.

[0007] To achieve the above objectives, according to one aspect of the present invention, a method for synthesizing two strands in DNB double-end sequencing is provided. The method comprises: after completing one-strand sequencing of the DNB, performing two-strand synthesis using a two-strand synthesis primer, wherein the two-strand synthesis primer is a primer that can be anchored on the surface of a sequencing chip.

[0008] Furthermore, the ends of the above-mentioned two-strand synthesis primers are modified and coupled to the bridge molecules on the surface of the sequencing chip through the modification. Preferably, the ends of the two-strand synthesis primers are modified with DBCO, SH, azide, or alkyne; preferably, the bridge molecules on the surface of the sequencing chip are NHS-PEG8-azido, SMCC, NHS-DBCO, or NHS-azido.

[0009] Furthermore, the above-mentioned synthesis method includes: after the completion of single-strand sequencing, eluting and removing the single-strand sequencing chain bound to the DNB to release the DNB; using the released DNB as a template, performing second-strand synthesis using a second-strand synthesis primer; preferably, using at least one of the following elution reagents to elute and remove the single-strand sequencing chain: an organic denaturant, a 3'-5' nuclease and NaOH; preferably, the organic denaturant is formamide; preferably, the working concentration of formamide is molecular biology grade, more preferably the mass concentration is 100%-99.5%; preferably, the mass concentration of NaOH is 0.01-0.1M.

[0010] Furthermore, the above synthesis method uses Bst3.0 polymerase to perform two-chain synthesis; preferably, after the two-chain synthesis, the synthesis method also includes: digesting and removing DNBs.

[0011] Furthermore, double-end sequencing is performed by preparing DNBs containing digestion markers. After double-strand synthesis, the DNBs are digested and removed using the digestion markers, wherein the digestion markers are selected from any one of the following: an enzyme cleavage site, a modified monodeoxyribonucleotide, a non-natural nucleotide, or a ribonucleotide; preferably, the enzyme cleavage site is the Nb.BbvCI enzyme cleavage site: 5'-CCTCAGC-3'; preferably, the modified monodeoxyribonucleotide is 8-OXO-dGTP; preferably, the non-natural nucleotide is dITP; preferably, the ribonucleotide is dUTP.

[0012] Furthermore, the use of a digestion marker to digest and remove DNBs includes any of the following methods: (1) the digestion marker is a restriction enzyme site, the DNB is digested, and then the digestion product is eluted with an organic denaturant, preferably, the Nb.BbvCI enzyme is used for digestion; preferably, the organic denaturant is formamide; (2) the digestion marker is a modified monodeoxyribonucleotide, and the modified monodeoxyribonucleotide is 8-OXO-dGTP, the DNB is digested with human alkyladenine DNA glycosylase and endonuclease IV, and then the digestion product is eluted with an organic denaturant; preferably, the digestion temperature is 37°C; preferably, the organic denaturant is (3) when the digestion marker is a non-natural nucleotide and the non-natural nucleotide is dITP, the DNB is digested with endonuclease V, and the digestion product is eluted with an organic denaturant; preferably, the organic denaturant is one or more of sodium citrate, Tris-HCl and EDTA; (4) when the digestion marker is a ribonucleotide and the ribonucleotide is dUTP, the DNB is digested with USER enzyme, and the digestion product is eluted with an organic denaturant; preferably, the organic denaturant is one or more of sodium citrate, Tris-HCl and EDTA.

[0013] To achieve the above objectives, according to one aspect of the present invention, a method for sequencing a second strand in DNB double-end sequencing is provided, the method comprising: synthesizing a second strand sequencing template using the above second strand synthesis method; and sequencing the second strand sequencing template using a second strand sequencing primer.

[0014] To achieve the above objectives, according to one aspect of the present invention, a sequencing chip is provided, wherein the surface of the sequencing chip is modified with a bridge molecule that can be coupled to a primer with an end modification, wherein the bridge molecule is selected from any one of the following: NHS-PEG8-azido, SMCC, NHS-DBCO and NHS-azido.

[0015] In order to achieve the above-mentioned object, according to one aspect of the present invention, a kit is provided, which comprises any multiple of the following: Nb.BbvCI enzyme, human alkyladenine DNA glycosylase, endonuclease IV, endonuclease V, USER enzyme, formamide, a primer with DBCO, a primer with SH, a primer with azide, a primer with an alkyne group and Bst3.0 polymerase.

[0016] To achieve the above objectives, according to one aspect of the present invention, a sequencing complex is provided, which includes: a sequencing chip, the sequencing chip carrying DNBs, an optional single-strand sequencing chain, and a two-strand synthesis primer or a two-strand sequencing template chain, wherein the two-strand synthesis primer or the two-strand sequencing template chain is fixed on the sequencing chip.

[0017] Furthermore, the surface of the sequencing chip in the above-mentioned sequencing complex is modified with a bridge molecule, the two-strand synthesis primer is modified with a coupling group, and the two-strand synthesis primer is fixed on the sequencing chip through the coupling between the coupling group and the bridge molecule; preferably, the end of the two-strand synthesis primer is modified with DBCO, SH, azide, or alkyne; preferably, the bridge molecule on the surface of the sequencing chip is NHS-PEG8-azide, SMCC, NHS-DBCO, or NHS-azide.

[0018] To achieve the above-mentioned object, according to one aspect of the present invention, a DNB double-end sequencing method is provided, which comprises: loading the DNB onto the above-mentioned sequencing chip; after performing one-chain sequencing on the DNB, performing the above-mentioned two-chain sequencing method; or performing one-chain sequencing on the DNB; after completing the one-chain sequencing, performing two-chain synthesis using the above-mentioned method to obtain a two-chain sequencing template; and performing two-chain sequencing on the two-chain sequencing template.

[0019] By applying the technical solution of the present invention, when performing second-strand synthesis, second-strand synthesis primers anchored on the surface of a sequencing vector are used for second-strand synthesis, making the second-strand synthesis process relatively more stable, and the synthesized second-strand template chain is anchored on the sequencing vector, and then the second-strand template chain anchored on the sequencing vector is sequenced, which can obtain relatively higher second-strand sequencing quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] The accompanying drawings, which constitute part of this application, are intended to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are intended to explain the present invention and do not constitute an undue limitation of the present invention. In the accompanying drawings:

[0021] FIG1 shows a technical solution route according to the present invention.

[0022] FIG2 shows a schematic diagram of conventional DNB sequencing. DETAILED DESCRIPTION

[0023] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present application can be combined with each other. The present invention will be described in detail below with reference to the embodiments.

[0024] As mentioned in the background art, the existing DNB double-end sequencing method shows high Lag%, low Q30%, rapid signal dropout, etc. in the two-chain sequencing results, resulting in poor quality of two-chain sequencing. At the same time, the polymerase Phi29 used in the two-chain synthesis has the problem of insufficient stability, which is also one of the factors affecting the quality of two-chain sequencing. Therefore, in this application, the inventors use a new two-chain synthesis method. When performing two-chain synthesis, two-chain synthesis is performed by using two-chain synthesis primers anchored on the surface of the sequencing vector to ensure that the two-chain synthesis process is carried out in an orderly manner through the primers anchored on the sequencing vector, and high-quality two-chain sequencing is performed under conditions where the two-chain synthesis is stable. In addition, the use of the more stable Bst3.0 polymerase to synthesize the two chains can also achieve quality assurance of two-chain sequencing.

[0025] In a first typical embodiment of the present invention, a method for synthesizing two strands in DNB double-end sequencing is provided, the synthesis method comprising: after completing one-strand sequencing of the DNB, performing two-strand synthesis using a two-strand synthesis primer; wherein the two-strand synthesis primer is a primer that can be anchored on the surface of a sequencing carrier.

[0026] The synthesis method described above differs from conventional two-strand synthesis methods in that the present invention anchors the two-strand synthesis primers to the surface of the sequencing support. Conventional two-strand synthesis uses free primers for two-strand synthesis, while the present invention immobilizes the two-strand synthesis primers, thereby anchoring the synthesized two-strand template strand to the surface of the sequencing support, forming a stable two-strand template strand, thereby improving the quality of subsequent sequencing using this two-strand template strand.

[0027] In order to further improve the stability of the two-strand sequencing template on the carrier, the present application adopts the idea of ​​anchoring the two-strand to the sequencing carrier. By anchoring the two-strand synthesis primer on the sequencing chip, the two-strand synthesis process is made more stable to generate high-quality two-strand template chains. The specific method of anchoring the two-strand sequencing template on the sequencing carrier through the synthesis step can be achieved by the existing known chemical coupling method. The end of the above-mentioned two-strand synthesis primer is modified and coupled with the bridge molecule on the surface of the sequencing chip through modification. Any chemical substance that can complete the coupling can be used as an end modification and bridge substance. In a preferred embodiment, the end of the two-strand synthesis primer is DBCO modified, SH modified, azide modified, and alkyne modified; in a preferred embodiment, the bridge molecule on the surface of the sequencing chip is NHS-PEG8-azido, SMCC (full name: 4-(N-maleimidomethyl)cyclohexane-1-carboxylic acid succinimide ester), NHS-DBCO (DBCO full name dibenzocyclooctyne), NHS-azido.

[0028] In the above-mentioned two-strand synthesis method, performing two-strand synthesis using DNB as a template further includes: after the completion of one-strand sequencing, eluting and removing the one-strand sequencing chain bound to the DNB to release the DNB; and performing two-strand synthesis using the released DNB as a template using a two-strand synthesis primer. There are various ways to elute and remove the one-strand sequencing chain, including but not limited to using at least one of the following elution reagents: an organic denaturant, a 3'-5' exonuclease, and NaOH. In a preferred embodiment, the organic denaturant is formamide; in a preferred embodiment, the working concentration of formamide is 100%-99.5%, molecular biology grade; in a preferred embodiment, the mass concentration of NaOH is 0.01-0.1M. To release DNBs, the double helix structure connecting one sequencing strand to the DNB needs to be disrupted. Strong bases and organic denaturants can disrupt the hydrogen bonds between the DNA double helix. 3'-5' exonucleases degrade DNA by breaking phosphodiester bonds, and further remove one sequencing strand through elution. Formamide elution is performed at 40°C for 10 minutes, under which conditions DNBs will not be eluted. Furthermore, because DNBs are single-stranded DNA and resemble wool balls, they lack 3'-5' free ends and are therefore not degraded.

[0029] In order to further improve the purity of the synthesized two-strand template, so as to further reduce or avoid the interference of DNB in ​​the subsequent application of the two-strand template, in a preferred embodiment of the present application, after the above-mentioned two-strand synthesis, the synthesis method further includes: digesting and removing the DNB. After completing the two-strand synthesis, the DNB template is digested and removed so that only the synthesized two-strand exists in the subsequent application of the two-strand template chain (such as in a system for two-strand sequencing), further avoiding the problem of reduced sequencing quality caused by the presence of too many two-strand templates in the system during two-strand sequencing in the prior art. In a preferred embodiment, the enzyme used for two-strand synthesis is Bst3.0 polymerase. A stable DNA polymerase with high heat resistance is used to generate two chains to improve the stability of the two-chain synthesis chain, thereby further ensuring the quality of two-chain sequencing.

[0030] The above-mentioned method of digesting and removing DNBs is not limited, and any method that can achieve this purpose is applicable to this application. In some preferred embodiments of the present application, double-end sequencing is performed by preparing DNBs containing digestion markers. After the second strand is synthesized, the DNBs are digested and removed using the digestion markers. The digestion markers are selected from any one of the following: restriction sites, modified monodeoxyribonucleotides, non-natural nucleotides, or ribonucleotides. By disrupting the DNA double helix structure of the DNBs, the DNBs are fragmented, thereby completing the digestion of the DNBs.

[0031] The digestion mark of the restriction site can be enzymatically cleaved by a relevant enzyme. In a preferred embodiment, the restriction site is the Nb.BbvCI restriction site: 5'-CCTCAGC-3'; the modified monodeoxyribonucleotide can also be recognized and cleaved by a specific repair enzyme. In a preferred embodiment, the modified monodeoxyribonucleotide is 8-OXO-dGTP; in a preferred embodiment, the non-natural nucleotide is dITP; in a preferred embodiment, the ribonucleotide is dUTP.

[0032] The above-mentioned digestion mark removes DNB by digestion, including any of the following methods: (1) digesting DNB by enzyme, and then eluting the digestion product with an organic denaturant. In a preferred embodiment, Nb.BbvCI enzyme is used for digestion, and formamide is used as the organic denaturant; (2) human alkyl adenine DNA glycosylase and endonuclease IV are used to digest DNB, and then the digestion product is eluted with an organic denaturant; in a preferred embodiment, DNB contains 8-OXO-dGTP site; the digestion temperature is 37°C; the organic denaturant is one or more of sodium citrate, Tris-HCl and EDTA; (3) endonuclease V is used to digest DNB, and then the digestion product is eluted with an organic denaturant; in a preferred embodiment, DNB contains dITP; the organic denaturant is one or more of sodium citrate, Tris-HCl and EDTA; (4) using USER Enzyme digests the DNB, and then an organic denaturant is used to elute the digestion product. In a preferred embodiment, the DNB comprises dUTP; the organic denaturant is one or more of sodium citrate, Tris-HCl, and EDTA.

[0033] When the DNB contains a modified monodeoxyribonucleotide, 8-OXO-dGTP, hAAG (human alkyladenine DNA glycosylase) and Endonuclease IV are used to digest the DNB. After the two enzymes recognize the 8-OXO-dGTP site, hAAG cleaves the 5'-end phosphodiester bond of the 8-OXO-dGTP site, generating a 3' hydroxyl group and a 5' deoxyribose phosphate terminus. Endonuclease IV also has 3' diesterase and 3'-5' exonuclease activities, and the DNB (one sequencing strand) is subsequently removed by elution.

[0034] When the DNB contains a non-natural nucleotide, dITP, the DNB is digested with Endonuclease V. After the enzyme recognizes the dITP site, it cleaves the second phosphodiester bond at the 3' end of the site, forming a 3' hydroxyl and a 5' phosphate nick. The DNB is then removed by elution.

[0035] When DNBs contain the non-natural nucleotide dUTP, USER enzyme is used to digest the DNB. USER enzyme is a mixture of uracil DNA glycosylase (UDG) and the DNA glycosylase-lyase Endo VIII. UDG catalyzes the cleavage of the uracil base, forming an abasic (apyrimidinic) site while leaving the phosphodiester backbone intact. The lyase activity of Endo VIII cleaves the phosphodiester bonds at the 3' and 5' ends of the abasic site, releasing the base-free deoxyribose; subsequent elution completes the DNB removal.

[0036] In a second exemplary embodiment of the present invention, a method for sequencing a second strand in DNB paired-end sequencing is provided, comprising: synthesizing a second strand sequencing template using the aforementioned second strand synthesis method; and sequencing the second strand sequencing template using a second strand sequencing primer. The second strand synthesized by the aforementioned second strand synthesis method is of higher quality under conditions of a more stable DNA polymerase, and DNB elution in the system eliminates interference from DNBs, thereby providing a strong guarantee for maximally improving the quality of second strand sequencing.

[0037] In a third exemplary embodiment of the present invention, a sequencing chip is provided, the surface of which is modified with a bridge molecule capable of coupling with a terminally modified primer. The bridge molecule is selected from any one of the following: NHS-PEG8-azide, SMCC, NHS-DBCO, and NHS-azide. By modifying the surface of the sequencing chip with the bridge molecule, the second-strand synthesis primer is anchored to the chip, thereby stabilizing the second-strand synthesis process and ensuring the quality of subsequent sequencing of the second-strand synthesis chain.

[0038] In a fourth exemplary embodiment of the present invention, a kit is provided, comprising any of the following: Nb.BbvCI enzyme, human alkyladenine DNA glycosylase, endonuclease IV, endonuclease V, USER enzyme, formamide, a primer containing DBCO, a primer containing SH, a primer containing an azide, a primer containing an alkyne, and Bst3.0 polymerase. This kit includes relevant substances in the two-strand synthesis process of the present invention to ensure digestion and elution during the two-strand synthesis process, and to maximize the quality of the two-strand synthesis process.

[0039] In a fifth exemplary embodiment of the present invention, a sequencing complex is provided, comprising: a sequencing chip carrying a DNB, an optional single-strand sequencing strand, and a dual-strand synthesis primer or a dual-strand sequencing template strand, wherein the dual-strand synthesis primer or the dual-strand sequencing template strand is immobilized on the sequencing chip. In a preferred embodiment, the surface of the sequencing chip is modified with a bridge molecule, the dual-strand synthesis primer is modified with a coupling group, and the dual-strand synthesis primer is immobilized on the sequencing chip through coupling between the coupling group and the bridge molecule. In a preferred embodiment, the ends of the dual-strand synthesis primer are modified with DBCO, SH, azide, or alkyne; and the bridge molecule on the surface of the sequencing chip is NHS-PEG8-azido, SMCC, NHS-DBCO, or NHS-azido. This sequencing support can be used for dual-strand synthesis. By immobilizing the dual-strand template strand on the solid support, a stable environment is provided for the dual-strand synthesis process, which is beneficial to improving the quality of its synthesis and sequencing.

[0040] In a sixth exemplary embodiment of the present invention, a DNB paired-end sequencing method is provided, comprising: loading DNBs onto the aforementioned sequencing chip; performing single-strand sequencing on the DNBs, and then performing the aforementioned two-strand sequencing method; or performing single-strand sequencing on the DNBs; after single-strand sequencing, performing two-strand synthesis using the aforementioned method to obtain a two-strand sequencing template; and performing two-strand sequencing on the two-strand sequencing template. The aforementioned DNB paired-end sequencing method can produce a higher-quality two-strand synthesized strand, and after DNB elution in the system, interference from DNBs is eliminated, thereby providing a strong guarantee for the quality of two-strand sequencing to the greatest extent possible.

[0041] The present application is further described in detail below with reference to specific embodiments. These embodiments should not be construed as limiting the scope of protection claimed in this application.

[0042] Example 1

[0043] The experimental equipment used in this example is a BGISEQ-500 sequencer, an MGIDL-200H loader, and a BGISEQ-500 sequencing slide.

[0044] The experimental reagents and raw materials used in this example are: Formamide (analytical grade), NHS-PEG8-azido, ultrapure water, E. coli single-stranded circular DNA as a template, i.e., Standard Library Reagent V3.0, and primer sequence: CAACTCCTTGGCTCACAGAACATGGCTACGATCCGACTT (SEQ ID NO: 1). DNA polymerase was from BGI, and DNA nanospheres were from BGI. The following experiments all used E. coli single-stranded circular DNA as a template, and the BGISEQ-500 high-throughput sequencing kit was used to prepare DNA nanospheres and load them onto the chip for subsequent sequencing.

[0045] The digestion marker sequence mentioned in this example is the Nb.BbvCI restriction site, i.e., 5'-CCTCAGC-3'. After one strand of sequencing is completed, the newly synthesized strand is eluted with a formamide reagent. Using NHS-PEG8-azido as a bridge, the DBCO-MP1 primer is coupled to the surface of the sequencing slide under certain conditions.

[0046] The specific method is as follows: NHS-PEG8-azido bridge is dissolved in PBS at a certain concentration (0.001-1 mg / mL), treated at room temperature for 30 minutes on a sequencing slide, and unreacted NHS-PEG8-azido reagent is eluted with PBS; DBCO-MP1 primer is dissolved in primer hybridization buffer (component is 5x SSC) to a certain concentration (0.1-2 μM), treated at 40°C for 3 hours on a sequencing slide, and formamide is treated on the sequencing slide at 37°C for 10 minutes to wash away unreacted DBCO-MP1 primer; then Bst3.0 polymerase is pumped in for second-strand synthesis (see Figure 1).

[0047] Comparative Example 1

[0048] The difference from Example 1 is that the synthesis was performed by conventional two-strand synthesis (as shown in FIG2 ), that is, the DBCO-MP1 primer was not coupled to the surface of the sequencing slide using NHS-PEG8-azido as a bridge.

[0049] Comparison of the sequencing quality results of Example 1 and Comparative Example 1:

[0050] Test conditions of Example 1: Primer: Read 1: normal insertion primer; Read 2: bridge molecule NHS-PEG8-Azido couples DBCO-primer to the surface of the sequencing chip to initiate second-strand synthesis: L02: Bst3.0@57°C, 30 min.

[0051] Test conditions of Comparative Example 1: Read 1: normal primer insertion; L02: normal double-end sequencing method, that is, double-strand sequencing is performed using the product of read 1 as the double-strand sequencing template chain.

[0052] Table 1:

[0053] Example 1 Comparative Example 1 Total reads 179.02 151.06 Q30% 91.77 88.3 ESR% 82.09 69.68 Lag% 0.09 0.12

[0054] From the above description, it can be seen that the above-mentioned embodiments of the present invention achieve the following technical effects: the double-strand sequencing results under the method of the present invention can obtain higher Total Reads, Q30% and ESR% and lower double-strand Lag%. These indicators are of great significance for NGS sequencing: Total Reads refers to the total number of reads contained in the fastq file generated by the basecall machine without splitting, the higher the better; Q30% refers to the proportion of bases with an estimated error rate lower than 0.001 (accuracy higher than 99.9%) in the basecall result, the higher the better; ESR% refers to the proportion of valid reads in the original unfiltered fastq data generated by the basecall process, the higher the better; the Lag% indicator can be used to evaluate the completeness of the biochemical reaction, the lower the better. It can be seen that this scheme and reagents used in sequencing methods and sequencing kits will improve the sequencing quality of the product, thereby helping to increase the value and market share of the product.

[0055] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention are intended to be within the scope of protection of the present invention.

Claims

1. A method for synthesizing a second strand in DNB double-end sequencing, characterized in that: The synthesis method comprises: After one-strand sequencing of the DNB is completed, second-strand synthesis is performed using a second-strand synthesis primer, wherein the second-strand synthesis primer is a primer that can be anchored on the surface of a sequencing chip.

2. The synthesis method according to claim 1, wherein The end of the double-stranded synthesis primer is modified and coupled to the bridge molecule on the surface of the sequencing chip through the modification. Preferably, the end of the double-stranded synthesis primer carries DBCO modification, SH modification, azide modification or alkyne modification; Preferably, the bridge molecule on the surface of the sequencing chip is NHS-PEG8-azide, SMCC, NHS-DBCO or NHS-azide.

3. The synthesis method according to claim 1, wherein The synthesis method comprises: after the sequencing of the first strand is completed, eluting and removing the first strand of sequencing chain bound to the DNB to release the DNB; using the released DNB as a template and using the second strand synthesis primer to perform the second strand synthesis; Preferably, the sequencing strand is eluted and removed using at least one of the following elution reagents: an organic denaturant, a 3'-5' exonuclease, and NaOH; Preferably, the organic denaturant is formamide; Preferably, the mass concentration of the formamide is 100%-99.5%; Preferably, the mass concentration of the NaOH is 0.01-0.1M.

4. The synthesis method according to claim 1, wherein Bst3.0 polymerase is used to perform the second-strand synthesis; Preferably, after the second-chain synthesis, the synthesis method further comprises: digesting and removing the DNB.

5. The synthesis method according to claim 4, characterized in that Double-end sequencing is performed by preparing a DNB containing a digestion marker, and after the second strand is synthesized, the DNB is digested and removed using the digestion marker. Wherein, the digestion marker is selected from any one of the following: an enzyme cleavage site, a modified monodeoxyribonucleotide, a non-natural nucleotide or a ribonucleotide; Preferably, the restriction enzyme cleavage site is the Nb.BbvCI restriction enzyme cleavage site: 5'-CCTCAGC-3'; Preferably, the modified monodeoxyribonucleotide is 8-OXO-dGTP; Preferably, the non-natural nucleotide is dITP; Preferably, the ribonucleotide is dUTP.

6. The synthesis method according to claim 5, characterized in that The method of removing the DNB by digestion using the digestion marker includes any of the following methods: (1) The digestion marker is the enzyme cleavage site, the DNB is cleaved, and then the enzyme cleavage product is eluted with an organic denaturant, Preferably, the enzyme cleavage is performed using Nb.BbvCI enzyme; Preferably, the organic denaturant is formamide; (2) the digestion marker is the modified monodeoxyribonucleotide, and the modified monodeoxyribonucleotide is 8-OXO-dGTP, the DNB is digested using human alkyladenine DNA glycosylase and endonuclease IV, and the digestion product is eluted with an organic denaturant; Preferably, the digestion temperature is 37°C; Preferably, the organic denaturant is one or more of sodium citrate, Tris-HCl and EDTA; (3) the digestion marker is the non-natural nucleotide, and the non-natural nucleotide is dITP, the DNB is digested with endonuclease V, and the digestion product is eluted with an organic denaturant; Preferably, the organic denaturant is one or more of sodium citrate, Tris-HCl and EDTA; (4) the digestion marker is the ribonucleotide, and the ribonucleotide is dUTP, the DNB is digested with USER enzyme, and then the digestion product is eluted with an organic denaturant; Preferably, the organic denaturant is one or more of sodium citrate, Tris-HCl and EDTA.

7. A method for sequencing two strands in DNB paired-end sequencing, characterized in that: The sequencing method comprises: Synthesizing a double-stranded sequencing template using the double-stranded synthesis method according to any one of claims 1 to 6; The double-strand sequencing template is sequenced using a double-strand sequencing primer.

8. A sequencing chip, characterized in that: The surface of the sequencing chip is modified with a bridge molecule that can be coupled to a primer with an end modification, wherein the bridge molecule is selected from any one of the following: NHS-PEG8-azido, SMCC, NHS-DBCO and NHS-azido.

9. A kit, characterized in that The kit includes any of the following: Nb.BbvCI enzyme, human alkyladenine DNA glycosylase, endonuclease IV, endonuclease V, USER enzyme, formamide, primers with DBCO, primers with SH, primers with azide, primers with alkyne and Bst3.0 polymerase.

10. A sequencing complex, characterized in that The sequencing complex includes: a sequencing chip, which carries DNB, an optional single-strand sequencing chain, and a double-strand synthesis primer or a double-strand sequencing template chain, wherein the double-strand synthesis primer or the double-strand sequencing template chain is fixed on the sequencing chip.

11. The sequencing complex according to claim 10, characterized in that The surface of the sequencing chip is modified with a bridge molecule, the two-strand synthesis primer is modified with a coupling group, and the two-strand synthesis primer is fixed on the sequencing chip through coupling between the coupling group and the bridge molecule; Preferably, the end of the double-stranded synthesis primer carries DBCO modification, SH modification, azide modification or alkyne modification; Preferably, the bridge molecules on the surface of the sequencing chip are NHS-PEG8-azide, SMCC, NHS-DBCO, and NHS-azide.

12. A DNB double-end sequencing method, characterized in that: The sequencing method comprises: Loading the DNB onto the sequencing chip according to claim 8; After sequencing the first strand of the DNB, the second strand is sequenced using the sequencing method of claim 7; or Sequencing of one strand of DNB; After one-strand sequencing is completed, performing second-strand synthesis using the method of any one of claims 1 to 6 to obtain a second-strand sequencing template; The strand sequencing template is subjected to second strand sequencing.