Preparation method and application of tumor microenvironment response type cascade targeting small activation nucleic acid nano-drug

Abstract

The invention discloses a preparation method and application of a tumor microenvironment response type cascade targeting small activation nucleic acid nano-drug, and belongs to the technical field of biological medicines. According to the present invention, M2 type TAM targeting peptide CRVLRSGSC modified dendrimer PAMAM is adopted to jointly load small activation RNA (sa-p38, sa-TFEB) of p38 and TFEB, and acid-sensitive liposome is adopted to wrap and protect the compound (CRV-PAMAM / saRNA) to prepare the tumor microenvironment response type cascade targeting small activation nucleic acid nano-drug, and the phenotype and the metabolic mode of M2 type TAM can be reprogrammed into M1 type TAM so as to kill tumor cells, such that the tumor microenvironment response type cascade targeting small activation nucleic acid nano-drug can be used for preparing the tumor microenvironment response type cascade targeting small activation nucleic acid nano-drug, and the tumor microenvironment response type cascade targeting small activation nucleic acid nano-drug can be used for preparing the tumor microenvironment response type cascade targeting small activation nucleic acid nano-drug. And a tumor immune microenvironment is remodeled, and finally, tumor growth is inhibited and even tumors are ablated. The invention has a very wide application prospect in gene therapy and immunotherapy of cancers, hereditary diseases, infectious diseases and the like.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to a preparation method and application of a tumor microenvironment-responsive cascade-targeted small activating nucleic acid nanomedicine. Background Art

[0002] Malignant tumors seriously threaten human health. Immunotherapy is a new type of tumor treatment strategy, mainly by reactivating immune cells in the tumor microenvironment, overcoming immune suppression to play an anti-tumor role, including adoptive cell therapy, monoclonal antibodies, immune checkpoint inhibitors, cytokines, immune adjuvants, etc. However, a large number of tumor-associated macrophages (TAM) present in the tumor microenvironment have led to the failure of immunotherapy to achieve the expected efficacy. TAM are abundantly present in the tumor microenvironment, promoting tumor growth, invasion and migration, metastasis, angiogenesis, etc., and inhibiting anti-tumor immune responses. However, the polarization of TAM is reversible and adjustable. Reprogramming TAM from the M2 phenotype to the anti-tumor M1 phenotype by various means can also achieve tumor suppression. TAM reprogramming can not only avoid the possible side effects caused by the sudden destruction of the tumor microenvironment balance due to the sudden decrease in cell numbers, but also activate the anti-tumor effect of M1-phenotype TAM, reshape the tumor microenvironment, and improve the effect of tumor immunotherapy.

[0003] Gene therapy refers to a new type of treatment method that treats diseases by introducing external genes at the gene level to achieve changes such as replacement, substitution, knock-in / knock-out, activation / inhibition of genes in the body. Small activating RNA (saRNA) is a new type of gene therapy drug, which can stimulate gene expression at the transcriptional level and has the characteristics of small molecular weight, gene specificity, and activation of gene expression. Research shows that upregulating p38 and promoting its phosphorylation can reprogram M2-type TAM into M1-type TAM. Upregulating the transcription factor EB (TFEB) can reprogram the metabolic mode of TAM from oxidative phosphorylation to aerobic glycolysis.

[0004] Like most nucleic acid drugs, saRNA requires an appropriate nucleic acid delivery vector to exert its maximum therapeutic effect. The nucleic acid delivery vector has to cross multiple barriers to reach the inside of cells to play a therapeutic role, such as phagocytosis by the endothelial reticular system in blood circulation, tissue and cell targeting, cell membrane barrier, lysosomal phagocytosis, etc. Dendritic polyamide amine (PAMAM) is a commonly used nucleic acid drug carrier. It contains a large number of primary amine groups, which can buffer the acidic environment in lysosomes, exert the proton sponge effect to escape from lysosomes; it can also be used for the connection of targeting peptides, thereby achieving tissue or cell targeting. However, as a foreign substance, PAMAM is extremely easy to be recognized and phagocytosed by the endothelial reticular system during blood circulation, resulting in inefficient or even ineffective gene therapy. How to reduce the non-specific clearance of nucleic acid drug carriers and improve their tissue / cell targeting is a hot spot and a difficult point in nucleic acid drug delivery. Summary of the Invention

[0005] The present invention uses dendritic macromolecule PAMAM modified with M2-type TAM targeting peptide CRVLRSGSC to co-load small activating RNAs (sa-p38, sa-TFEB) of p38 and TFEB, and uses acid-sensitive liposomes to wrap and protect the above complex (CRV-PAMAM / saRNA) to prepare a tumor microenvironment-responsive cascade targeting small activating nucleic acid nanodrug, which is effective for in-situ solid tumors except brain tumors. The liposomes on the outer layer of the tumor microenvironment-responsive cascade targeting small activating nucleic acid nanodrug swell and disintegrate in the weakly acidic tumor microenvironment, and the internal small activating nucleic acid nanocomplex CRV-PAMAM / saRNA is exposed and recognized and enters M2-type TAM under the mediation of the CRVLRSGSC targeting peptide. The proton sponge effect of CRV-PAMAM destroys the lysosome structure, and then enters the cytoplasm and releases sa-p38 and sa-TFEB, up-regulates the expression of p38 and TFEB, promotes the phosphorylation of p38 and the nuclear translocation of TFEB, reprograms the phenotype and metabolic mode of M2-type TAM into M1-type TAM, thereby killing tumor cells and remodeling the tumor immune microenvironment, and finally inhibiting tumor growth or even ablating the tumor.

[0006] The present invention provides a preparation method of a tumor microenvironment-responsive cascade targeting small activating nucleic acid nanodrug, and the preparation method includes the following steps:

[0007] (1) Dilute the G4.0 PAMAM solution with PBS to 0.08 - 0.12 mM. Weigh 3.5 - 4.0 mg of sulfo - GMBS and dissolve it in 0.8 - 1.2 mL of PBS to make a solution, and add it to the above PAMAM solution. Mix well and react at room temperature for 25 - 35 min to remove the unbound GMBS. Add CRVLRSGSC to the reaction solution of the previous step according to a grafting degree of 4 - 6%, and stir - react at 3 - 5 °C for 110 - 130 minutes. Remove the unbound CRVLRSGSC to obtain CRV - PAMAM;

[0008] (2) Add 25 - 35 μg of saRNA to 90 - 110 μL of nuclease - free water. In another tube, add 80 - 85 μL of nuclease - free water and 15 - 20 μL of CRV - PAMAM solution. The mass ratio of saRNA to CRV - PAMAM is 5 - 7. After mixing the two tubes, let it stand at room temperature for incubation for 25 - 35 min to obtain CPS;

[0009] The saRNA is a mixture of sa - p38 - 5 and sa - TFEB - 1, and the mass ratio of sa - p38 - 5 to sa - TFEB - 1 is 1.5 - 2.5:0.5 - 1.5. The sense and antisense strand sequences of sa - p38 - 5 are shown in SEQ ID NO.9 - 10, and the sense and antisense strand sequences of sa - TFEB - 1 are shown in SEQ ID NO.13 - 14;

[0010] The concentration of the CRV - PAMAM solution is 8 - 12 μg / μL;

[0011] (3) Dissolve dipalmitoylphosphatidylcholine, cholesterol, and distearoylphosphatidylethanolamine - poly(2 - ethyl - 2 - oxazoline) in an organic solvent according to a molar ratio of 1.5 - 2.5:0.5 - 1.5:0.3 - 0.5. Rotate - evaporate to remove the organic solvent. Add CPS to the aqueous phase. The total mass ratio of dipalmitoylphosphatidylcholine, cholesterol, and distearoylphosphatidylethanolamine - poly(2 - ethyl - 2 - oxazoline) to CPS is 8 - 12:0.8 - 1.2. Hydrate in a water bath at 40 - 45 °C until the lipid film completely disappears. Pass the complex solution through filters with pore sizes of 400 nm and 200 nm in sequence, and centrifuge to collect PLCPS.

[0012] Preferably, in step (1), dilute the G4.0 PAMAM solution with PBS to 0.1 mM, and weigh 3.82 mg of sulfo - GMBS and dissolve it in 1 mL of PBS to make a solution.

[0013] More preferably, in step (1), add CRVLRSGSC to the reaction solution of the previous step according to a grafting degree of 5%.

[0014] More preferably, in step (2), 30 μg of saRNA is added to 100 μL of ribonuclease-free water, and 82 μL of ribonuclease-free water and 18 μL of CRV-PAMAM solution with a concentration of 10 μg / μL are added to another tube.

[0015] More preferably, in step (2), the mass ratio of sa-p38-5 to sa-TFEB-1 is 2:1.

[0016] More preferably, in step (3), the molar ratio of dipalmitoylphosphatidylcholine, cholesterol, and distearoylphosphatidylethanolamine-poly(2-ethyl-2-oxazoline) is 2:1:0.4.

[0017] More preferably, in step (3), the mass ratio of the sum of dipalmitoylphosphatidylcholine, cholesterol, and distearoylphosphatidylethanolamine-poly(2-ethyl-2-oxazoline) to CPS is 10:1.

[0018] The present invention also provides a tumor microenvironment-responsive cascade-targeted small activating nucleic acid nanomedicine prepared by the above preparation method.

[0019] The present invention also provides the application of the above tumor microenvironment-responsive cascade-targeted small activating nucleic acid nanomedicine in the preparation of products for treating solid tumors, and the solid tumors include breast cancer, lung cancer, colorectal cancer, hepatocellular carcinoma, pancreatic cancer, gastric cancer, etc.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] After the tumor microenvironment-responsive cascade-targeted small activating nucleic acid nanomedicine of the present invention is passively targeted to tumor tissues, in response to the weakly acidic microenvironment, the lipid outer coat swells and disintegrates, exposing the small activating nucleic acid nanocomplex inside that targets tumor-associated macrophages. After entering the cells through receptor recognition, the small activating nucleic acid nanocomplex releases small activating RNA, regulates gene expression, reprograms M2-type tumor-associated macrophages into M1-type from two aspects of phenotype and metabolic mode, kills tumor cells, and remodels the tumor immunosuppressive microenvironment, so as to achieve the purpose of inhibiting tumor progression. Therefore, it can be seen that the present invention provides a new way for the treatment of tumors. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 In which A) The expression level of p38 mRNA was detected by q-PCR method; B) The expression level of TFEB mRNA was detected by q-PCR method.

[0023] Figure 2A) Confocal laser scanning microscopy was used to observe the cellular uptake of CPS with different grafting degrees, scale bar = 200 μm; B) Flow cytometry was used to detect the average fluorescence intensity of different grafting degree CPS inside cells; C) Agarose gel was used to detect the saRNA blocking ability of PS and CPS with different mass ratios; D) Agarose gel was used to detect the encapsulation of CPS with different mass ratios; E) Comparison of the encapsulation efficiency of CPS with different mass ratios; F) The ability of PS and CPS to resist nuclease degradation; G) Particle size distribution and morphology of CPS with a mass ratio of 6.

[0024] Figure 3 A) Schematic diagram of the acid response of PLCPS; B) Electron micrograph of PL in an environment with pH 5.4, scale bar = 200 nm; C) Particle size comparison of CPS, PL, PLCPS, and PLCPS 5.4; D) Potential comparison of CPS, PL, PLCPS, and PLCPS 5.4; E) Morphology comparison of CPS, PL, PLCPS, and PLCPS 5.4, scale bar = 200 nm; F) Drug release curve of PLCPS under different pH conditions.

[0025] Figure 4 A) Confocal laser scanning microscopy was used to observe the cellular uptake of different formulations, scale bar = 200 μm; B) Flow cytometry was used to detect the average fluorescence intensity of Cy5-saRNA inside cells of different formulations; C) Flow cytometry was used to detect the average fluorescence intensity of Cy3-saRNA inside cells of different formulations; D) Flow cytometry was used to detect the average fluorescence intensity of PLCPS inside different cells; E) Flow cytometry was used to detect the average fluorescence intensity of PLCPS inside different treated cells; F) Confocal laser scanning microscopy was used to observe the lysosomal escape of PLCPS, scale bar = 200 μm; G) Confocal laser scanning microscopy was used to observe the cell viability of macrophages transfected with different formulations, scale bar = 200 μm; H) Western blot was used to detect the protein expression of macrophages transfected with different formulations.

[0026] Figure 5 A) In vivo imaging of small animals was used to observe the distribution and metabolism of different formulations in tumor-bearing mice; B) In vivo imaging of small animals was used to observe the distribution of different formulations in the main organs of tumor-bearing mice; C) Comparison of the tumor fluorescence signals of different formulations in tumor-bearing mice; D) Flow cytometry was used to analyze the co-localization of Cy7-saRNA and tumor-associated macrophages.

[0027] Figure 6 A) Schematic diagram of the animal treatment process; B) Photograph of the tumor of tumor-bearing mice; C) Tumor volume change curve of tumor-bearing mice; D) Body weight change curve of tumor-bearing mice; E) TUNEL immunofluorescence staining, Ki67 immunohistochemical staining, and hematoxylin / eosin staining of tumor tissues, scale bar = 100 μm; F) Comparison of the positive area of TUNEL in tumor tissues; G) Results of the comparison of the positive area of Ki67 in tumor tissues.

[0028] Figure 7 This is the technical concept diagram of the present invention. Detailed implementation manners

[0029] Example 1

[0030] I. Method

[0031] 1. Screening of saRNA sequences

[0032] RAW 264.7 cells were induced into M2 macrophages using IL4. The saRNA and PEI were mixed at a mass ratio of 2:1, vortexed for 15 s, and allowed to stand for 15 min. After the complex was incubated with the cells for 8 h, the culture medium was discarded, and fresh complete culture medium was added and continued to culture for 48 h. The cell RNA was extracted, and after reverse transcription, the expression levels of p38 and TFEB mRNA were detected using q-PCR to screen for effective saRNA sequences.

[0033] sa-p38-1

[0034] Sense (SEQ ID NO.1): 5’-TGCGACCACAGAGAGGCGC-3’;

[0035] Anti sense (SEQ ID NO.2): 5’-GCGCCUCUCUGUGGUCGCA-3’;

[0036] sa-p38-2

[0037] Sense (SEQ ID NO.3): 5’-CTTCCCCGACGCTGTCACA-3’;

[0038] Anti sense (SEQ ID NO.4): 5’-UGUGACAGCGUCGGGGAAG-3’;

[0039] sa-p38-3

[0040] Sense (SEQ ID NO.5): 5’-TCGCCCGTGCGACCACAGA-3’;

[0041] Anti sense (SEQ ID NO.6): 5’-UCUGUGGUCGCACGGGCGA-3’;

[0042] sa-p38-4

[0043] Sense (SEQ ID NO.7): 5’-AAAATACCGACTTTATCTC-3’;

[0044] anti sense(SEQ ID NO.8): 5’-GAGAUAAAGUCGGUAUUUU-3’;

[0045] sa-p38-5

[0046] sense(SEQ ID NO.9): 5’-TCACAGCGGCTTTCCGCCA-3’;

[0047] anti sense(SEQ ID NO.10): 5’-UGGCGGAAAGCCGCUGUGA-3’;

[0048] sa-p38-6

[0049] sense(SEQ ID NO.11): 5’-GGGACCACGGTGCCAGCTT-3’;

[0050] anti sense(SEQ ID NO.12): 5’-AAGCUGGCACCGUGGUCCC-3’;

[0051] sa-TFEB-1

[0052] sense(SEQ ID NO.13): 5’-GATGTGGATGTGACAGCGA-3’;

[0053] anti sense(SEQ ID NO.14): 5’-UCGCUGUCACAUCCUCAUC-3’;

[0054] sa-TFEB-2

[0055] sense(SEQ ID NO.15): 5’-GCTACTGTGAGCAGATGGT-3’;

[0056] anti sense(SEQ ID NO.16): 5’-ACCAUCUGCUCACAGUAGC-3’;

[0057] sa-TFEB-3

[0058] sense(SEQ ID NO.17): 5’-GAGGGAGTCCGAGGCCCGA-3’;

[0059] anti sense(SEQ ID NO.18): 5’-UCGGGCCUCGGACUCCCUC-3’;

[0060] sa-TFEB-4

[0061] sense(SEQ ID NO.19): 5’-TGCAGGCACCAAGGCCGGC-3’;

[0062] anti sense(SEQ ID NO.20): 5’-UCGCUGUCACAUCCUCAUC-3’;

[0063] sa-TFEB-5

[0064] sense(SEQ ID NO.21): 5’-GGCACAGCGGTAGGCCTAT-3’;

[0065] anti sens(SEQ ID NO.22)e: 5’-AUAGGCCUACCGCUGUGCC-3’;;

[0066] sa-TFEB-6

[0067] sense(SEQ ID NO.23): 5’-AATTGACTCCTAGGGAACA-3’;

[0068] anti sense(SEQ ID NO.24): 5’-UGUUCCCUAGGAGUCAAUU-3’;

[0069] p38 primer

[0070] Forward(SEQ ID NO.25): TGACCCTTATGACCAGTCCTTT;

[0071] Reverse(SEQ ID NO.26): GTCAGGCTCTTCCACTCATCTAT;

[0072] TFEB primer

[0073] Forward(SEQ ID NO.27): CCACCCCAGCCATCAACAC;

[0074] Reverse(SEQ ID NO.28): CAGACAGATACTCCCGAACCTT;

[0075] Preparation and Characterization of 2CPS

[0076] 2.1 Synthesis of CRV-PAMAM

[0077] Take an appropriate amount of G4.0 PAMAM solution and dilute it with an appropriate amount of PBS to 0.1 mM. Weigh 3.82 mg of sulfo-GMBS and dissolve it in 1 mL of PBS to make a 10 mM solution, and quickly add it to the PAMAM solution and mix evenly. Stir and react at room temperature for 30 min; use a 3 kDa ultrafiltration tube to remove the unbound GMBS. Add CRVLRSGSC (abbreviated as CRV) to the reaction solution of the previous step at grafting degrees of 5%, 15%, 25%, and 35% respectively, stir and react at 4 °C for 120 min; use a 3 kDa ultrafiltration tube to remove the unbound CRV, and lyophilize the reaction product and redissolve it in water. Scan the ultraviolet absorption spectra of PAMAM, CRV, and CRV-PAMAM (abbreviated as CP) to analyze whether CRV-PAMAM is successfully prepared.

[0078] The above G4.0 PAMAM contains 64 amino groups, and the CRV polypeptide contains 1 mercapto group. The amino group and the mercapto group react in a 1:1 ratio, and 5% of the amino groups are used for the mercapto reaction, which is a grafting degree of 5%.

[0079] 2.2 Screening of grafting degree

[0080] RAW 264.7 cells are induced into M2-type macrophages using IL4. Use Cy5-sa-p38 and Cy3-sa-TFEB to synthesize PS (i.e., PAMAM / saRNA), 5% CPS, 15% CPS, 25% CPS, and 35% CPS respectively according to a mass ratio of 6. After co-incubating CPS with M2-type macrophages for 8 h, use a flow cytometer to detect the intracellular fluorescence intensity, or observe the intracellular distribution of fluorescence using a confocal laser microscope. The above mass ratio of 6 refers to the ratio of the sum of sa-p38 and sa-TFEB to CP, and the mass ratio of sa-p38 and sa-TFEB is 2:1.

[0081] 2.3 Screening of CPS mass ratio

[0082] Take 1 μg of sa-p38 and 0.5 μg of sa-TFEB and dilute them in 10 μL of nuclease-free water. In another tube, add CP with a grafting degree of 5% according to the mass ratios of the sum of saRNA (sa-p38 and sa-TFEB) to CP of 0.75, 1.5, 3, 6, 9, 12, and 15 respectively, and add an appropriate amount of nuclease-free water to make up to 10 μL. Mix the two tubes and vortex for 15 s, and incubate at room temperature for 30 min to prepare CRV-PAMAM / saRNA (abbreviated as CPS). Take 20 μL of the complex solution, add 10*Loading buffer and mix well, then load the sample, electrophorese on a 1% agarose gel at 100 V for 30 min, take a photo with a gel imager and save it to analyze the loading and blocking abilities of CPS with different mass ratios on saRNA.

[0083] Take 3 μg of sa-p38 and 3 μg of sa-TFEB and dilute them in 50 μL of nuclease-free water. In another tube, add CP with a grafting degree of 5% at mass ratios of saRNA total to CP of 0.75, 1.5, 3, 6, 9, 12, and 15 respectively, and make up to 50 μL with an appropriate amount of nuclease-free water. After mixing the two tubes, vortex for 15 s and incubate at room temperature for 30 min to prepare CRV-PAMAM / saRNA (abbreviated as CPS). Centrifuge the CPS solution at 12,000 rpm for 30 min at 4 °C, take 20 μL of the supernatant, add 10*Loading buffer, mix well and load the sample, electrophorese on a 1% agarose gel at 100 V for 30 min, take a photo with a gel imager and save it, and calculate the encapsulation efficiency and drug loading rate.

[0084] Preparation and Characterization of 3PLCPS

[0085] 3.1 Synthesis of PLCPS

[0086] Dipalmitoyl phosphatidylcholine, cholesterol, and distearoyl phosphatidylethanolamine-poly(2-ethyl-2-oxazoline) were dissolved in ethanol at a molar ratio of 2:1:0.4. The organic solvent was removed by rotary evaporation. The CPS complex was added to the aqueous phase (the ratio of the three lipids to the CPS complex was 10:1, w / w), and the mixture was hydrated in a 42 °C water bath for 30 min until the lipid film completely disappeared. The complex solution was successively passed through polycarbonate membranes with pore sizes of 400 nm and 200 nm, and centrifuged at 12,000 rpm for 15 min at 4 °C to collect PLCPS.

[0087] 3.2 pH Responsiveness

[0088] Dipalmitoyl phosphatidylcholine (DPPC), cholesterol, and distearoyl phosphatidylethanolamine-poly(2-ethyl-2-oxazoline) (DSPE-PEOz) were dissolved in ethanol at a molar ratio of 2:1:0.4. The organic solvent was removed by rotary evaporation, and double-distilled water was added. The mixture was hydrated in a 42 °C water bath for 30 min until the lipid film completely disappeared. The complex solution was successively passed through polycarbonate membranes with pore sizes of 400 nm and 200 nm, and centrifuged at 12,000 rpm for 15 min at 4 °C to collect acid-sensitive liposomes PEOz-Liposome (abbreviated as PL). Resuspend PL with pH 5.4 PBS buffer solution. Take 10 μL at 0, 3, 6, and 12 h respectively and drop it on a copper mesh coated with carbon mesh. After thoroughly drying, stain it negatively with phosphotungstic acid, and observe the morphology of PL with a transmission electron microscope.

[0089] PLCPS was diluted in pH 7.4 and pH 5.4 PBS buffer solutions and allowed to stand for 6 h. Take an appropriate amount of the solution to measure the particle size and zeta potential, and compare them with CPS and PL.

[0090] PLCPS was diluted separately in PBS buffer solutions with pH 7.4 and pH 5.4 and allowed to stand for 6 h. 10 μL was taken and dropped on a copper mesh coated with carbon film. After completely drying, it was negatively stained with phosphotungstic acid, and the morphology was observed by transmission electron microscopy and compared with the morphologies of CPS and PL.

[0091] 3.3 Drug release

[0092] PLCPS was prepared with fluorescently labeled saRNA, loaded into a dialysis bag with a molecular weight cut-off of 3500, and placed separately in PBS buffer solutions with pH 5.4 and pH 7.4. The dialysis fluid was taken at 1, 2, 3, 4, 5, 6, 8, 12, 24, 48, and 72 h, and the fluorescence intensity was measured by a fluorescence spectrophotometer to calculate the cumulative drug release rate.

[0093] 4 Reprogramming of macrophages mediated by PLCPS

[0094] 4.1 Cellular uptake

[0095] PLCPS was prepared with saRNA labeled with a fluorescent dye. M2 macrophages were cultured overnight in a 6-well plate, and PBS, saRNA (Cy5-sa-p38 1.6 μg, Cy3-sa-TFEB 0.8 μg), PS, CPS, PLCPS, and PLCPS + 1 mL pH 6.5 (i.e., PLCPS was co-incubated with cells in DMEM culture medium with pH 6.5) were added respectively. Each well contained Cy5-sa-p38 1.6 μg and Cy3-sa-TFEB 0.8 μg. The first 5 groups were supplemented with DMEM culture medium with pH 7.4 to a final volume of 1 mL and incubated for 8 h. The cellular uptake of different preparations was detected by flow cytometry and confocal fluorescence microscopy.

[0096] 4.2 Specific cellular uptake

[0097] Mouse alveolar epithelial cells (MLE12), mouse embryonic fibroblasts (NIH 3T3), and mouse lewis lung cancer cells (LLC) were cultured overnight, and the medium was changed to high-glucose DMEM with pH 6.5. They were co-incubated with PLCPS containing equal mass of fluorescently labeled saRNA for 8 h, and the cellular uptake of different cells was detected by flow cytometry and confocal fluorescence microscopy.

[0098] 4.3 Mechanism of cellular uptake

[0099] M2 macrophages were cultured overnight and pretreated with low temperature (4 °C), amiloride (200 μg / mL), genistein (50 μg / mL), and chlorpromazine (5 μg / mL) for 4 h respectively, and then co-incubated with CPS labeled with a fluorescent dye for 8 h. The cellular uptake under different treatment conditions was detected by flow cytometry to analyze the pathway mechanism of CPS entering cells.

[0100] 4.4 Lysosomal escape

[0101] Culture M2 macrophages overnight, add an equal mass of fluorescently labeled PLCPS, and incubate for 3 h and 12 h respectively. Gently wash the cells twice with PBS, add a green lysosome probe (Yeasen LysoTracker Green DND-26 lysosome green fluorescent probe, product number 40738ES50) and incubate. Observe the lysosomal escape of nanoparticles in cells with a laser confocal microscope.

[0102] 4.5 Cytotoxicity

[0103] Culture M2 macrophages in confocal dishes overnight, and treat them with PBS, saRNA, PS, CPS, PLCPS, PLCPS6.5 (i.e., PLCPS co-incubated with cells in DMEM medium at pH 6.5) for 8 h, then change the medium. Each well contains 1.6 μg of Cy5-sa-p38 and 0.8 μg of Cy3-sa-TFEB. The first 5 groups are cultured in DMEM medium at pH 7.4 and continue to culture until 48 h. Stain the cells with a cell viability / cytotoxicity staining kit, observe the live and dead conditions of the cells with a laser confocal microscope, and analyze the cytotoxicity of different preparations.

[0104] 4.6 Macrophage reprogramming efficiency

[0105] Culture M2 macrophages overnight, add PBS, saRNA, PS, CPS, PLCPS, PLCPS+pH6.5 (i.e., PLCPS co-incubated with cells in DMEM medium at pH 6.5) and incubate for 8 h, then change the medium. Each well contains 1.6 μg of Cy5-sa-p38 and 0.8 μg of Cy3-sa-TFEB. The first 5 groups are cultured in DMEM medium at pH 7.4 and continue to culture until 48 h. Lyse the cells with RIPA lysis buffer, extract the total cellular proteins, and analyze the expression levels of iNOS, Arg1, TFEB, p38, and p-p38 by Western blotting to evaluate the efficiency of PLCPS in reprogramming macrophages.

[0106] 5 Antitumor effect of PLCPS in vivo

[0107] 5.1 In vivo distribution

[0108] Prepare PLCPS with Cy7-saRNA, and the specific process is as follows:

[0109] (1) Dilute the G4.0 PAMAM solution to 0.1 mM with PBS. Weigh 3.82 mg of sulfo - GMBS and dissolve it in 1 mL of PBS to make a 10 mM solution. Then quickly add it to the above PAMAM solution, mix well, stir at room temperature for 30 min, and remove the unbound GMBS. Add CRVLRSGSC to the reaction solution from the previous step according to a grafting degree of 5%, and stir at 4 °C for 120 minutes. Remove the unbound CRVLRSGSC to obtain CRV - PAMAM.

[0110] (2) Take 30 μg of Cy7 - saRNA (the mass ratio of sa - p38 - 5 to sa - TFEB - 1 is 2:1) and add it to 100 μL of nuclease - free water. Add 82 μL of nuclease - free water and 18 μL of CRV - PAMAM (10 μg / μL) to another tube. The mass ratio of saRNA to CRV - PAMAM is 6. After mixing the two tubes, vortex for 15 s and incubate at room temperature for 30 min to obtain CPS.

[0111] (3) Dissolve dipalmitoyl phosphatidylcholine, cholesterol, and distearoyl phosphatidylethanolamine - poly(2 - ethyl - 2 - oxazoline) in ethanol according to a molar ratio of 2:1:0.4. Rotate - evaporate to remove the organic solvent. Add CPS to the aqueous phase (lipid:CPS complex = 10:1, w / w), and hydrate in a 42 °C water bath for 30 min until the lipid film completely disappears. Pass the complex solution through polycarbonate membranes with pore sizes of 400 nm and 200 nm in sequence, centrifuge at 4 °C and 12,000 rpm for 15 min, and collect PLCPS.

[0112] Subcutaneously inject 3×10 6 LLC cells into the right axilla of C57BL / 6J mice to establish a subcutaneous xenograft tumor model. When the tumor volume reaches 100 mm 3 , randomly divide the mice into 5 groups: PBS, saRNA, PS, CPS, PLCPS, and inject the above drugs via the tail vein, 200 μL per mouse, 30 μg of Cy7 - saRNA per mouse, and the mass ratio of sa - p38 to sa - TFEB is 2:1. Image the mice using small - animal imaging at 2, 4, 8, 12, 24, and 48 h after injection to observe the distribution and metabolism of PLCPS in vivo. Dissect the mice at 48 h after injection to take the heart, liver, spleen, lung, kidney, and tumor, and image to observe the distribution of PLCPS in each organ. Digest the tumor tissue into a single - cell suspension, incubate it with AF647 - CD206 antibody on ice, and analyze the co - localization of Cy7 - saRNA and AF - 647 - CD206 + with tumor - associated macrophages by flow cytometry.

[0113] 5.3 Tumor suppression

[0114] When the tumor volume reached 100 mm 3 The mice were randomly divided into 5 groups: PBS, saRNA, PS, CPS, PLCPS. The above drugs were injected via the tail vein, 200 μL per mouse, 30 μg saRNA per mouse (sa-p38: saTFEB = 20 μg: 10 μg), and the drug was administered every 3 days. The tumor volume and body weight were measured every two days, and the mice were dissected 5 days after the last administration. The tumor tissues were taken for photographing and weighing, and the mouse tumor tissues were fixed with 4% paraformaldehyde and then sectioned. TUNEL staining was used to detect cell death in the tumor tissues, and Ki67 staining was used to detect cell proliferation in the tumor tissues.

[0115] II. Results

[0116] q-PCR screened the sequences of sa-p38 and sa-TFEB. sa-p38-5 up-regulated the p38 mRNA level, showing significant differences from other sequences ( Figure 1 A), and sa-TFEB-1 significantly up-regulated the TFEB mRNA level ( Figure 1 B). Therefore, sa-p38-5 and sa-TFEB-1 were selected as the saRNA sequences of p38 and TFEB, and sa-p38-5 and sa-TFEB-1 were used in subsequent experiments.

[0117] Laser confocal microscopy was used to observe the uptake of CPS with different grafting degrees by M2-type macrophages. Obvious green fluorescence and red fluorescence were visible in the cells treated with PS. As the grafting degree of CRVLRSGSC increased, the fluorescence in the cells decreased ( Figure 2 A). Flow cytometry was used to quantitatively analyze the fluorescence signal in the cells. The average fluorescence intensity in the cells of 15% CPS, 25% CPS, and 35% CPS was significantly lower than that of PS, while there was no obvious decrease in 5% CPS ( Figure 2 B). Therefore, 5% CRVLRSGSC grafting degree was selected to synthesize CPS. When the mass ratio of CPS was 6, it could exactly block saRNA in the loading well ( Figure 2 C), indicating that it could exactly load saRNA at this time, and the encapsulation efficiency was close to 100% ( Figure 2 D and 2E). saRNA was completely degraded after being co-incubated with nuclease for 15 min, while PS and CPS still effectively protected saRNA after co-incubation for 60 min ( Figure 2 F). Based on the above results, CPS was prepared with a mass ratio = 6. The particle size of CPS was 140.0 ± 4.30 nm, the zeta potential was 19.1 ± 1.3 mV, and it was round in shape ( Figure 2 G).

[0118] Acid-sensitive liposomes (PEOz-Liposome, abbreviated as PL) gradually increase in particle size in an environment with a pH of 5.4, and the liposome structure disappears after 12 hours, indicating complete disintegration ( Figure 3 B), indicating that PL has acid sensitivity. The particle size of PL is 106 ± 4.9 nm, and the particle size of PLCPS is 175.5 ± 12.2 nm. After being placed in a pH 5.4 PBS buffer for 6 hours (PLCPS 5.4), the particle size changes to 131.6 ± 14.6 nm ( Figure 3 C). PL is negatively charged, PLCPS has a negative charge similar to that of PL, while PLCPS 5.4 has a positive charge similar to that of CPS ( Figure 3 D). The changes in particle size and zeta potential both indicate that PL has successfully encapsulated CPS and degrades in an acidic environment, releasing free CPS. CPS is a round nanoparticle, PL shows an obvious liposome morphology, and round particles can be observed in the liposome cavity in the electron micrograph of PLCPS, further indicating the successful preparation of PLCPS. However, no liposome structure was observed in PLCPS 5.4, and only round-like nanoparticles were visible ( Figure 3 E). The cumulative drug release of PLCPS reaches more than 90% after 72 hours in an environment with a pH of 5.4, while the cumulative release is less than 50% in an environment with a pH of 7.4 ( Figure 3 F).

[0119] CPS shows a strong fluorescence signal in M2 macrophages. PLCPS is negatively charged, so the intracellular fluorescence signal is weak. However, PLCPS co-incubated with cells in an environment with a pH of 6.5 (PLCPS 6.5) has a strong fluorescence signal ( Figure 4 A). Comparing the average intracellular fluorescence intensity, there is no significant difference between PLCPS 6.5 and the CPS group, but there is a significant difference compared with PLCPS ( Figure 4 B, 4C). PLCPS was co-incubated with mouse alveolar epithelial cells (MLE12), mouse embryonic fibroblasts (NIH 3T3), and mouse lewis lung cancer cells (LLC). The average intracellular fluorescence intensity in these cells is weaker than that in M2 macrophages and there are significant differences ( Figure 4 D). Studying the mechanism of CPS entering cells, it was found that there are significant differences in the average intracellular fluorescence intensity between cells pretreated with low temperature, amiloride, and genistein and untreated cells, while there is no obvious difference in the chlorpromazine treatment group ( Figure 4 E), indicating that CPS may enter cells through energy-dependent endocytosis, macropinocytosis, and caveolin-mediated endocytosis. After co-incubating PLCPS with cells for 3 hours, the fluorescence signal overlaps with the blue fluorescence signal of lysosomes, indicating that it is captured by lysosomes at this time. After 12 hours, the fluorescence of PLCPS separates from the lysosome fluorescence signal, and the lysosome fluorescence signal weakens, indicating that PLCPS escapes from lysosomes at this time ( Figure 4F). After transfection with PLCPS for 48 h, the cells of M2 macrophages still showed positive calcein signals. Figure 4 G). After transfection, the cells still had good viability, indicating that PLCPS had low cytotoxicity. After transfection of M2 macrophages with PLCPS, the phosphorylation of p38 increased, the expression of TFEB was up-regulated, the marker protein Arg1 of M2 macrophages decreased, while the marker iNOS of M1 macrophages increased. Figure 4 H). It shows that PLCPS effectively reprograms M2 macrophages by up-regulating the p38 and TFEB pathways.

[0120] After PLCPS was injected into tumor-bearing mice via the tail vein, it gradually accumulated at the tumor site, and the signal at the tumor site was the strongest at 4 h, and there was still a strong fluorescence signal after 48 h. Figure 5 A). After sacrificing the mice at 48 h and taking out the main visceral organs and tumor tissues for re-imaging, the fluorescence was distributed in the liver, spleen, lung and tumor tissues. Figure 5 B). The fluorescence of the PLCPS group at the tumor site was the strongest among all groups. Figure 5 C). The above results indicate that PLCPS effectively targets the tumor site and prolongs the in vivo circulation time. After making the tumor tissues into single-cell suspensions, the tumor-associated macrophages were stained and labeled with AF647-CD206 antibody. The double-positive cell rate of Cy7-saRNA and AF647-CD206 in the PS group was only 8.22%, while that in the CPS group was 16.1%, and the double-positive rate in the PLCPS group was as high as 23.4%. Figure 5 D). It shows that acid-sensitive liposomes and CRVLRSGSC can enhance the tumor targeting of small activating nucleic acid nanodrugs through weak acidic tumor microenvironment response and cascade polypeptide active targeting.

[0121] Tumor-bearing mice were given drugs via the tail vein every 3 days, and the mice were dissected 5 days after the last drug administration. Figure 6 A). The saRNA group had almost no therapeutic effect. Figure 6 B). The tumor volume of the PLCPS group was the smallest, showing the strongest tumor inhibitory effect. Figure 6 B and 6C). During the whole treatment process, the body weights of the mice in each group did not change significantly. Figure 6 D). It indicates that PLPCS has biosafety. The tumor tissue cell nuclei of the mice treated with PLCPS showed pyknosis. Figure 6 E). TUNEL staining showed that the tumor tissue cells of the mice in the PLCPS group underwent apoptosis. Figure 6 E). The apoptosis situation was significantly higher than that of the other preparation treatment groups. Figure 6 F). At the same time, the expression of Ki67 in the tumor tissues of the mice in the PLCPS group decreased. Figure 6 E). There was a significant difference compared with the control group. Figure 6(G), indicating that PLCPS treatment inhibited cell proliferation. Based on the above results, PLCPS can effectively inhibit the growth of non-small cell lung cancer.

[0122] The embodiments described above are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the spirit of the present invention's design, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A preparation method of a tumor microenvironment-responsive cascade-targeted small activating nucleic acid nanomedicine, characterized in that, The preparation method includes the following steps: (1) Dilute the G4.0 PAMAM solution with PBS to 0.08 - 0.12 mM. Weigh 3.5 - 4.0 mg of sulfo-GMBS and dissolve it in 0.8 - 1.2 mL of PBS to make a solution, and add it to the above PAMAM solution. Mix well and react at room temperature for 25 - 35 min to remove unbound GMBS. Add CRVLRSGSC to the reaction solution of the previous step according to a grafting degree of 4 - 6%, and stir and react at 3 - 5 °C for 110 - 130 minutes. Remove unbound CRVLRSGSC to obtain CRV-PAMAM; (2) Add 25 - 35 μg of saRNA to 90 - 110 μL of nuclease-free water. In another tube, add 80 - 85 μL of nuclease-free water and 15 - 20 μL of CRV-PAMAM solution. The mass ratio of saRNA to CRV-PAMAM is 5 - 7. After mixing the two tubes, let it stand and incubate at room temperature for 25 - 35 min to obtain CPS; The saRNA is a mixture of sa-p38-5 and sa-TFEB-1, and the mass ratio of sa-p38-5 to sa-TFEB-1 is 1.5 - 2.5:0.5 - 1.

5. The sense and antisense strand sequences of sa-p38-5 are shown in SEQ ID NO.9 - 10, and the sense and antisense strand sequences of sa-TFEB-1 are shown in SEQ ID NO.13 - 14; The concentration of the CRV-PAMAM solution is 8 - 12 μg / μL; (3) Dissolve dipalmitoylphosphatidylcholine, cholesterol, and distearoylphosphatidylethanolamine-poly(2-ethyl-2-oxazoline) in an organic solvent according to a molar ratio of 1.5 - 2.5:0.5 - 1.5:0.3 - 0.

5. Rotate and evaporate to remove the organic solvent. Add CPS to the aqueous phase. The total mass ratio of dipalmitoylphosphatidylcholine, cholesterol, and distearoylphosphatidylethanolamine-poly(2-ethyl-2-oxazoline) to CPS is 8 - 12:0.8 - 1.

2. Hydrate in a water bath at 40 - 45 °C until the lipid film completely disappears. The complex solution is successively passed through filters with pore sizes of 400 nm and 200 nm, and PLCPS is collected by centrifugation.

2. The preparation method according to claim 1, characterized in that, In step (1), dilute the G4.0 PAMAM solution with PBS to 0.1 mM. Weigh 3.82 mg of sulfo-GMBS and dissolve it in 1 mL of PBS to make a solution.

3. The preparation method according to claim 2, characterized in that, In step (1), add CRVLRSGSC to the reaction solution of the previous step according to a grafting degree of 5%.

4. The preparation method according to claim 3, characterized in that, In step (2), add 30 μg of saRNA to 100 μL of nuclease-free water. In another tube, add 82 μL of nuclease-free water and 18 μL of CRV-PAMAM solution. The concentration of the CRV-PAMAM solution is 10 μg / μL.

5. The preparation method according to claim 4, characterized in that, In step (2), the mass ratio of sa-p38-5 to sa-TFEB-1 is 2:

1.

6. The preparation method according to claim 5, wherein In step (3), the molar ratio of dipalmitoylphosphatidylcholine, cholesterol, and distearoylphosphatidylethanolamine-poly(2-ethyl-2-oxazoline) is 2:1:0.

4.

7. The preparation method according to claim 6, characterized in that, In step (3), the mass ratio of the sum of dipalmitoylphosphatidylcholine, cholesterol, and distearoylphosphatidylethanolamine-poly(2-ethyl-2-oxazoline) to CPS is 10:

1.

8. A tumor microenvironment-responsive cascade-targeted small activating nucleic acid nanomedicine prepared by the preparation method according to any one of claims 1-7.

9. Use of the tumor microenvironment-responsive cascade-targeted small activating nucleic acid nanomedicine according to claim 8 in the preparation of a product for treating solid tumors.

10. The application according to claim 9, wherein The solid tumor is lung cancer.

Images