Targeted Intracellular CRISPR / Cas System Delivery and Gene Editing Enabled by Dendrimers

Abstract

A genome editing composition conjugated to a dendrimer for safe and efficient cell targeting and intracellular delivery of a genome editing system has been established. Compositions and methods for genome editing and gene regulation in one or more diseases and disorders are described. The compositions include a gene editing system, preferably a CRISPR / Cas system conjugated to a dendrimer. In a preferred embodiment, the dendrimer is covalently conjugated to a Cas9 nuclease that is further complexed with a specific single-guide RNA for targeting a genomic segment of a target cell.

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims the benefit and priority of U.S.S.N. 63 / 391,598, filed on July 22, 2022, the content of which is hereby incorporated by reference in its entirety.

[0002] Reference to Sequence Listing The sequence listing filed on July 24, 2023, as a text file named "JHU_C_17439_ST26.xml" and having a size of 6,335 bytes, is hereby incorporated by reference in accordance with 37 C.F.R.§1.834(c)(1).

[0003] Field of the Invention The present invention generally relates to the field of gene modification using a CRISPR - Cas - based gene editing system conjugated to a dendrimer for selective targeting.

Background Art

[0004] Background of the Invention Clustered regularly interspaced short palindromic repeat (CRISPR)-associated Cas9 ribonucleoprotein (RNP) has been utilized as an efficient tool for targeted genome editing with a wide range of applications including gene disruption, modification, transcription, and translation in various systems including human cells (Jinek, M. et al., Science 337, 816-821, (2012); Liu, et al., J Control Release 266, 17-26, (2017); Suresh, et al., Methods Mol Biol 1507, 81-94, (2017); Liang, X. et al., Journal of Biotechnology 208, 44-53, (2015); Mout, et al., Bioconjug Chem 28, 880-884, (2017)). The CRISPR / Cas9 system consists of S. pyogenes Cas9 nuclease and single guide RNA (sgRNA): Cas9, a nuclease protein, cleaves specific double-stranded DNA, while sgRNA recognizes a specific target genomic region and transfers the sgRNA / Cas9 complex to the target DNA sequence inside the cell (Sander, et al. Nat Biotechnol 32, 347-355, (2014); Jinek, M. et al., Science 343, 1247997, (2014)). The targeting RNA is composed of a sequence of approximately 20 nt (protospacer) complementary to the target DNA (5’-NGG) with the sequence requirement of the protospacer adjacent motif (PAM) (Jinek, M. et al., Science 337, 816-821, (2012); van der Oost, et al. Nat Rev Microbiol 12, 479-492, (2014)). As this CRISPR / Cas9 system progresses towards clinical bridging studies, issues such as targeted delivery, cytotoxicity, serum stability, off-target mutations, safe nuclear entry, and immunogenicity must be addressed.

[0005] Efficient delivery of Cas9 ribonucleoprotein (RNP) is crucial for efficient genome editing (Zhang, et al., Theranostics 11, 614-648, (2021); Glass, et al., Trends in biotechnology 36, 173-185, (2018)). Direct delivery of Cas9 RNP can significantly minimize off-target mutations, achieve highly efficient gene editing, and reduce off-target effects, toxicity, and immune responses. RNP delivery provides genome editing efficacy even in embryonic stem cells, induced pluripotent stem cells, and tissue stem cells (D’Astolfo, D. S. et al., Cell 161, 674-690, (2015)). However, due to the size and charge characteristics and combined properties of the protein and nucleic acid of the RNP complex, specific strategies must be considered to design a delivery system for RNP. Multiple studies have reported the delivery of Cas9 RNP by harsh physical methods, including microinjection (Chang, N. et al., Cell Research 23, 465-472, (2013); Yan, Q. et al., Cell Regeneration 3, 3:12, (2014); Al-Dosari, M. S., Knapp, J. E. & Liu, D. in Advances in Genetics Vol. 54, 65-82 (Academic Press, 2005)), hydrodynamic injection (Yin, H. et al., Nat Biotechnol 32, 551-553, (2014)), electroporation (Wang, L. et al., Cell Res 30, 276-278, (2020)), sonoporation, and chemical transfection, or using modified DNA nanoparticles (Sun, W. et al., Angewandte Chemie International Edition 54, 12029-12033, (2015)).Lipofectamine and polymer-based delivery have been found to be the most successful in Cas9 RNP delivery and have been successfully used in oncological applications (Yu, X. et al., Biotechnol Lett 38, 919-929, (2016); Kang, Y. K. et al., Bioconjugate Chemistry 28, 957-967, (2017)). Viral vectors are very efficient in delivering CRISPR-Cas9 but suffer from immunogenicity, carcinogenesis, and limited DNA packing capacity. For example, gene delivery using adeno-associated virus (AAV) is currently one of the most advanced technologies for delivering Cas9 in vivo (Ylae-Herttuala, S. Molecular Therapy 20, 1831-1832, (2012)). However, concerns about existing immunity in a significant proportion of the human population against AAV limit the development of AAV-based Cas9 therapeutics. Furthermore, AAV-based Cas9 delivery is prone to off-target genomic damage and limited packaging capacity issues. Therefore, the development of a stable and non-immunogenic cell-targeted delivery method is important for advancing the clinical translation of the CRISPR / Cas9 system. A scalable approach to improve cell targeting and intracellular delivery of CRISPR / Cas constructs accelerates translation to the clinic.

[0006] Accordingly, an object of the present invention is to provide a composition for the safe and efficient cell targeting and intracellular delivery of CRISPR / Cas constructs, as well as methods for making and using the same. Another object of the present invention is to provide compositions and methods for genome editing and gene regulation in one or more diseases and disorders.

Prior Art Documents

Non-Patent Documents

[0007]

Non-Patent Document 1

[0008] Gist of the Invention A genome editing composition for genome modification of cells has been developed. The genome editing composition includes a dendrimer and a gene editing system. Typically, the dendrimer is covalently conjugated to the gene editing system via a linker if necessary. Exemplary gene editing systems include the CRISPR system, zinc finger nuclease (ZFN), and transcription activator-like effector nuclease (TALEN). In a preferred embodiment, the gene editing system is a CRISPR system including a Cas nuclease and a single guide RNA (sgRNA). In a more preferred embodiment, the Cas nuclease includes one or more nuclear localization signals. Exemplary Cas nucleases include Cas9, CasX, Cas7-11, CasFx, Cas12a, and Cas13. In a preferred embodiment, the dendrimer is covalently conjugated to the Cas9 nuclease and optionally to the sgRNA. In a more preferred embodiment, the Cas9 nuclease is Streptococcus pyogenes Cas9 nuclease. Typically, the Cas9 nuclease is conjugated to the dendrimer at a ratio of the protein to the dendrimer between 1:1 and 4:1.

[0009] The dendrimer can be covalently conjugated to the gene editing system via one or more of disulfide, ester, ether, or amide bonds and optionally via a hydrocarbon or oligoethylene glycol chain. In some embodiments, the dendrimer is covalently conjugated to the gene editing system via a releasable bond. For improved intracellular delivery of the composition, the linker preferably includes a glutathione-sensitive disulfide bond such as a gamma-aminobutyric acid linker.

[0010] Dendrimers of different generations are suitable for use in genome editing compositions. In some embodiments, the dendrimer is a first-generation, second-generation, third-generation, fourth-generation, fifth-generation, sixth-generation, seventh-generation, eighth-generation, or ninth-generation dendrimer. In some embodiments, the dendrimer is a poly(amidoamine) (PAMAM) dendrimer, such as a hydroxyl, amine, carboxylic acid, acetamide-terminated PAMAM dendrimer. In preferred embodiments, the dendrimer is a hydroxyl-terminated PAMAM dendrimer, such as a fourth-generation, fifth-generation, or sixth-generation hydroxyl-terminated PAMAM dendrimer. In some embodiments, the dendrimer is a glucose dendrimer comprising a central core of dipentaerythritol and one or more branching units of the monosaccharide glucose molecule, optionally conjugated with a linker thereto. In some embodiments, the glucose dendrimer has the following structure: [Chemical Formula] and is a first-generation dendrimer having the structure.

[0011] In another embodiment, the glucose dendrimer has the following structure: [Chemical Formula] and is a second-generation dendrimer having the structure.

[0012] In some embodiments, the dendrimer is further conjugated to one or more therapeutic, prophylactic, or diagnostic agents, such as small molecules, antibodies or antigen-binding fragments thereof, nucleic acids, and polypeptides. Exemplary therapeutic agents include anti-inflammatory agents, antioxidants, and immunomodulatory agents. Exemplary diagnostic agents include fluorescent dyes, near-infrared dyes, SPECT imaging agents, PET imaging agents, and radioisotopes.

[0013] Also provided is a pharmaceutical preparation comprising a genome editing composition and one or more pharmaceutically acceptable excipients. The pharmaceutical composition is formulated for systemic administration, such as parenteral or enteral administration, or topical administration. Exemplary parenteral administrations include intramuscular, intraperitoneal, intravenous, or subcutaneous injection. In some cases, the formulation is formulated for nasal administration.

[0014] Example of conjugation of G2-glucose dendrimer (GD2) Cas9 conjugation for targeted neuronal delivery of CRISPR-Cas9 ribonucleoprotein.

[0015] A method for altering, adding, and / or deleting a genomic segment in a target cell of a subject in need thereof, the method comprising administering to the subject an effective amount of a dendrimer-gene editing composition or a pharmaceutical preparation thereof. Preferably, the composition or its pharmaceutical preparation is administered by parenteral or enteral administration, such as intramuscular, intraperitoneal, intravenous, or subcutaneous injection. In some embodiments, the genome editing composition comprises a Cas9 nuclease and an sgRNA specific for a genomic segment in the cell. In some embodiments, the pharmaceutical preparation is administered in an effective amount for treating monogenic and polygenic diseases, such as cystic fibrosis, hemophilia, globinopathy, such as sickle cell anemia and beta-thalassemia, xeroderma pigmentosum, and lysosomal storage diseases. In preferred embodiments, the pharmaceutical preparation is administered in an effective amount for treating genetic disorders, such as eye diseases, neurological and / or neurodegenerative diseases, neurodevelopmental diseases, and cancer.

[0016] Exemplary eye diseases treated with the pharmaceutical formulation include age-related macular degeneration, choroidal neovascularization, retinitis pigmentosa, Stargardt disease, and Leber congenital amaurosis. In the case of AMD, an sgRNA specific for vascular endothelial growth factor (VEGF) can be used, and the formulation is administered in an effective amount to induce a decrease of about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% to up to 100% in the expression, translation, or activity of VEGF in retinal cells.

[0017] Suitable exemplary neurological and / or neurodegenerative diseases suitable for the pharmaceutical formulation include Huntington's disease, amyotrophic lateral sclerosis (ALS), Alzheimer's disease, Parkinson's disease, childhood cerebral adrenoleukodystrophy (ccALD), muscular dystrophy, Friedreich's ataxia, spinocerebellar ataxia, Duchenne muscular dystrophy, and spinal muscular atrophy. Exemplary neurodevelopmental diseases include cerebral palsy, fragile X syndrome, Down syndrome, Tay-Sachs disease, Sandhoff disease, Niemann-Pick disease, and sphingolipidosis.

[0018] Exemplary cancers include bone cancer, bladder cancer, brain cancer, breast cancer, cervical cancer, colorectal cancer, esophageal cancer, kidney cancer, liver cancer, lung cancer, nasopharyngeal cancer, pancreatic cancer, prostate cancer, skin cancer, stomach cancer, and uterine cancer. Typically, a pharmaceutical formulation is administered in an effective amount to induce a decrease of about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% to up to 100% in the expression, translation, or activity of one or more oncogenes in cancer. In other embodiments, a pharmaceutical formulation is administered in an effective amount to induce a decrease of about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% to up to 100% in the expression, translation, or activity of one or more immunomodulatory factors such as PD-1 or PD-L1. In a preferred embodiment, the method includes altering, adding, and / or deleting at least one nucleotide in a genomic segment in a target cell.

[0019] The method may also include the step of selecting a subject who may benefit from treatment with a composition of a dendrimer-gene editing agent. BRIEF DESCRIPTION OF THE DRAWINGS

[0020]

Figure 1-1

Figure 1-2

[0021]

Figure 2-1

Figure 2-2

Figure 2-3

Figure 2-4

Figure 2-5

[0022]

Figure 3-1

Figure 3-2

[0023]

Figure 4-1

Figure 4-2

[0024]

Figure 5

[0025]

Figure 6

[0026]

Figure 7

[0027]

Figure 8

[0028]

Figure 9

[0029]

Figure 10-1

Figure 10-2

[0030]

Figure 11

[0031]

Figure 12-1

Figure 12-2

[0032]

Figure 13

Mode for Carrying Out the Invention

[0033] Detailed Description of the Invention I. Definitions The terms "targeted gene", "targeted genome", or "targeted element" refer to a gene or genomic component within a recipient cell that has been selected for modification by a CRISPR-Cas system conjugated to a dendrimer.

[0034] The terms "gene editing", "genome modification", and "genetic manipulation" are used interchangeably and refer to selective and specific changes to one or more targeted genes within a recipient cell by programming of the CRISPR-Cas system within the cell. Editing or changing a targeted gene or genome can include one or more of deletions, knock-ins, point mutations, or any combination thereof in one or more genes of the recipient cell. Thus, the result of gene editing may be downregulation or upregulation of one or more genes or expressed gene products as compared to control cells without CRISPR-Cas-based gene editing. The degree of variation in the presence or activity of a gene or expressed gene product can be complete (i.e., 100%) or partial (i.e., 1-99.9%) relative to the level in control cells.

[0035] The terms "inhibit" or "reduce" in the context of inhibition mean a decrease or reduction in activity and amount. This may be a complete inhibition or reduction, or a partial inhibition or reduction in activity or amount. The inhibition or reduction may be compared to a control or standard level. The inhibition can be measured, for example, as a percentage value from 1% up to a maximum of 100%, such as 5%, 10, 25, 50, 75, 80, 85, 90, 95, 99, or 100%. For example, suppression or deletion of a gene can inhibit or reduce the activity and / or expression of one or more target genes, or the activity or amount of one or more expressed gene products, by about 10%, 20%, 30%, 40%, 50%, 75%, 85%, 90%, 95%, or 100% from the activity and / or amount of the same gene or gene product in control cells that have not undergone CRISPR-Cas-based gene editing. In some embodiments, the inhibition and reduction are compared according to the level of mRNA, or the protein corresponding to the targeted genetic element within the cell.

[0036] The terms "individual", "subject", and "patient" are used interchangeably and refer to mammals, including but not limited to, mice, monkeys, humans, mammalian farm animals, mammalian sport animals, and mammalian pets.

[0037] The terms "active agent" or "biologically active agent" are used interchangeably to refer to chemical or biological compounds that elicit a desired pharmacological and / or physiological effect, which may be prophylactic, therapeutic or diagnostic. These may be nucleic acids, nucleic acid analogs, small molecules having a molecular weight of less than 2 kD, more typically less than 1 kD, peptidomimetics, proteins or peptides, carbohydrates or sugars, lipids, or combinations thereof. These terms also encompass pharmaceutically acceptable and pharmacologically active derivatives of the agents, including but not limited to salts, esters, amides, prodrugs, active metabolites, and analogs. The term "therapeutic agent" refers to an agent that can be administered to treat one or more symptoms of a disease or disorder. The term "diagnostic agent" generally refers to an agent that can be administered to indicate, identify, and clarify the location of a pathological process. A diagnostic agent can label target cells and enable subsequent detection or imaging of these labeled target cells. In some embodiments, the diagnostic agent can selectively target neurons, particularly neurons within the site of a lesion in the eye, brain, or CNS, via a dendrimer. The term "prophylactic agent" generally refers to an agent that can be administered to prevent a disease or to prevent a particular condition.

[0038] The term "therapeutically effective amount" refers to the amount of a therapeutic agent that, when incorporated in and / or on a dendrimer, results in some desired effect at a reasonable benefit / risk ratio applicable to any medical treatment. The effective amount may vary depending on factors such as the disease or condition being treated, the particular targeted construct being administered, the size of the subject, or the severity of the disease or condition. One of ordinary skill in the art may empirically determine the effective amount of a particular compound without undue experimentation. In some embodiments, the term "effective amount" refers to the amount of a therapeutic or prophylactic agent to reduce or mitigate the symptoms of one or more eye diseases or neurological diseases.

[0039] The terms "treating" or "preventing" mean alleviating, reducing or otherwise arresting a disease, disorder and / or condition that may be susceptible to, but has not yet been diagnosed in, an animal having the same, inhibiting a disease, disorder or condition, e.g., slowing its progression, and reducing a disease, disorder or condition, e.g., effecting regression of the disease, disorder and / or condition. Treating a disease or condition includes restoring at least one symptom of a particular disease or condition, even if underlying pathophysiology is not affected, e.g., treating a subject's pain by administering an analgesic even if such agent does not treat the cause of the pain. Desirable effects of treatment may include decreasing the rate of progression of a disease, restoring or alleviating the condition of a disease, and effecting remission or improving prognosis. For example, without limitation, reduction in the rate of neuron loss, decrease in symptoms attributable to the disease, improvement in the quality of life of those affected by the disease, decrease in the dosage of other medications required to treat the disease, delay in the progression of the disease, and / or extension of the survival of an individual. When one or more symptoms associated with Alzheimer's disease are reduced or eliminated, including, but not limited to, those described above, the individual has been successfully "treated".

[0040] The phrases "pharmaceutically acceptable" or "biocompatible" refer to compositions, polymers, and other materials and / or dosage forms that are suitable for use in contact with human and animal tissues within the scope of sound medical judgment, and that exhibit no excessive toxicity, irritation, allergic response, or other problems or complications commensurate with a reasonable benefit / risk ratio. The phrase "pharmaceutically acceptable carrier" refers to a pharmaceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, solvent, or encapsulating material involved in carrying or transporting any subject composition from one organ or part of the body to another. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the subject composition and not injurious to the patient.

[0041] The term "biodegradable" generally refers to materials that, under physiological conditions, will be broken down or eroded into smaller units or chemical species that can be metabolized, removed, or excreted in vivo. The degradation time is a function of composition and form.

[0042] The term "dendrimer" includes, but is not limited to, a molecular structure with an internal core, an inner layer or "generation" of repeating units regularly attached to this starting core, and an outer surface of end groups attached to the outermost generation.

[0043] The term "functionalization" means modifying a compound or molecule in a manner that results in the attachment of a functional group or site. For example, a molecule may be functionalized by introducing a molecule that makes the molecule a strong nucleophile or a strong electrophile.

[0044] The term "targeting moiety" refers to a moiety that is localized at or away from a specific location. The moiety may be, for example, a protein, nucleic acid, nucleic acid analog, carbohydrate, or small molecule. The entity may be, for example, a therapeutic compound, such as a small molecule, or a diagnostic entity, such as a detectable label. The location may be a tissue, a specific cell type, or an intracellular compartment. In one embodiment, the targeting moiety localizes a drug. In a preferred embodiment, the dendrimer composition can selectively target target neurons, particularly injured / hyperactive neurons, in the absence of additional targeting moieties.

[0045] The term "extended residence time" refers to an increase in the time required for a drug to disappear from a patient's body, or an organ or tissue of that patient. In certain embodiments, "extended residence time" refers to a drug that disappears with a half-life that is 10%, 20%, 50%, or 75% longer than a comparative standard, e.g., a comparative drug not conjugated to a delivery vehicle such as a dendrimer. In certain embodiments, "extended residence time" refers to a drug that disappears with a half-life that is 2, 5, 10, 20, 50, 100, 200, 500, 1000, 2000, 5000, or 10000 times longer than a comparative standard, e.g., a comparative drug that does not include a dendrimer that specifically targets a particular cell type.

[0046] The terms "incorporated" and "encapsulated" refer to incorporating, formulating, or otherwise including such a drug in and / or on a composition that enables the drug to be released, e.g., sustained release, in a desired application. Such a drug may be incorporated into such a dendrimer by binding the drug or other material to one or more surface functional groups of the dendrimer (by covalent, ionic, or other binding interactions), by physical mixing, by enclosing the drug within the dendritic structure, and / or by encapsulating the drug within the dendritic structure.

[0047] II. Compositions A dendrimer-based genome editing system for delivering a gene editing agent, such as a Cas9 ribonucleoprotein (RNP), to the cytoplasm and then to the nucleus was developed. As demonstrated in the examples, the S.pyogenes Cas9-2NLS endonuclease was covalently conjugated via a highly specific inverse Diels-Alder click reaction (IEDDA) through a glutathione-sensitive disulfide linker to a hydroxyl PAMAM dendrimer (D-Cas9(2NLS)), and a guide RNA (sgRNA) was complexed with the Cas9-dendrimer nanoconstruct. The D-Cas9 RNP produces robust genomic deletions in vitro in the human embryonic 293 cell line (HEK293) (about 100%) and the human retinal pigment epithelial cell line (ARPE-19) (20%).

[0048] Described is a composition of a dendrimer complexed or covalently conjugated with one or more gene editing agents. Exemplary dendrimers include fourth-generation, fifth-generation, sixth-generation, seventh-generation, or eighth-generation PAMAN and glucose dendrimers.

[0049] In a preferred embodiment, the dendrimer is a glucose dendrimer. The glucose dendrimer includes (a) a central core, (b) one or more branching units, where the branching units include monosaccharide glucose-based branching units optionally conjugated with linkers thereto. In some embodiments, the glucose dendrimer is a first-generation, second-generation, third-generation, fourth-generation, fifth-generation, or sixth-generation dendrimer.

[0050] In some embodiments, the dendrimer is a poly(amidoamine) (PAMAM) dendrimer, such as a hydroxyl-terminated PAMAM dendrimer, preferably a fourth-generation, fifth-generation, or sixth-generation hydroxyl-terminated PAMAM dendrimer.

[0051] In some embodiments, the dendrimer is covalently conjugated to one or more Cas9 proteins, optionally via a linker or spacer moiety. In preferred embodiments, the dendrimer is covalently conjugated to one or more Cas9 proteins having one or more nuclear localization signals (NLSs), more preferably two NLSs.

[0052] Dendrimer conjugation improves the properties of the formulation, such as improved plasma stability, storage stability, and sustained release capacity, compared to gene editing compositions that are not associated or conjugated to the dendrimer.

[0053] A. Dendrimer A dendrimer is a three-dimensional hyperbranched monodisperse globular multivalent polymer that contains surface terminal groups (Tomalia, D. A., et al., Biochemical Society Transactions, 35, 61 (2007); and Sharma, A., et al., ACS Macro Letters, 3, 1079 (2014)). Due to its unique structural and physical characteristics, the dendrimer has shown unprecedented potential as a nanocarrier for various biomedical applications, including targeted drug / gene delivery, imaging, and diagnostics (Sharma, A., et al., RSC Advances, 4, 19242 (2014), Caminade, A.-M., et al., Journal of Materials Chemistry B, 2, 4055 (2014), Esfand, R., et al., Drug Discovery Today, 6, 427 (2001), and Kannan, R. M., et al., Journal of Internal Medicine, 276, 579 (2014)).

[0054] The term "dendrimer", without being limited thereto, refers to a molecular structure having an internal core ("G0") and layers or "generations" of repeating units attached to and extending from this internal core, wherein each layer has one or more branching points and the outer surface of the terminal groups is attached to the outermost generation. In some embodiments, the dendrimer has a standard dendrimer or "starburst" molecular structure.

[0055] Dendrimers are useful for a variety of biomedical applications including drug / gene delivery, targeting, imaging and diagnostics (Soliman, GM et al., Chem. Commun. 2011, 47, 9572; and Tomalia, DA et al., Biochem. Soc. Trans. 2007, 35, 61). Among several different types of dendrimers, polyamidoamine (PAMAM) dendrimers have been extensively studied for drug delivery applications due to their commercial availability, water solubility and biocompatibility (Tomalia, DA et al., Polym J 1985, 17, 117). The small size and the presence of multiple, easily tunable surface groups make these nanoparticles excellent carriers for transporting drugs to the CNS. Previous studies have shown that non-cytotoxic hydroxyl-terminated 4th generation PAMAM dendrimers (approximately 4 nm in size, without any targeting ligands) can cross the impaired BBB and target activated microglia at sites of brain injury several-fold more than healthy controls (Lesniak, WG et al., Mol Pharm 2013, 10). These dendrimers are non-toxic even at intravenous doses of over 500 mg / kg and are cleared intact through the kidney. These findings were validated in various small and large animal models (Kannan, S et al., Sci. Transl. Med. 2012, 4, 130ra46; Kambhampati, SP et al., Invest Ophthalmol Vis Sci 2015, 56; Nance, E et al., J. Control. Release 2015, 214, 112; Mishra, MK et al., ACS Nano 2014, 8, 2134; and Nanomedicine 2010, 5, 1317). The selective uptake and localization of these neutral dendrimers in activated microglia is likely due to their ability to cross the impaired BBB and rapidly diffuse in the brain parenchyma followed by constant uptake by phagocytic activated glial cells.

[0056] It has been shown that the dendrimer surface groups significantly affect their biodistribution (Nance, E., et al., Biomaterials, 101, 96 (2016)). When the hydroxyl-terminated fourth-generation PAMAM dendrimer (approximately 4 nm in size) without any targeting ligand is administered systemically in a rabbit model of cerebral palsy (CP), it passes significantly more (more than 20-fold) through the damaged BBB compared to healthy controls and selectively targets activated microglia and astrocytes (Lesniak, W. G., et al., Mol Pharm, 10 (2013)).

[0057] Generally, dendrimers have a diameter between about 1 nm and about 50 nm, more preferably between about 1 nm and about 20 nm, between about 1 nm and about 10 nm, or between about 1 nm and about 5 nm. Conjugates generally fall within the same size range, but large proteins, such as the Cas9 protein, may increase in size to about 10 - 20 nm or 10 - 15 nm. Generally, large proteins, such as the Cas9 protein, conjugate with dendrimers of a larger generation, i.e., the fourth generation or higher, with the ratio of protein to dendrimer being between 1:1 and 4:1. In preferred embodiments, the dendrimers have a diameter effective to pass through brain tissue and be retained in target cells for an extended period of time for intracellular delivery of the agents conjugated thereto.

[0058] In some embodiments, the dendrimers have a molecular weight between about 500 daltons and about 100,000 daltons (including both ends), preferably between about 500 daltons and about 50,000 daltons (including both ends), and most preferably between about 1,000 daltons and about 20,000 daltons (including both ends).

[0059] Suitable dendrimer scaffolds that may be used include poly(amidoamine), also known as PAMAM, or STARBURST™ dendrimers, polypropylamine (POPAM), polyethyleneimine, polylysine, polyester, ipcicene, aliphatic poly(ethers), and / or aromatic polyether dendrimers. The dendrimer may have carboxyl, amine, and / or hydroxyl termini. In a preferred embodiment, the dendrimer has hydroxyl termini. Each dendrimer of the dendrimer complex may be the same or have chemical properties similar to or different from other dendrimers (e.g., the first dendrimer may comprise a PAMAM dendrimer while the second dendrimer may be a POPAM dendrimer).

[0060] The term "PAMAM dendrimer" may contain different cores, have amidoamine building blocks, and includes, but is not limited to, any generation of poly(amidoamine) dendrimer having carboxyl, amine, and hydroxyl termini, such as the first generation PAMAM dendrimer, the second generation PAMAM dendrimer, the third generation PAMAM dendrimer, the fourth generation PAMAM dendrimer, the fifth generation PAMAM dendrimer, the sixth generation PAMAM dendrimer, the seventh generation PAMAM dendrimer, the eighth generation PAMAM dendrimer, the ninth generation PAMAM dendrimer, or the tenth generation PAMAM dendrimer. In a preferred embodiment, the dendrimer is soluble in the formulation and is a fourth, fifth, or sixth generation ("G") dendrimer. The dendrimer may have a hydroxyl group attached to its functional surface group.

[0061] 1. Hydroxyl-Terminated Dendrimer In some embodiments, the dendrimer contains a plurality of hydroxyl groups. Some exemplary high-density hydroxyl group-containing dendrimers include commercially available polyester dendritic polymers such as hyperbranched 2,2-bis(hydroxyl-methyl)propionic acid polyester polymers (e.g., hyperbranched bis-MPA polyester-64-hydroxyl, fourth generation), dendritic polyglycerol.

[0062] In some embodiments, the high-density hydroxyl group-containing dendrimer is an oligoethylene glycol (OEG)-like dendrimer. For example, the second-generation OEG dendrimer (“D2-OH-60”) is very efficient, robust, and can be synthesized using atom-economical chemical reactions such as Cu(I)-catalyzed alkyne-azide click and photocatalyzed thiol-ene click chemistry. By using an orthogonal hypermonomer and a hypercore strategy, very low-generation high-density polyol dendrimers can be achieved with a minimal number of reaction steps, as described in, for example, WO2019 / 094952. In some embodiments, the dendrimer backbone has non-cleavable polyether linkages throughout the structure, avoiding in vivo disintegration of the dendrimer and allowing such dendrimers to disappear from the body as a single entity (non-biodegradable).

[0063] In a preferred embodiment, the dendrimer has a plurality of hydroxyl (-OH) groups on the periphery of the dendrimer. The preferred hydroxyl (-OH) group surface density is at least 1 OH group / nm 2 (number of hydroxyl surface groups / surface area nm 2 ). For example, in some embodiments, the hydroxyl group surface density exceeds 2, 3, 4, 5, 6, 7, 8, 9, 10; preferably it is at least 10, 15, 20, 25, 30, 35, 40, 45, 50 or exceeds 50. In further embodiments, the hydroxyl (-OH) group surface density is between about 1 and about 50, preferably 5 - 20 OH groups / nm 2 (number of hydroxyl surface groups / surface area nm 2and simultaneously has a molecular weight between about 500 Da and about 10 kDa.

[0064] In some embodiments, the dendrimer may have a fraction of hydroxyl groups exposed on the outer surface, along with another fraction in the inner core of the dendrimer. In preferred embodiments, the dendrimer has at least 1 OH group / nm 3 (number of hydroxyl groups / volume nm 3 ) of hydroxyl (-OH) group volume density. For example, in some embodiments, the hydroxyl group volume density is 2, 3, 4, 5, 6, 7, 8, 9, 10 or exceeds 10, 15, 20, 25, 30, 35, 40, 45, and 50. In some embodiments, the hydroxyl group volume density is about 4 to about 50 groups / nm 3 , preferably about 5 to about 30 groups / nm 3 , more preferably about 10 to about 20 groups / nm 3 .

[0065] In some embodiments, the dendrimer specifically targets a particular tissue region and / or cell type after administration to the body. In preferred embodiments, the dendrimer specifically targets a particular tissue region and / or cell type without a targeting moiety.

[0066] 2. Glucose-based dendrimers In some embodiments, the dendrimer has a hypercore (e.g., dipentaerythritol) and one or more monosaccharide branching units. In some embodiments, the monosaccharide branching units are conjugated to the core or a prior layer of monomers via a linker, such as a polyethylene glycol chain. In preferred embodiments, the hypercore is dipentaerythritol and the monosaccharide branching units are glucose-based branching units.

[0067] In further embodiments, the spacer molecule is also alkyl (CH2) n- It may be a hydrocarbon-like unit. The branching unit is a PEG or alkyl chain linker between dendrimers of different generations. For example, the glucose layer is bonded via a PEG linker and a triazole ring.

[0068] Dendrimers synthesized using glucose building blocks are mostly accompanied by a surface made of glucose moieties, enabling specific targeted gene editing in cells including damaged neurons, ganglion cells, and other neuronal cells in the brain and eye.

[0069] In one embodiment, the glucose-based dendrimer selectively targets or is enriched within neurons, particularly neuronal nuclei. In a preferred embodiment, the glucose-based dendrimer selectively targets or is enriched within damaged neurons, diseased neurons, and / or hyperactive neurons.

[0070] In a preferred embodiment, the dendrimer contains an effective number of terminal glucose and / or hydroxyl groups for targeting one or more neurons of the CNS or the eye. The hydroxyl groups on the dendrimer surface are part of the glucose molecules. There are no extra hydroxyls other than the glucose molecules on the surface. The number of sugar molecules on the surface is determined by the number of generations. All generations are expected to target neurons.

[0071] In some embodiments, the dendrimer is made from glucose and oligoethylene glycol building blocks. Exemplary glucose dendrimers are shown in the examples. Some exemplary glucose dendrimers include a first-generation glucose dendrimer having 24 hydroxyl (-OH) end groups, a second-generation glucose dendrimer having 96 hydroxyl (-OH) end groups, a third-generation glucose dendrimer having 396 hydroxyl (-OH) end groups, and a fourth-generation glucose dendrimer having 1584 hydroxyl (-OH) end groups. In a preferred embodiment, the glucose dendrimer is a second-generation glucose-based dendrimer having 24 glucose molecules on the periphery and 6 glucose molecules embedded in a backbone held by PEG segments.

[0072] B. Gene Editing System The dendrimer is complexed with or covalently conjugated to one or more gene editing systems, or at least one or more of its components. Exemplary gene editing systems include, but are not limited to, triple helix formation, pseudocomplementary oligonucleotides, CRISPR / Cas, zinc finger nucleases, and TALENs. In a preferred embodiment, the gene editing system is a CRISPR / Cas system. In some embodiments, the gene editing technology is a donor oligonucleotide, which can be used alone to modify genes. Strategies include, but are not limited to, small fragment homologous replacement (e.g., polynucleotide small DNA fragment (SDF)), single-stranded oligo-deoxynucleotide-mediated gene modification (e.g., ssODN / SSO), and others described in Sargent, Oligonucleotides, 21(2): 55-75 (2011). Other suitable gene editing technologies include, but are not limited to, intron-encoded meganucleases engineered to change their target specificity. See, for example, Arnould, et al., Protein Eng. Des. Sel., 24(1-2):27-31 (2011).

[0073] In a preferred embodiment, the gene editing system is a protein-guided gene editing system, such as a CRISPR system, zinc finger nuclease (ZFN), and transcription activator-like effector nuclease (TALEN).

[0074] 1. CRISPR / Cas In some embodiments, the gene editing system that induces single-stranded or double-stranded breaks in the genome of the target cell is CRISPR / Cas, or a nucleic acid construct encoding a Cas nuclease.

[0075] CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) is an acronym for DNA loci containing multiple short direct repeats of a nucleotide sequence. Prokaryotic CRISPR / Cas systems have been adapted for use in eukaryotes for gene editing (silencing, enhancing, or altering a particular gene) (see, e.g., Cong, Science, 15:339(6121):819-823 (2013) and Jinek, et al., Science, 337(6096):816-21 (2012)). By transfecting cells with the required elements including the cas genes and a specifically designed CRISPR, the genome of an organism can be cleaved and modified at any desired location. Methods for preparing compositions for use in genome editing using the CRISPR / Cas system are described in detail in WO2013 / 176772 and WO2014 / 018423.

[0076] Generally, the “CRISPR system” collectively refers to transcripts and other elements that are involved in the expression of or direct the activity of CRISPR associated (“Cas”) genes, which include the sequences encoding the Cas genes, the tracr (trans-activating CRISPR) sequence (e.g., tracrRNA or an active partial tracrRNA), the tracr mate sequence (which in the context of an endogenous CRISPR system includes “direct repeats” and the processed partial direct repeats of the tracrRNA), the guide sequence (which is also referred to as a “spacer” in the context of an endogenous CRISPR system), or other sequences and transcripts from a CRISPR locus. One or more tracr mate sequences (e.g., direct repeat-spacer-direct repeat) operably linked to a guide sequence can also be referred to as pre-crRNA (pre-CRISPR RNA) prior to processing by a nuclease or as crRNA after processing.

[0077] In some embodiments, the tracrRNA and crRNA are linked to form a chimeric crRNA-tracrRNA hybrid, where the mature crRNA is fused to a partial tracrRNA via a synthetic stem loop, mimicking the native crRNA:tracrRNA duplex, as described in Cong, Science, 15:339(6121):819-823 (2013) and Jinek, et al., Science, 337(6096):816-21 (2012). The single fusion crRNA-tracrRNA construct may also be referred to as a guide RNA or gRNA (or single guide RNA (sgRNA)). Within the sgRNA, the crRNA portion may be identified as the "target sequence" and the tracrRNA is often referred to as the "scaffold".

[0078] Once a desired DNA target sequence has been identified, there are many resources available to assist the practitioner in determining a suitable target site. For example, many public resources, including a list of approximately 190,000 potential sgRNAs created by bioinformatics that target over 40% of human exons, are available to assist the practitioner in the selection of target sites and the design of associated sgRNAs that affect nicking or double-strand breaks at those sites. See also crispr.u-psud.fr / , a tool designed to help scientists find CRISPR targeting sites in a wide range of species and generate appropriate crRNA sequences.

[0079] In some embodiments, the dendrimer is covalently conjugated to one or more CRISPR-associated (Cas) nucleases. Exemplary Cas nucleases suitable for conjugation to a dendrimer as a gene editing composition include Cas9, CasX (also referred to as Cas12e), Cas7-11, CasFx, Cas12a, and Cas13.

[0080] In some embodiments, the dendrimer is covalently conjugated to one or more Cas nucleases, which further complexes with one or more single guide RNAs (sgRNAs) to form a CRISPR / Cas ribonucleoprotein (RNP). In some embodiments, the dendrimer is covalently conjugated to one or more Cas nucleases via one or more linking moieties. In some embodiments, the linking moiety is conjugated to one or more spacer moieties. The linking moiety and / or spacer moiety may be cleavable in vivo, for example, by exposure to the intracellular compartment of the target cell. In preferred embodiments, one or more spacers / linkers between the dendrimer and the gene editing system are added to achieve the desired and effective release kinetics in vivo. These may be cleavable linkages such as disulfides and esters.

[0081] In some embodiments, the dendrimer is covalently conjugated to one or more Cas9 nucleases, preferably complexed with one or more single guide RNAs (sgRNAs) to form a CRISPR / Cas ribonucleoprotein (RNP). In other embodiments, the dendrimer is covalently conjugated to one or more Cas9 nucleases and / or one or more single guide RNAs (sgRNAs) via a releasable linkage for intracellular release from the associated dendrimer. In preferred embodiments, the dendrimer is covalently conjugated to one or more Cas9 nucleases before or after complexation of Cas9 with the sgRNA. In preferred embodiments, the Cas9 nuclease is modified with one or more nuclear localization signals (NLSs), preferably two NLSs. In further embodiments, the Cas9 nuclease is Streptococcus pyogenes Cas9 nuclease, or a variant thereof.

[0082] 2. Zinc finger nuclease In some embodiments, the gene editing system that induces a single-stranded or double-strand break in the genome of a target cell is a zinc finger nuclease (ZFN), or a nucleic acid construct encoding a ZFN. A ZFN is typically a fusion protein that includes a DNA binding domain derived from a zinc finger protein linked to a cleavage domain.

[0083] The most common cleavage domain is FokI, an IIS type enzyme. FokI catalyzes double-stranded cleavage of DNA nine nucleotides from its recognition site on one strand and thirteen nucleotides from its recognition site on the other strand. See, for example, U.S. Pat. Nos. 5,356,802; 5,436,150 and 5,487,994; and Li, et al., Proc., Natl. Acad. Sci. USA 89 (1992):4275-4279; Li, et al., Proc. Natl. Acad. Sci. USA, 90:2764-2768 (1993); Kim, et al., Proc. Natl. Acad. Sci. USA. 91:883-887 (1994a); Kim, et al., J. Biol. Chem. 269:31,978-31,982 (1994b). One or more of these enzymes (or enzymatically functional fragments thereof) can be used as a source of the cleavage domain.

[0084] DNA binding domains that can in principle be designed to target any genomic location of interest can be tandem arrays of Cys2His2 zinc fingers, each of which generally recognizes 3 to 4 nucleotides in the target DNA sequence. The Cys2His2 domain has the general structure: Phe (sometimes Tyr)-Cys-(2 to 4 amino acids)-Cys-(3 amino acids)-Phe (sometimes Tyr)-(5 amino acids)-Leu-(2 amino acids)-His-(3 amino acids)-His. By linking multiple fingers together (the number varies: in published studies, 3 to 6 fingers per monomer have been used), a pair of ZFNs can be designed to bind to a genomic sequence 18 - 36 nucleotides in length.

[0085] Methods of operation include, but are not limited to, rational design and various types of empirical selection methods. Rational design includes, for example, the use of databases containing triplet (or quadruplet) nucleotide sequences and individual zinc finger amino acid sequences, where each triplet or quadruplet nucleotide sequence is associated with the amino acid sequence of one or more zinc fingers that bind to a specific triplet or quadruplet sequence. See, for example, U.S. Pat. Nos. 6,140,081; 6,453,242; 6,534,261; 6,610,512; 6,746,838; 6,866,997; 7,067,617; U.S. Patent Application Publication 2002 / 0165356; 2004 / 0197892; 2007 / 0154989; 2007 / 0213269; and International Patent Application Publications WO98 / 53059 and WO2003 / 016496.

[0086] 3. Transcription activator-like effector nucleases In some embodiments, the gene editing system that induces single-stranded or double-stranded breaks in the genome of target cells is a transcription activator-like effector nuclease (TALEN), or one or more nucleic acid constructs encoding TALEN. TALEN has an overall structure similar to that of ZFN, with the main difference being that the DNA-binding domain is derived from the TAL effector protein, a transcription factor from a plant pathogen. The DNA-binding domain of TALEN is a tandem array of amino acid repeats, each approximately 34 residues in length. The repeats are very similar to each other and typically differ mainly at two positions (amino acids 12 and 13, called repeat variable diresidues, or RVDs). Each RVD defines a preferential binding to one of the four possible nucleotides, which means that each TALEN repeat binds to a single base pair, although it is known that the NN RVD binds to both guanine and adenine. TAL effector DNA binding is less well understood mechanistically than that of zinc finger proteins, but their simpler code on the surface can prove very useful for engineered nuclease design. TALEN also cleaves as a dimer and has a relatively long target sequence (the shortest reported so far binds 13 nucleotides per monomer) and seems to have less stringent requirements than ZFN with respect to the length of the spacer between binding sites. Monomeric and dimeric TALEN can contain more than 10, more than 14, more than 20, or more than 24 repeats.

[0087] Methods for engineering TALs to bind to specific nucleic acids are described in Cermak, et al, Nucl. Acids Res. 1-11 (2011). US Patent Application Publication 2011 / 0145940 discloses TAL effectors and methods for using them to modify DNA. Miller et al. Nature Biotechnol 29: 143 (2011) reported the generation of TALENs for site-specific nuclease constructs by linking TAL truncation variants to the catalytic domain of Fokl nuclease. The resulting TALENs were shown to induce gene modification in immortalized human cells. General design principles for TALE binding domains can be found, for example, in WO2011 / 072246.

[0088] C. Coupling Agents and Spacers The dendrimer conjugate can be formed from one or more gene editing systems, or one or more components thereof, conjugated or attached to the dendrimer. Optionally, one or more gene editing systems are conjugated to the dendrimer via one or more spacers / linkers via different linkages, such as disulfide, ester, carbonate, carbamate, thioester, hydrazine, hydrazide, ether, and amide linkages. One or more spacers / linkers between the dendrimer and the gene editing system may be designed to provide a form of the dendrimer conjugate that is releasable or non-releasable in vivo. In some embodiments, the attachment occurs via a suitable spacer that provides an ester bond between the gene editing system and the dendrimer. In some embodiments, one or more spacers / linkers between the dendrimer and the gene editing system are added to achieve the desired and effective release kinetics in vivo. These may be cleavable (ester, S-S) or non-cleavable (amide, ether). The linking chemistry may be click chemistry, acid-amine coupling, Staudinger ligation, etc.

[0089] In some embodiments, the linkage occurs via one or more of a disulfide, ester, ether, thioester, carbamate, carbonate, hydrazine, ether or amide linkage. In a preferred embodiment, the linkage occurs via a suitable spacer that provides an ester or amide bond between the agent and the dendrimer, depending on the desired release kinetics of the agent.

[0090] The term "spacer" includes compositions used to link an active agent (e.g., one or more components of a gene editing system, such as a Cas9 nuclease) to a dendrimer. The spacer can be either a single chemical entity or two or more chemical entities linked together. Examples of spacers include any small chemical entity, peptide or polymer having sulfhydryl, thiopyridine, succinimidyl, maleimide, vinylsulfone, and carbonate termini.

[0091] The spacer can be selected from the class of compounds having sulfhydryl, thiopyridine, succinimidyl, maleimide, vinyl sulfone, and carbonate groups at the ends. Examples of spacers include thiopyridine-terminated compounds such as dithiodipyridine, N-succinimidyl 3-(2-pyridyldithio)-propionate (SPDP), succinimidyl 6-(3-[2-pyridyldithio]-propionamido)hexanoate LC-SPDP or sulfo-LC-SPDP. Spacers can also include linear or cyclic peptides substantially having sulfhydryl groups such as glutathione, homocysteine, cysteine and their derivatives, arg-gly-asp-cys (RGDC), cyclo(Arg-Gly-Asp-d-Phe-Cys) (c(RGDfC)), cyclo(Arg-Gly-Asp-D-Tyr-Cys), cyclo(Arg-Ala-Asp-d-Tyr-Cys). Spacers can also include mercapto acid derivatives such as 3-mercaptopropionic acid, mercaptoacetic acid, 4-mercaptobutyric acid, thioran-2-one, 6-mercaptohexanoic acid, 5-mercaptovaleric acid and other mercapto derivatives such as 2-mercaptoethanol and 2-mercaptoethylamine. Spacers can be thiosalicylic acid and its derivatives, (4-succinimidyl-oxycarbonyl-methyl-alpha-2-pyridylthio)toluene, (3-[2-pyridithio]propionyl hydrazide. The spacer may have a maleimide end, and examples of spacers include polymers or small chemical entities such as bis-maleimidodiethylene glycol and bis-maleimidotriethylene glycol, bis-maleimidoethane, bis-maleimidohexane. Examples of spacers include vinyl sulfone such as 1,6-hexane-bis-vinyl sulfone. Examples of spacers include thioglycosides such as thioglucose. The spacer can be a reduced protein such as bovine serum albumin and human serum albumin, or any thiol-terminated compound capable of forming a disulfide bond.Examples of spacers include maleimide, succinimidyl, and polyethylene glycol having a thiol terminus.

[0092] D. Dendrimer-Gene Editing Agent Conjugate The dendrimer may include one or more gene editing agents complexed with or conjugated to the dendrimer by covalent bonds.

[0093] In some embodiments, one or more gene editing agents are attached by covalent bonds to one or more terminal groups of the dendrimer, such as hydroxyl groups. In some embodiments, the dendrimer conjugate includes one or more gene editing agents conjugated to or complexed with the dendrimer via one or more linking moieties. One or more spacers / linkers between the dendrimer and the gene editing system may be designed to provide a form that is releasable or non-releasable in vivo for the dendrimer conjugate. In some embodiments, the linking moiety is conjugated to one or more spacer moieties. The linking moiety and / or spacer moiety may be cleavable in vivo, for example, by exposure to the intracellular compartment of the target cell. In preferred embodiments, one or more spacers / linkers between the dendrimer and the gene editing system are added to achieve the desired and effective release kinetics in vivo. These may be cleavable (ester, S-S) or non-cleavable (amide, ether).

[0094] The dendrimer is preferably of the second, third, fourth, fifth, sixth, and up to the tenth generation. In preferred embodiments, the dendrimer is linked to one or more gene editing agents via a spacer ending with a disulfide, ester, ether, or amide bond.

[0095] Optimal loading necessarily depends on many factors, including the choice of drug, the structure and size of the dendrimer, and the tissue being treated. In some embodiments, the Cas9 nuclease protein is conjugated to the protein dendrimer at a ratio of 1:1 to 4:1 for larger generations of dendrimers, i.e., the fourth generation or higher.

[0096] In preferred embodiments, the dendrimer complex retains an effective amount of surface functional groups for targeting target cells and is conjugated to an effective amount of agent for treating, preventing, and / or imaging a disease or disorder.

[0097] Typically, the dendrimer conjugate has a hydrodynamic volume within the nanometer range. For example, in some embodiments, the dendrimer-Cas9 RNP complex has a diameter between about 5 nm and about 500 nm (including both ends), or between about 10 nm and about 200 nm (including both ends), between about 15 nm and about 100 nm (including both ends), depending on the generation of the dendrimer and the number of nuclease molecules carried. Preferably, the dendrimer conjugate has a diameter effective for entering and retaining in target cells for a long time.

[0098] E. Additional Agents to be Delivered A wide range of agents may be included in the particles to be delivered. The agent can be a protein or peptide, sugar or carbohydrate, nucleic acid or oligonucleotide, lipid, small molecule, or a combination thereof. The nucleic acid can be an oligonucleotide encoding a protein, such as a DNA expression cassette or mRNA. Representative oligonucleotides include siRNA, microRNA, DNA, RNA, and aptamers. In one embodiment, these are antisense oligonucleotides. In some embodiments, the therapeutic, prophylactic, or diagnostic agent is a therapeutic antibody. One or more types of therapeutic, prophylactic, or diagnostic agents may be encapsulated, complexed, or conjugated to the dendrimer.

[0099] Exemplary therapeutic agents include anti-inflammatory agents, anti-proliferative agents, chemotherapeutic agents, vasodilators, neuroactivating agents, and anti-infective agents. In some embodiments, the dendrimer is linked to a targeting moiety, an imaging agent, and / or a therapeutic agent. In some embodiments, the dendrimer is linked to a targeting moiety or an antibody for targeting a specific cell type.

[0100] 1. Therapeutic Agent One or more therapeutic agents may be complexed with the dendrimer, covalently attached to the dendrimer, or molecularly dispersed or encapsulated within the dendrimer. In some embodiments, two or more different therapeutic agents can associate with the dendrimer via covalent and / or non-covalent interactions.

[0101] When administered by intravenous injection, the dendrimer conjugate can preferentially cross the blood-brain barrier (BBB). Preferably, the agent(s) is / are bound or conjugated to a dendrimer that can preferentially release the drug at the target site, i.e., the diseased site, the damaged site, and / or the subcellular location. For example, some drugs can be released intracellularly under reducing conditions found in vivo. The dendrimer conjugate linked to the agent can be used to perform several functions including targeting, localization at the disease site, drug release, and imaging purposes. The dendrimer complex can be tagged with or without a targeting moiety.

[0102] In some embodiments, one or more therapeutic agents target the root cause of the disease or condition, and one or more therapeutic agents alleviate one or more symptoms of the disease or condition.

[0103] Preferred therapeutic or prophylactic agents include agents that reduce neuroinflammation (e.g., N-acetylcysteine, pioglitazone, vitamin E), and RNA oligonucleotides that interfere with gene transcription or translation. In particularly preferred embodiments, the agent is N-acetylcysteine, 4-phenylbutyrate, bezafibrate, thyroid hormone (T3), sobetirome, pioglitazone, resveratrol, VBP15, vitamin E, erucic acid, coenzyme Q10, clemastine, galactosylceramidase (GALC), aspartoacylase (ASPA), or arylsulfatase A (ARSA). Other suitable agents include anti-inflammatory agents, neuroactive agents, and imaging agents. Dendrimers can conjugate to more than one agent and more than one type of agent.

[0104] a. Anti-inflammatory agent In some embodiments, the composition comprises one or more anti-inflammatory agents. Anti-inflammatory agents reduce inflammation, and anti-inflammatory agents include steroid drugs and non-steroid drugs.

[0105] Preferred anti-inflammatory drugs are antioxidants including N-acetylcysteine. Preferred NSAIDs include mefenamic acid, aspirin, diflunisal, salsalate, ibuprofen, naproxen, fenoprofen, ketoprofen, deacketoprofen, flurbiprofen, oxaprozin, loxoprofen, indomethacin, sulindac, etodolac, ketorolac, diclofenac, nabumetone, piroxicam, meloxicam, tenoxicam, droxicam, lornoxicam, isoxicam, meclofenamic acid, flufenamic acid, tolfenamic acid, celecoxib, rofecoxib, valdecoxib, parecoxib, lumiracoxib, etoricoxib, firocoxib, sulfonanilide, nimesulide, niflumic acid, and licofelone.

[0106] Representative small molecules include steroids such as methylprednisolone and dexamethasone, non-steroidal anti-inflammatory agents including COX-2 inhibitors, corticosteroid anti-inflammatory agents, gold compound anti-inflammatory agents, immunosuppressants, anti-inflammatory and anti-angiogenic agents, valproic acid, excitotoxicity inhibitors such as D-aminophosphonovalerate and D-aminophosphonoheptanoate, glutamate formation / release inhibitors such as baclofen, NMDA receptor antagonists, salicylate anti-inflammatory agents, anti-VEGF agents including ranibizumab and aflibercept, and rapamycin. Other anti-inflammatory drugs include non-steroidal drugs such as indomethacin, aspirin, acetaminophen, diclofenac sodium, and ibuprofen. The corticosteroid may be fluocinonide acetonide and methylprednisolone.

[0107] Exemplary immunomodulatory drugs include cyclosporine, tacrolimus, and rapamycin. In some embodiments, the anti-inflammatory agent is a biological drug that blocks the action of one or more immune cell types such as T cells, or blocks proteins in the immune system such as tumor necrosis factor-alpha (TNF-alpha), interleukin 17-A, interleukin 12, and 23.

[0108] In some embodiments, the anti-inflammatory drug is a synthetic or natural anti-inflammatory protein. Antibodies specific to the selected immune components can be added to immunosuppressive therapy. In some embodiments, the anti-inflammatory drug is an anti-T cell antibody (e.g., antithymocyte globulin or antilymphocyte globulin), an anti-IL-2Rα receptor antibody (e.g., basiliximab or daclizumab), or an anti-CD20 antibody (e.g., rituximab).

[0109] In a preferred embodiment, one or more anti-inflammatory drugs are released in an amount effective to inhibit inflammation from the dendrimer conjugate for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, preferably for at least 1 week, 2 weeks, or 3 weeks, more preferably for at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months after administration to a mammalian subject.

[0110] b. Neuroactive agents Some drugs have been developed to interfere with, affect, or temporarily halt the glutamate excitotoxicity cascade leading to neuronal damage. One strategy is "upstream" of the reduction in glutamate release. Drugs in this category include riluzole, lamotrigine, and lifarizine, which are sodium channel blockers. The commonly used nimodipine is a voltage-dependent channel (L-type) blocker. Some agents affect the site of the metabotropic glutamate receptor. Examples of these drugs include felbamate, ifenprodil, magnesium, memantine, and nitroglycerin. These "downstream" drugs attempt to affect intracellular events such as free radical formation, nitric oxide formation, proteolysis, endonuclease activity, and ICE-like protease formation (an important component in the process that causes programmed cell death or apoptosis).

[0111] Agents for treating neurodegenerative diseases are well known in the art and vary based on the symptoms and diseases being treated. For example, conventional treatments for Parkinson's disease include levodopa (usually in combination with a dopa decarboxylase inhibitor or a COMT inhibitor), dopamine agonists, or MAO-B inhibitors.

[0112] Examples of treatments for Huntington's disease include dopamine blockers to help with abnormal behavior and decreased movement, or drugs to control movement, such as amantadine and tetrabenazine. Other drugs that help with chorea reduction include antianxiety drugs and benzodiazepines. Compounds such as amantadine or remacemide have shown positive results. Hypokinesia and rigidity may be treated with antiparkinsonian drugs, especially in the juvenile case, and myoclonic hyperkinesis may be treated with valproic acid. Psychiatric symptoms may be treated with medications similar to those used in the general population. Selective serotonin reuptake inhibitors and mirtazapine are recommended for depression, while atypical antipsychotic drugs are recommended for psychosis and behavioral disorders.

[0113] Riluzole (RILUTEK®) (2-amino-6-(trifluoromethoxy)benzothiazole), an anti-excitotoxic agent, has improved survival in subjects presenting with ALS. Other pharmaceuticals can reduce symptoms resulting from ALS by intervening. Some treatments are thought to improve quality of life and some to extend lifespan. General ALS-related therapies are reviewed in Gordon, Aging and Disease, 4(5):295-310 (2013); see, for example, Table 1 therein. A number of other agents have been tested in one or more clinical trials, with efficacy ranging from ineffective to promising. Exemplary agents are reviewed in Carlesi, et al., Archives Italiennes de Biologie, 149:151-167 (2011). For example, treatments include agents that reduce excitotoxicity, such as talampanel (8-methyl-7H-1,3-dioxolo(2,3)benzodiazepine), cephalosporins such as ceftriaxone, or memantine; agents that reduce oxidative stress, such as coenzyme Q10, manganoporphyrin, KNS-760704 [(6R)-4,5,6,7-tetrahydro-N6-propyl-2,6-benzothiazole-diamine dihydrochloride, RPPX], or edaravone (3-methyl-1-phenyl-2-pyrazolin-5-one, MCI-186); agents that reduce apoptosis, such as histone deacetylase (HDAC) inhibitors including valproic acid, TCH346 (dibenzo(b,f)oxepin-10-ylmethyl-methylprop-2-ynylamine), minocycline, or tauroursodeoxycholic acid (TUDCA); agents that reduce neuroinflammation, such as thalidomide and celeustol; neurotrophic agents, such as insulin-like growth factor 1 (IGF-1) or vascular endothelial growth factor (VEGF); heat shock protein inducers, such as arimoclomol; or autophagy inducers, such as rapamycin or lithium.

[0114] Treatments for Alzheimer's disease include, for example, acetylcholinesterase inhibitors such as tacrine, rivastigmine, galantamine or donepezil; NMDA receptor antagonists such as memantine; and antipsychotic drugs.

[0115] Treatments for dementia with Lewy bodies include, for example, acetylcholinesterase inhibitors such as tacrine, rivastigmine, galantamine or donepezil; N-methyl-D-aspartate receptor antagonist memantine; dopaminergic therapeutics such as levodopa or selegiline; antipsychotics such as olanzapine or clozapine; REM disorder therapeutics such as clonazepam, melatonin, or quetiapine; antidepressant and anti-anxiety therapeutics such as selective serotonin reuptake inhibitors (citalopram, escitalopram, sertraline, paroxetine, etc.), or serotonin and norepinephrine reuptake inhibitors (venlafaxine, mirtazapine, and bupropion) (see, e.g., Macijauskiene, et al., Medicina (Kaunas), 48(1):1-8 (2012)).

[0116] Exemplary neuroprotective agents include, for example, glutamate antagonists, antioxidants, and NMDA receptor agonists. Other neuroprotective agents and treatments include caspase inhibitors, trophic factors, anti-protein aggregation agents, therapeutic hypothermia, and erythropoietin.

[0117] Other common therapeutics, preventives or diagnostics for treating nerve dysfunction include amantadine and anticholinergics for treating motor symptoms, clozapine for treating psychosis, cholinesterase inhibitors for treating dementia, and modafinil for treating daytime sleepiness.

[0118] c. Anti-infective agents Useful anti-infective agents include antibiotics, antifungal agents, and antiviral agents. Examples of antibiotics include beta-lactams such as penicillin and ampicillin, cephalosporins such as cefuroxime, cefaclor, cephalexin, cephradine, cefpodoxime proxetil, tetracycline antibiotics such as doxycycline and minocycline, macrolide antibiotics such as azithromycin, erythromycin, rapamycin, and clarithromycin, fluoroquinolones such as ciprofloxacin, enrofloxacin, ofloxacin, gatifloxacin, levofloxacin, and norfloxacin, tobramycin, colistin, or aztreonam, and antibiotics known to have anti-inflammatory activity such as erythromycin, azithromycin, or clarithromycin. In some cases, these are nucleic acids that prevent infection or replication, which are expressed to produce antibodies against them.

[0119] 2. Diagnostic agents In some cases, the agent delivered to the target cell or tissue via the dendrimer is a diagnostic agent. Examples of diagnostic agents that can be delivered to the brain by a glucose dendrimer conjugate include paramagnetic molecules, fluorescent compounds, magnetic molecules, and radionuclides, X-ray imaging agents, and contrast media. The dendrimer conjugate may contain an agent useful for determining the location of the administered composition. Useful agents for this purpose include fluorescent tags, radionuclides, and imaging agents.

[0120] Exemplary diagnostic agents include dyes, fluorescent dyes, near-infrared dyes, SPECT imaging agents, PET imaging agents, and radioisotopes. Representative dyes include carbocyanine, indocarbocyanine, oxacarbocyanine, thuicarbocyanine, and merocyanine, polymethine, coumarin, rhodamine, xanthene, fluorescein, boron-dipyrromethane (BODIPY), Cy5, Cy5.5, Cy7, VivoTag-680, VivoTag-S680, VivoTag-S750, AlexaFluor660, AlexaFluor680, AlexaFluor700, AlexaFluor750, AlexaFluor790, Dy677, Dy676, Dy682, Dy752, Dy780, DyLight547, Dylight647, HiLyte Fluor647, HiLyte Fluor680, HiLyte Fluor750, IRDye800CW, IRDye800RS, IRDye700DX, ADS780WS, ADS830WS, and ADS832WS.

[0121] Exemplary SPECT or PET imaging agents include chelating agents such as diethylenetriaminepentaacetic acid (DTPA), 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA), diaminedithiol, activated mercaptoacetyl-glycyl-glycyl-glycine (MAG3), and hydrazidonicotinamide (HYNIC).

[0122] Exemplary isotopes include Tc-94m, Tc-99m, In-111, Ga-67, Ga-68, Gd3+, Y-86, Y-90, Lu-177, Re-186, Re-188, Cu-64, Cu-67, Co-55, Co-57, F-18, Sc-47, Ac-225, Bi-213, Bi-212, Pb-212, Sm-153, Ho-166, and Dy-166.

[0123] In a preferred embodiment, the dendrimer composition comprises one or more radioisotopes suitable for positron emission tomography (PET) imaging. Exemplary positron-emitting radioisotopes include carbon-11 ( 11 C), copper-64 ( 64 Cu), nitrogen-13 ( 13 N), oxygen-15 ( 15 O), gallium-68 ( 68 Ga), and fluorine-18 ( 18 F), for example, 2-deoxy-2- 18 F-fluoro-β-D-glucose ( 18 F-FDG).

[0124] In a further embodiment, the dendrimer conjugate composition can simultaneously treat and / or diagnose a disease or condition at one or more locations in the body.

[0125] III. Methods for Preparing Dendrimer Conjugates A. Methods for Preparing Dendrimers Dendrimers complexed with one or more gene editing systems may be prepared via various chemical reaction steps. Dendrimers are typically synthesized according to methods that allow control of their structure at all stages of construction. The dendritic structure is mostly synthesized by two major different approaches, divergent or convergent.

[0126] In some embodiments, dendrimers are prepared using a divergent approach, where the dendrimer is assembled from a polyfunctional core, which is extended outward by a series of reactions, usually Michael reactions. The strategy involves coupling monomer molecules having reactive and protecting groups with the polyfunctional core moiety, which leads to the stepwise addition of generations around the core, followed by removal of the protecting groups. For example, PAMAM-NH2 dendrimers are first synthesized by coupling N-(2-aminoethyl)acrylamide monomers to an ammonia core.

[0127] In other embodiments, dendrimers are prepared using a convergent approach, where the dendrimer is constructed from small molecules that ultimately reside on the surface of the sphere, and the reaction proceeds inward, building inward and ultimately attaching to the core.

[0128] There are also many other synthetic routes for preparing dendrimers, such as orthogonal approaches, accelerated approaches, two-step convergent methods or hypercore approaches, hypermonomer methods or branched monomer approaches, double exponential methods; orthogonal coupling methods or two-step approaches, two monomer approaches, AB2-CD2 approaches.

[0129] In some embodiments, the core of the dendrimer, one or more branching units, one or more linkers / spacers, and / or one or more surface groups may be modified to enable conjugation to additional functional groups (such as branching units, linkers / spacers, surface groups, etc.), monomers, and / or agents via one or more copper-assisted azide-alkyne cycloaddition (CuAAC), Diels-Alder reactions, thiol-ene and thiol-yne reactions, and click chemistry using azide-alkyne reactions (Arseneault M et al., Molecules. 2015 May 20;20(5):9263-94). In some embodiments, a ready-made dendron is clicked onto a high-density hydroxyl polymer. "Click chemistry" involves, for example, the coupling of two different moieties (such as a core group and a branching unit; or a branching unit and a surface group) via a 1,3-dipolar cycloaddition reaction between an alkyne moiety (or its equivalent) on the surface of a first moiety and an azide moiety on a second moiety (such as that present on a triazine composition or its equivalent, or any reactive end group, such as a primary amine end group, hydroxyl end group, carboxylic acid end group, thiol end group, etc.).

[0130] In some embodiments, dendrimer synthesis responds to one or more reactions, such as thiol-ene click reactions, thiol-yne click reactions, CuAAC, Diels-Alder click reactions, azide-alkyne click reactions, Michael additions, epoxy ring openings, esterifications, silane chemistries, and combinations thereof.

[0131] In some embodiments, the method includes one or more protection and deprotection steps of functional groups (e.g., hydroxyl groups) in the core, branching units, and / or therapeutic, prophylactic, or diagnostic agents to facilitate the addition of branching units to generate the desired dendrimer molecule or the addition of a therapeutic, prophylactic, or diagnostic agent to generate the desired dendrimer conjugate. In the case of hydroxyl groups, they may be protected by ether, ester, or acetal formation. Other exemplary protecting groups include Boc and Fmoc.

[0132] Existing dendritic platforms may be used to create dendrimers with the desired functionality, i.e., a high density of surface hydroxyl groups, by conjugating a high hydroxyl-containing moiety, such as 1-thio-glycerol or pentaerythritol. Exemplary dendritic platforms, such as polyamidoamine (PAMAM), poly(propylene imine) (PPI), poly-L-lysine, melamine, poly(ether hydroxyl amine) (PEHAM), poly(ester amine) (PEA), and polyglycerol, may be synthesized and studied.

[0133] Dendrimers may also be prepared by combining two or more dendrons. A dendron is the wedge-shaped section of the dendrimer that has a reactive focal functional group. Many dendron scaffolds are commercially available. They are sold as the first, second, third, fourth, fifth, and sixth generations, having 2, 4, 8, 16, 32, and 64 reactive groups, respectively. In certain embodiments, one type of agent is linked to one type of dendron and different types of agents are linked to another type of dendron. Then, two dendrons are connected to form a dendrimer. The two dendrons may be linked via click chemistry, i.e., a 1,3-dipolar cycloaddition reaction between an azide moiety on one dendron and an alkyne moiety on the other dendron to form a triazole linker.

[0134] Exemplary methods of making dendrimers are detailed in International Patent Applications WO2009 / 046446, WO2015168347, WO2016025745, WO2016025741, WO2019094952, and U.S. Patent No. 8,889,101.

[0135] 1. Method for preparing a glucose dendrimer In some embodiments, glucose-based dendrimers are prepared using a divergent method, where the dendrimer is assembled from a polyfunctional core, which is extended outward by a series of reactions. The strategy involves coupling monomer molecules having reactive and protecting groups with the polyfunctional core moiety, which leads to the stepwise addition of generations around the core, followed by removal of the protecting groups.

[0136] The synthesis of exemplary dendrimers is shown in the Examples. In some embodiments, the second-generation dendrimer D2-Glu24-OH96 is propargylated with one or more terminal hydroxyl groups suitable for further conjugation to one or more molecules such as Cas9 nuclease. **

[0137] B. Dendrimer-Gene Editing Agent Complex Methods for conjugating a drug to a dendrimer are generally known in the art and are described, for example, in U.S. Patent Application Publications US2011 / 0034422, US2012 / 0003155, and US2013 / 0136697.

[0138] In some embodiments, one or more drugs are covalently attached to the dendrimer. In some embodiments, the drug is attached to the dendrimer via a linking moiety designed to cleave in vivo. The linking moiety may be designed to cleave hydrolytically, enzymatically, or a combination thereof, thereby providing for the sustained release of the drug in vivo. Both the composition of the linking moiety and its point of attachment to the drug are selected such that cleavage of the linking moiety releases either the active drug or a suitable prodrug thereof. The composition of the linking moiety may also be selected in view of the desired rate of release of the drug.

[0139] In some embodiments, the attachment occurs via one or more of a disulfide, ester, ether, thioester, carbamate, carbonate, hydrazine, or amide bond. In preferred embodiments, the attachment occurs via a suitable spacer that provides an ester or amide bond between the drug and the dendrimer, depending on the desired release kinetics of the drug. In some cases, an ester bond is introduced for the releasable form of the drug. In other cases, an amide bond is introduced for the non-releasable form of the drug.

[0140] The linking moiety generally contains one or more organic functional groups. Examples of suitable organic functional groups include secondary amides (-CONH-), tertiary amides (-CONR-), sulfonamides (-S(O)2-NR-), secondary carbamates (-OCONH-;-NHCOO-), tertiary carbamates (-OCONR-;-NRCOO-), carbonates (-O-C(O)-O-), ureas (-NHCONH-;-NRCONH-;-NHCONR-, -NRCONR-), carbinols (-CHOH-,-CROH-), disulfide groups, hydrazones, hydrazides, ethers (-O-), and esters (-COO-,-CH2O2C-,CHRO2C-), where R is an alkyl group, an aryl group, or a heterocyclic group. Generally, the identity of one or more organic functional groups within the linking moiety is selected in consideration of the desired release rate of the agent. Further, one or more organic functional groups may be selected to facilitate covalent attachment of the agent to the dendrimer. In a preferred embodiment, the linkage may occur via a suitable spacer that provides a disulfide bridge between the agent and the dendrimer. The dendrimer complex allows for rapid release of the agent in vivo by a thiol-exchange reaction under reducing conditions found in the body.

[0141] In certain embodiments, the linking moiety, in combination with a spacer group, contains one or more of the organic functional groups described above. The spacer group may be composed of any assembly of atoms including oligomeric and polymeric chains, provided that the total number of atoms in the spacer group is preferably between 3 and 200 atoms, more preferably between 3 and 150 atoms, more preferably between 3 and 100 atoms, and most preferably between 3 and 50 atoms. Examples of suitable spacer groups include alkyl groups, heteroalkyl groups, alkylaryl groups, oligo- and polyethyleneglycol chains, and oligo- and poly(amino acid) chains. Variations of the spacer group further control the release of the agent in vivo. In embodiments where the linking moiety contains a spacer group, one or more organic functional groups are generally used to connect the spacer group to both the anti-inflammatory agent and the dendrimer.

[0142] Reactions and strategies useful for covalently attaching agents to dendrimers are known in the art. For example, see March, “Advanced Organic Chemistry,” 5 th th Edition, 2001, Wiley-Interscience Publication, New York) and Hermanson, “Bioconjugate Techniques,” 1996, Elsevier Academic Press, U.S.A. The appropriate method for the covalent attachment of a given agent may be selected considering the desired linker as well as the structures of the agent and the dendrimer, since it is related to the compatibility of functional groups, protecting group strategies, and the presence of labile linkages.

[0143] Optimal loading necessarily depends on many factors, including the choice of agent, the structure and size of the dendrimer, and the tissue being treated. In one embodiment, the Cas9 nuclease is conjugated to the dendrimer at a ratio of 1:1. However, the optimal loading for any given agent, dendrimer, and target site can be identified by conventional methods such as those described.

[0144] In some embodiments, conjugation of the agent and / or linker occurs via one or more surface and / or internal groups. In a preferred embodiment, the dendrimer complex retains an effective amount of surface functional groups for targeting specific cell types while being conjugated to an effective amount of an agent for treating, preventing, and / or imaging a disease or disorder.

[0145] IV. Pharmaceutical Formulations A pharmaceutical composition comprising a dendrimer-gene editing agent conjugate may be formulated in a conventional manner using one or more physiologically acceptable carriers, optionally including excipients and auxiliaries that facilitate the processing of the active compound into a preparation that can be pharmaceutically used for oral, intranasal, subcutaneous, intraperitoneal, or intramuscular administration. In some forms, the pharmaceutical composition comprises a glucose-dendrimer-gene editing agent conjugate.

[0146] Suitable formulations depend on the chosen route of administration. In a preferred embodiment, the composition is formulated for parenteral delivery. In some embodiments, the composition is formulated for intravenous injection. Typically, the composition will be formulated in sterile saline or buffer solution for injection into the tissue or cells to be treated. The composition may be lyophilized and stored in a disposable vial for rehydration immediately prior to use. Other means for rehydrating and administering are known to those skilled in the art.

[0147] Representative excipients include solvents, diluents, pH modifiers, preservatives, antioxidants, suspending agents, wetting agents, viscosity modifiers, isotonic agents, stabilizers, and combinations thereof. Suitable pharmaceutically acceptable excipients are preferably selected from materials generally recognized as safe (GRAS) and can be administered to an individual without causing undesired biological side effects or unwanted interactions.

[0148] Generally, pharmaceutically acceptable salts may be prepared by reacting the free acid or free base form of the agent with a stoichiometric amount of the appropriate base or acid in water or an organic solvent or a mixture of the two; generally, non-aqueous media such as ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred. Pharmaceutically acceptable salts include salts of the agent derived from inorganic acids, organic acids, alkali metal salts, and alkaline earth metal salts, as well as salts formed by the reaction of the drug with a suitable organic ligand (e.g., quaternary ammonium salts). A list of suitable salts can be found, for example, in Remington’s Pharmaceutical Sciences, 20th ed., Lippincott Williams & Wilkins, Baltimore, MD, 2000, p. 704. Examples of ophthalmic drugs sometimes administered in the form of pharmaceutically acceptable salts include timolol maleate, brimonidine tartrate, and diclofenac sodium.

[0149] The composition is preferably formulated into dosage unit forms to facilitate administration and to uniformize the dosage. The phrase “dosage unit form” refers to physically discrete units suitable for the patient to be treated. However, it will be understood that the total daily dosage of the composition will be decided by the attending physician within the scope of sound medical judgment. The therapeutically effective dose may first be estimated in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs. The animal model may be used to achieve the desired concentration range and route of administration. Such information should then be useful in determining the effective dose and route of administration in humans. The therapeutic efficacy and toxicity of the conjugate, e.g., ED50 (the dose is therapeutically effective in 50% of the population) and LD50 (the dose is lethal to 50% of the population), may be determined by standard pharmaceutical procedures in cell cultures or experimental animals. The dose ratio of toxicity to therapeutic effect is the therapeutic index, LD 50 / ED 50It is shown as a ratio. A pharmaceutical composition showing a large therapeutic index is preferred. Data obtained from cell culture assays and animal studies can be used in the formulation of various dosages for human use.

[0150] In certain embodiments, the composition of the glucose dendrimer is administered locally, for example, by direct injection into the site to be treated. In some embodiments, the composition is injected into, topically applied to, or otherwise directly administered to the vasculature on vascular tissue at or near the site of injury, surgery, or transplantation. For example, in an embodiment, the composition is topically applied to vascular tissue exposed during surgery. Typically, local administration results in an increase in the local concentration of the composition, which is higher than that which can be achieved by systemic administration.

[0151] Pharmaceutical compositions formulated for parenteral (intramuscular, intraperitoneal, intravenous or subcutaneous injection) and enteral administration routes are described.

[0152] The composition can be administered parenterally. The terms "parenteral administration" and "administered parenterally" are terms recognized in the art and include modes of administration other than enteral and topical administration such as injection. The dendrimer can be administered orally, intranasally, subcutaneously, intraperitoneally or intramuscularly. For liquid formulations, the pharmaceutically acceptable carrier may be, for example, an aqueous or non-aqueous solution, suspension, emulsion or oil. Examples of parenteral vehicles (for subcutaneous, intravenous, intraarterial or intramuscular injection) include, for example, sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's and fixed oils. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, and injectable organic esters such as ethyl oleate. Examples of aqueous carriers include water, alcohol / aqueous solutions, cyclodextrins, emulsions or suspensions including, for example, physiological saline and buffered media. The dendrimer can also be administered as an emulsion, for example, water-in-oil type. Examples of oils are of petroleum, animal, vegetable or synthetic origin, for example, peanut oil, soybean oil, mineral oil, olive oil, sunflower oil, fish liver oil, sesame oil, cottonseed oil, corn oil, olive, petrolatum, and mineral ones. Suitable fatty acids for use in parenteral formulations include, for example, oleic acid, stearic acid, and isostearic acid. Ethyl oleate and isopropyl myristate are examples of suitable fatty acid esters.

[0153] Formulations suitable for parenteral administration may include aqueous and non-aqueous sterile suspensions which may contain antioxidants, buffers, bacteriostats, and solutes which render the formulation isotonic with the blood of the intended recipient, as well as suspending, solubilizing, thickening, stabilizing and preserving agents. Intravenous vehicles may include fluid and nutrient replenishers, electrolyte replenishers, for example those based on Ringer's dextrose. Generally, water, physiological saline, aqueous dextrose and related sugar solutions, and glycols, for example propylene glycol or polyethylene glycol, are preferred liquid carriers for injectable solutions in particular.

[0154] Injectable pharmaceutical carriers for injectable compositions are well known to those skilled in the art (see, e.g., Pharmaceutics and Pharmacy Practice, J.B. Lippincott Company, Philadelphia, PA, Banker and Chalmers, eds., pages 238-250 (1982), and ASHP Handbook on Injectable Drugs, Trissel, 15th ed., pages 622-630 (2009)).

[0155] The compositions can also be made into aerosol formulations (i.e., they can be "sprayed") for administration via inhalation. The aerosol formulations can be placed in a pressurized acceptable propellant such as dichlorodifluoromethane, propane, nitrogen, and air. For administration by inhalation, the compounds are delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer using a suitable propellant.

[0156] V. Method of Use Describes methods of using compositions of the dendrimer-gene editing agent.

[0157] In some embodiments, the compositions may be capable of editing in prokaryotic and eukaryotic cells, in vitro, ex vivo, and in vivo settings. In further embodiments, the compositions may be capable of gene editing in an agricultural setting, such as in plants.

[0158] A. Treatment Methods The composition can be used for ex vivo or in vivo gene editing. The method typically involves contacting cells with an effective amount of the dendrimer-gene editing agent composition to modify the genome of the cells. As will be discussed in more detail below, the contacting can be performed ex vivo or in vivo. In a preferred embodiment, the method involves contacting a population of target cells with an effective amount of the gene editing composition to modify the genomes of a sufficient number of cells to achieve a desired result, such as a therapeutic result or a modified trait.

[0159] For example, an effective amount or a therapeutically effective amount can be a dosage sufficient to treat, inhibit, or alleviate one or more symptoms of a disease or disorder, or otherwise provide a desired pharmacological and / or physiological effect, such as a reduction, inhibition, or reversal of one or more underlying pathophysiological mechanisms of the disease or disorder.

[0160] The formulation is made according to the mode of administration. The pharmaceutically acceptable carrier is determined in part by the particular composition being administered and by the particular method used to administer the composition. Thus, there are a variety of suitable formulations for pharmaceutical compositions containing nucleic acids. The exact dosage will be varied by various factors, such as subject-dependent variables (e.g., age, immune system health, clinical symptoms, etc.). Exemplary indications, pharmacological, and physiological effects will be discussed in more detail below.

[0161] The composition can be administered once, twice, or three times daily; once, twice, three times, four times, five times, six times, seven times a week; once, twice, three times, four times, five times, six times, seven times, or eight times a month, or otherwise contacted with the target cells. For example, in some embodiments, the composition is administered every two or three days, or on average about two to about four times a week.

[0162] In a preferred embodiment, the composition is administered in an amount effective to induce gene modification in at least one target allele such that it occurs at a frequency of at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25% of the target cells. In some embodiments, particularly for ex vivo applications, the gene modification occurs at a frequency of about 0.1 - 25%, or 0.5 - 25%, or 1 - 25%, 2 - 25%, or 3 - 25%, or 4 - 25%, or 5 - 25%, or 6 - 25%, or 7 - 25%, or 8 - 25%, or 9 - 25%, or 10 - 25%, 11 - 25%, or 12 - 25%, or 13% - 25%, or 14% - 25%, or 15 - 25%, or 2 - 20%, or 3 - 20%, or 4 - 20%, or 5 - 20%, or 6 - 20%, or 7 - 20%, or 8 - 20%, or 9 - 20%, or 10 - 20%, 11 - 20%, or 12 - 20%, or 13% - 20%, or 14% - 20%, or 15 - 20%, 2 - 15%, or 3 - 15%, or 4 - 15%, or 5 - 15%, or 6 - 15%, or 7 - 15%, or 8 - 15%, or 9 - 15%, or 10 - 15%, 11 - 15%, or 12 - 15%, or 13% - 15%, or 14% - 15% in at least one target allele.

[0163] In some embodiments, particularly for in vivo applications, gene modification occurs in at least one target allele at a frequency of about 0.1% to about 10%, or about 0.2% to about 10%, or about 0.3% to about 10%, or about 0.4% to about 10%, or about 0.5% to about 10%, or about 0.6% to about 10%, or about 0.7% to about 10%, or about 0.8% to about 10%, or about 0.9% to about 10%, or about 1.0% to about 10%, or about 1.1% to about 10%, or about 1.2% to about 10%, or about 1.3% to about 10%, or about 1.4% to about 10%, or about 1.5% to about 10%, or about 1.6% to about 10%, or about 1.7% to about 10%, or about 1.8% to about 10%, or about 1.9% to about 10%, or about 2.0% to about 10%, or about 2.5% to about 10%, or about 3.0% to about 10%, or about 3.5% to about 10%, or about 4.0% to about 10%, or about 4.5% to about 10%, or about 5.0% to about 10%.

[0164] In some embodiments, gene modification occurs with a low off-target effect. In some embodiments, off-target modifications cannot be detected using conventional assays. In some embodiments, off-target events occur at a frequency of 0 to 1%, or 0 to 0.1%, or 0 to 0.01%, or 0 to 0.001%, or 0 to 0.0001%, or 0 to 0.00001%, or 0 to 0.000001%. In some embodiments, off-target modifications occur at a frequency that is about 10 2 times, 10 3 times, 10 4 times, or 10 5 times lower than the modification at the target site.

[0165] A method comprising the step of selecting a subject who may benefit from treatment with a dendrimer-gene editing agent composition.

[0166] 1. ex vivo gene therapy In some embodiments, ex vivo gene therapy of cells is used for the treatment of genetic disorders in a subject. With respect to ex vivo gene therapy, cells are isolated from the subject and contacted ex vivo with a composition to generate cells containing a mutation in or adjacent to a gene. In preferred embodiments, the cells are isolated from the subject to be treated or from a syngeneic host. The target cells are removed from the subject prior to contact with the gene editing composition and preferably an enhancer. The cells may be hematopoietic progenitor cells or stem cells. In a preferred embodiment, the target cells are CD34 + hematopoietic stem cells. Hematopoietic stem cells (HSCs), such as CD34+ cells, are pluripotent stem cells that give rise to all blood cell types including red blood cells. Thus, CD34+ cells can be isolated from patients having, for example, thalassemia, sickle cell disease, or lysosomal storage diseases, the mutant gene can be altered or repaired ex vivo using the compositions and methods, and the cells can be reintroduced back into the patient as a treatment or cure.

[0167] The stem cells may be isolated and enriched by those skilled in the art. Such methods for the isolation and enrichment of CD34 + and other cells are known in the art and are disclosed, for example, in U.S. Pat. Nos. 4,965,204; 4,714,680; 5,061,620; 5,643,741; 5,677,136; 5,716,827; 5,750,397 and 5,759,793. As used herein in the context of enriched compositions of hematopoietic progenitor cells and stem cells, "enriched" indicates a higher proportion of a desired element (e.g., hematopoietic progenitor cells and stem cells) than found in the natural source of the cells. The composition of cells may be enriched by at least one order of magnitude, preferably two or three orders of magnitude, more preferably 10, 100, 200 or 1000 orders of magnitude, relative to the natural source of the cells.

[0168] In humans, CD34 +Cells can be recovered from cytokine-mobilized blood generated by subcutaneous or intravenous injection of hematopoietic growth factors, such as granulocyte colony-stimulating factor (G-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), and stem cell factor (SCF), into a donor in an amount sufficient to cause the migration of hematopoietic stem cells from umbilical cord blood, bone marrow, or from the bone marrow space into the peripheral circulation. First, bone marrow cells can be obtained from any suitable source of bone marrow, such as the tibia, femur, vertebrae, and other bone cavities. For the isolation of bone marrow, an appropriate solution can be used to flush the bone, which is a balanced salt solution supplemented with fetal bovine serum or other naturally occurring factors, in combination with a low concentration, generally about 5 to 25 mM, acceptable buffer. Convenient buffers include Hepes, phosphate buffer, lactate buffer, and the like.

[0169] Cells can be selected by positive and negative selection techniques. Cells can be selected using commercially available antibodies that bind to surface antigens of hematopoietic progenitor cells or stem cells, such as CD34, using methods known to those skilled in the art. For example, the antibody may be conjugated to magnetic beads, and immunogenic procedures may be utilized to recover the desired cell type. Other techniques include the use of fluorescence-activated cell sorting (FACS). The CD34 antigen found on progenitor cells within the hematopoietic system of non-leukemic individuals is expressed in a population of cells recognized by the monoclonal antibody My-10 (i.e., cells that express the CD34 antigen), and this can be used to isolate stem cells for bone marrow transplantation. My-10, deposited with the American Type Culture Collection (Rockville, Md.) as HB-8483, is commercially available as anti-HPCA 1. Furthermore, negative selection of differentiated and "specialized" cells from human bone marrow can be utilized to select against virtually any desired cell marker. For example, progenitor cells or stem cells, most preferably CD34 + Cells are CD3 - 、CD7 - 、CD8 - 、CD10 - 、CD14 - 、CD15- , CD19 - , CD20 - , CD33 - , class II HLA + and Thy-1 + can be characterized as being any one of.

[0170] Once the progenitor cells or stem cells are isolated, they may be propagated by growing them in any suitable medium. For example, the progenitor cells or stem cells can be grown in conditioned medium from stromal cells, such as from bone marrow or liver associated with the secretion of factors, or in a medium containing cell surface factors that support the growth of stem cells. The stromal cells may be without hematopoietic cells using appropriate monoclonal antibodies for the removal of undesired cells.

[0171] The isolated cells are contacted ex vivo with a combination of a triple helix-forming molecule and a donor oligonucleotide in an amount effective to cause a desired mutation in a gene that requires repair or alteration, such as the human beta-globin or alpha-L-iduronidase gene, either within or adjacent to it. These cells are referred to herein as modified cells. Methods for the transfection of cells with oligonucleotides and peptide nucleic acids are well known in the art (Koppelhus, et al., Adv. Drug Deliv. Rev., 55(2): 267-280 (2003)). It may be desirable to synchronize the cells in the S phase in order to further increase the frequency of gene correction. For example, methods for synchronizing cells cultured by double thymidine block are known in the art.

[0172] The modified cells can be maintained or expanded in culture prior to administration to a subject. The culture conditions are generally known in the art depending on the cell type. CD34 +The conditions for maintenance have been well studied, and several suitable methods are available. A common approach for ex vivo expansion of multipotent hematopoietic cells is to culture purified progenitor or stem cells in the presence of early-acting cytokines such as interleukin-3. It has been shown to be useful to include in the nutrient medium for ex vivo maintenance of hematopoietic progenitor cells a combination of thrombopoietin (TPO), stem cell factor (SCF), and flt3 ligand (Flt-3L; i.e., the ligand of the flt3 gene product) for in vitro expansion of early (i.e., relatively undifferentiated) human hematopoietic progenitor cells, and that these cells could engraft in SCID-hu mice (Luens et al., 1998, Blood 91:1206-1215). In other known methods, cells can be maintained ex vivo in a nutrient medium containing mouse prolactin-like protein E (mPLP-E) or mouse prolactin-like protein F (mPIP-F; collectively mPLP-E / IF) (e.g., for several minutes, hours, or 3, 6, 9, 13 days or longer) (U.S. Patent No. 6,261,841). It is recognized that other suitable cell culture and expansion methods can likewise be used with respect to the present invention. Cells can also be grown in serum-free medium as described in U.S. Patent No. 5,945,337.

[0173] In another embodiment, modified hematopoietic stem cells are differentiated ex vivo in a cell culture using a specific combination of interleukins and growth factors prior to administration to a subject using methods well known in the art. The cells can be expanded ex vivo in large numbers compared to the original population of isolated hematopoietic stem cells, preferably achieving at least a 5-fold, more preferably at least a 10-fold, and even more preferably at least a 20-fold expansion of the cells. +

[0174] In another embodiment of the cells for ex vivo gene therapy, the cells used may be differentiated somatic cells. The somatic cells can be reprogrammed to become pluripotent stem-like cells that can be induced to become hematopoietic progenitor cells. The hematopoietic progenitor cells are then treated with a triple helix-forming molecule and a donor oligonucleotide as described above to generate recombinant cells having one or more modified genes. Representative somatic cells that can be reprogrammed include, but are not limited to, fibroblasts, adipocytes, and myocytes. Hematopoietic progenitor cells derived from induced pluripotent stem cells have been successfully developed in mice (Hanna, et al., Science, 318:1920-1923 (2007)). + As described above with respect to the + cells, the hematopoietic progenitor cells can be treated with a triple helix-forming molecule and a donor oligonucleotide to generate recombinant cells having one or more modified genes. Representative somatic cells that can be reprogrammed include, but are not limited to, fibroblasts, adipocytes, and myocytes. Hematopoietic progenitor cells derived from induced pluripotent stem cells have been successfully developed in mice (Hanna, et al., Science, 318:1920-1923 (2007)).

[0175] To generate hematopoietic progenitor cells from induced pluripotent stem cells, the somatic cells are collected from the host. In a preferred embodiment, the somatic cells are autologous fibroblasts. The cells are cultured and transduced with vectors encoding the Oct4, Sox2, Klf4, and c-Myc transcription factors. The transduced cells are cultured and screened for embryonic stem cell (ES) markers including, but not limited to, AP, SSEA1, and Nanog. The transduced ES cells are cultured and induced to generate induced pluripotent stem cells. The cells are then screened for the CD41 and c-kit markers (early hematopoietic progenitor cell markers) as well as markers for myeloid and erythroid differentiation.

[0176] The modified hematopoietic stem cells or modified induced hematopoietic progenitor cells are then introduced into the subject. Delivery of the cells may be affected using a variety of methods, most preferably including intravenous administration by injection as well as direct depot injection into the periosteum, bone marrow, and / or subcutaneous sites.

[0177] Subjects receiving the modified cells may be treated for bone marrow conditioning to enhance engraftment of the cells. The recipient may be treated using radiation or chemotherapeutic agent treatment to enhance engraftment prior to administration of the cells. At the time of administration, the cells generally require a period for engraftment. It typically takes several weeks to several months to achieve significant engraftment of hematopoietic stem cells or progenitor cells.

[0178] A high percentage of engraftment of modified hematopoietic stem cells is not assumed to be necessary to achieve a significant prophylactic or therapeutic effect. It is expected that the engrafted cells will expand and proliferate over time after engraftment, increasing the percentage of modified cells. Only a small number or small percentage of engraftment of modified hematopoietic stem cells is expected to be necessary to provide a prophylactic or therapeutic effect.

[0179] In a preferred embodiment, the cells administered to the subject are autologous, e.g., derived from the subject, or syngeneic.

[0180] In a preferred embodiment, the guide RNA enables specific gene editing for ex vivo cell therapy, including CAR-T, CAR-NK, and CAR-macrophage editing. In a further embodiment, the guide RNA enables knockout and knock-in of one or more genes or gene segments in iPSCs, ESCs, mesenchymal stem cells, and stem-derived cell lines.

[0181] 2. In vivo gene therapy In some forms, the composition is administered directly to the subject for in vivo gene therapy. When the described composition is administered directly to the subject, the composition is typically delivered as a pharmaceutically acceptable formulation via and in an amount effective for the intended gene therapy.

[0182] Dendrimer compositions, particularly glucose dendrimers, selectively target neurons, which play an important role in the etiology of many disorders and conditions, including neurodevelopmental disorders, neurodegenerative diseases, and brain cancer. Thus, in preferred embodiments, the dendrimer composition, particularly the glucose dendrimer, is systemically administered and passes through the blood-brain barrier (BBB) to selectively target the nucleus of neurons, preferably damaged / hyperactive neurons, or to become enriched within neurons, preferably within the nucleus of damaged / hyperactive neurons.

[0183] In other forms, the dendrimer composition enables targeted editing of specific cells of the body, including reactive microglia, macrophages, astrocytes, retinal pigment epithelium (RPE cells), reactive immune cells, made possible by the ability of hydroxyl PAMAM dendrimers to target these cells.

[0184] Typically, the dendrimer composition is administered in vivo in a dosage unit amount effective to treat or alleviate one or more conditions or diseases in a subject. In some forms, the one or more conditions or diseases are associated with one or more pathologies of neurons. Generally, by targeting these cells, the dendrimer delivers an effective amount of a gene editing composition to specifically modify the genomes of a sufficient number of diseased neurons to achieve a therapeutic effect.

[0185] B. Disorders and Diseases to be Treated Gene therapy using dendrimer-gene editing agent compositions is evident when studied in the context of human genetic diseases such as cystic fibrosis, hemophilia, globinopathies such as sickle cell anemia and beta-thalassemia, xeroderma pigmentosum, and lysosomal storage diseases. However, this strategy is also useful for treating non-genetic diseases such as HIV, both in the context of ex vivo-based cell modification and also with respect to in vivo cell modification. The compositions are particularly useful for treating hereditary deficiencies, disorders, and diseases caused by mutations in a single gene, for example, for correcting hereditary deficiencies, disorders, and diseases caused by point mutations. When the target gene contains a mutation that is the cause of a genetic disorder, the composition can be used for mutagenic repair that can normally restore the DNA sequence of the target gene. The target sequence may be within the coding DNA sequence of the gene or within an intron. The target sequence may also be within a DNA sequence that regulates the expression of the target gene, including a promoter or enhancer sequence.

[0186] In some embodiments, the composition is particularly useful for treating monogenic and polygenic diseases, where the dendrimer is conjugated or complexed with one or more sgRNA constructs.

[0187] When the target gene is an oncogene that causes unregulated growth, for example, in cancer cells, the oligonucleotide is useful for inactivating the gene and causing mutations that end or reduce the uncontrolled growth of the cells. The oligonucleotide is also a useful anti-cancer agent for activating a repressor gene that has lost its ability to suppress growth. The target gene may also be a gene encoding an immune regulator, such as programmed cell death protein 1 (PD-1), to enhance the host immune response against cancer. The gene editing technology can be designed to reduce or prevent the expression of PD-1 and can be administered in an effective amount to do so. Thus, in some embodiments, the composition is used for treating cancer.

[0188] The composition can be used as an antiviral agent, for example, when designed to modify a specific portion of the viral genome necessary for proper viral growth or function.

[0189] Dendrimer compositions, particularly glucose dendrimers, selectively target neurons, which play important roles in the etiology of many disorders and conditions including neurodevelopmental disorders, neurodegenerative disorders, and brain cancer. In a preferred embodiment, the dendrimer composition, particularly the glucose dendrimer, crosses the blood-brain barrier (BBB) and selectively targets the nucleus of neurons, preferably damaged / hyperactive neurons, or is enriched within neurons, preferably within the nucleus of damaged / hyperactive neurons.

[0190] In a further embodiment, the dendrimer composition enables targeted editing of specific cells of the body, including reactive microglia, macrophages, astrocytes, retinal pigment epithelium (RPE cells), enabled by the ability of hydroxyl PAMAM dendrimers to target these cells.

[0191] Accordingly, the dendrimer composition is administered in a dosage unit amount effective to treat or alleviate conditions associated with the pathological state of neurons. Generally, by targeting these cells, the dendrimer delivers an effective amount of the gene editing composition to specifically modify the genomes of a sufficient number of diseased neurons to achieve a therapeutic outcome.

[0192] In particular, the dendrimer composition is suitable for treating one or more diseases and conditions in the eye, brain, and nervous system, particularly those associated with pathological activation of neurons, microglia, and / or astrocytes. The compositions and methods are also suitable for prophylactic use.

[0193] In some embodiments, the subject to be treated is a human. In some embodiments, the subject to be treated is a pediatric or infant subject. All methods may include the step of identifying and selecting a subject in need of treatment or a subject who would benefit from administration of the described compositions.

[0194] 1. Eye Diseases and Disorders The compositions and methods are suitable for the treatment of one or more diseases and conditions in the eye.

[0195] In a preferred embodiment, the eye disorder to be treated is age-related macular degeneration (AMD). Age-related macular degeneration (AMD) is a neurodegenerative neuroinflammatory disease of the macula, which is a cause of central vision loss. The etiology of age-related macular degeneration involves chronic neuroinflammation in the choroid (the vascular layer under the retina), the retinal pigment epithelium (RPE), the cell layer under the neurosensory retina, Bruch's membrane, and the neurosensory retina itself.

[0196] Current treatments for exudative retinal diseases, such as neovascular or "wet" age-related macular degeneration (AMD) and diabetic retinopathy, include intravitreal injection of drugs that target vascular endothelial growth factor (VEGF). These anti-VEGF agents require frequent injections into the eye, which is costly and burdensome for patients.

[0197] As shown in the following examples, dendrimer-Cas9 RNP is effective in editing the VEGF gene. Thus, in some embodiments, the composition is administered in an amount effective to permanently suppress VEGF secretion from human retinal cells.

[0198] In some embodiments, the eye disorder is a hereditary form of blindness caused by specific gene mutations, such as Leber congenital amaurosis, the most common cause of hereditary pediatric blindness.

[0199] Other examples of eye disorders that can be treated include amebic keratitis, fungal keratitis, bacterial keratitis, viral keratitis, onchocerciasis keratitis, bacterial conjunctivitis, viral conjunctivitis, corneal dystrophy diseases, Fuchs corneal endothelial dystrophy, meibomian gland dysfunction, anterior and posterior blepharitis, conjunctival hyperemia, conjunctival necrosis, cicatricial scarring and fibrosis, punctate epithelial keratopathy, filamentary keratitis, corneal erosion, thinning, ulceration and perforation, Sjogren's syndrome, Stevens-Johnson syndrome, autoimmune dry eye disease, environmental dry eye disease, corneal neovascularization diseases, prevention and treatment of rejection after corneal transplantation, autoimmune uveitis, infectious uveitis, anterior uveitis, posterior uveitis (including toxoplasmosis), panuveitis, vitreous or retinal inflammatory diseases, prevention and treatment of endophthalmitis, macular edema, macular degeneration, age-related macular degeneration, proliferative and non-proliferative diabetic retinopathy, hypertensive retinopathy, retinal autoimmune diseases, primary and metastatic intraocular melanoma, other intraocular metastatic tumors, glaucoma, open-angle glaucoma, closed-angle glaucoma, pigmentary glaucoma, and combinations thereof.

[0200] 2. Neurological and neurodegenerative diseases Dendrimer compositions and formulations are suitable for the treatment of one or more neurological and neurodegenerative diseases. In some embodiments, the disease or disorder is, but is not limited to, some mental disorders (e.g., depression, schizophrenia (SZ), alcohol use disorder, and morphine antinociceptive tolerance), neurological and neurodegenerative disorders (e.g., Alzheimer's disease (AD), Parkinson's disease (PD), amyotrophic lateral sclerosis (ALS)). In one embodiment, the dendrimer complex is used to treat Alzheimer's disease (AD) or dementia.

[0201] Neurodegenerative diseases are chronic progressive disorders of the nervous system that affect nerves and behavioral functions, accompanied by biochemical changes that result in different histopathological and clinical syndromes (Hardy H, et al., Science. 1998;282:1075-9). Abnormal proteins that are resistant to cell degradation mechanisms accumulate intracellularly. The pattern of nerve loss is selective in the sense that one group is affected while the other remains intact. Often, there is no obvious triggering event for the disease. Classically described neurodegenerative diseases are Alzheimer's disease, Huntington's disease, and Parkinson's disease.

[0202] Compositions and methods deliver an effective amount of a gene editing composition for the treatment of a nerve disease or disorder or a neurodegenerative disease or disorder, or a central nervous system disorder. In preferred embodiments, the compositions and methods are effective in the treatment and / or alleviation of neuroinflammation associated with a nerve disease or disorder or a neurodegenerative disease or disorder, or a central nervous system disorder. The methods typically include administering an effective amount of the composition to a subject for enhancing cognition or reducing cognitive decline, enhancing cognitive function or reducing cognitive function decline, enhancing memory or reducing memory decline, enhancing learning ability or capacity or reducing learning ability or capacity decline, or a combination thereof.

[0203] In some embodiments, the neurological disease or disorder is Huntington's disease, amyotrophic lateral sclerosis (ALS), Alzheimer's disease, Parkinson's disease, childhood cerebral adrenoleukodystrophy (ccALD), muscular dystrophy, Friedreich's ataxia, and spinocerebellar ataxia.

[0204] In one embodiment, the disease or disorder is Duchenne muscular dystrophy, which is caused by a mutation in the DMD gene that encodes a protein necessary for muscle contraction.

[0205] In another embodiment, the disease or disorder is Huntington's disease. Huntington's disease is caused by an abnormal repetition of a specific DNA sequence within the huntingtin gene. Treating Huntington's can be difficult because any off-target effects of CRISPR in the brain can have very dangerous consequences. In a preferred embodiment, the dendrimer-gene editing agent composition provides selective delivery to target cells with minimal off-targeting.

[0206] In another embodiment, the disease or disorder is spinal muscular atrophy. Spinal muscular atrophy (SMA) is an autosomal recessive neuromuscular disorder caused by mutations in the telomeric survival motor neuron 1 (SMN1) gene. Deficiency of ubiquitous SMN function affects multiple tissues and organs, however, neuronal tissue is primarily sensitive, resulting in α-motor neuron degeneration in the anterior horn of the spinal cord and subsequent dysfunction of the neuromuscular junction and proximal muscle weakness. Thus, in some embodiments, the dendrimer-gene editing composition is administered to increase SMN levels in affected tissues for the treatment of spinal muscular atrophy, for example, by applying targeted genome editing techniques to the human SMN locus to convert the SMN2 sequence back to an SMN1-like sequence capable of undergoing proper splicing under endogenous transcriptional control.

[0207] In another embodiment, the compositions and methods may be used to treat a subject having a disease or disorder such as Parkinson's disease (PD) and PD-related diseases, amyotrophic lateral sclerosis (ALS), prion diseases such as Creutzfeldt-Jakob disease, corticobasal degeneration, frontotemporal dementia, HIV-associated cognitive impairment, mild cognitive impairment, motor neuron disease (MND), Lewy body disease, Alzheimer's disease, neuronal ceroid lipofuscinosis, Batten disease, cerebro-oculo-facio-skeletal syndrome, corticobasal degeneration, Gerstmann-Straussler-Scheinker disease, Kuru, Leigh disease, Monomelic Amyotrophy, multiple system atrophy, multiple system atrophy with orthostatic hypotension (Shy-Drager syndrome), multiple sclerosis (MS), Duchenne muscular dystrophy, neurodegeneration with brain iron accumulation, opsoclonus myoclonus, Posterior Cortical Atrophy, primary progressive aphasia, progressive supranuclear palsy, vascular dementia, progressive multifocal leukoencephalopathy, Lewy body dementia (DLB), Lacunar syndrome, hydrocephalus, Wernicke-Korsakoff syndrome, post-encephalitic dementia, cancer and chemotherapy-related cognitive impairment and dementia, as well as depression-induced dementia and pseudodementia.

[0208] In other embodiments, the disease or disorder is injection-limited amyloidosis, cerebral amyloid angiopathy, myopathy, neuropathy, traumatic brain injury, frontotemporal dementia, Pick's disease, multiple sclerosis, prion disorder, type 2 diabetes, fatal familial insomnia, cardiac arrhythmia, isolated atrial amyloidosis, atherosclerosis, rheumatoid arthritis, familial amyloidotic polyneuropathy, hereditary non-neuropathic systemic amyloidosis, Finnish amyloidosis, lattice corneal dystrophy, systemic AL amyloidosis, neuropathic Gaucher's disease or Down syndrome. In a preferred embodiment, the disease or disorder is Alzheimer's disease or dementia.

[0209] 3. Neurodevelopmental disorders Neurodevelopmental disorders generally mean that the brain is not formed normally from the beginning. Abnormal regulation of basic neurodevelopmental processes may occur, or there may be disruptions due to injuries that can take various forms. Autism and attention deficit hyperactivity disorder are classically described as neurodevelopmental disorders. Others include fragile X syndrome, Down syndrome, Tay-Sachs disease, Sandhoff disease, Niemann-Pick disease, and sphingolipidosis.

[0210] The compositions and methods can also be used to treat neurodevelopmental disorders, such as cerebral palsy.

[0211] 4. Cancer In some embodiments, the dendrimer-gene editing agent composition is administered to a subject having a proliferative disease, such as a benign or malignant tumor. In some embodiments, the subject being treated is diagnosed with stage I, stage II, stage III, or stage IV cancer.

[0212] The term cancer specifically refers to a malignant tumor. In addition to uncontrolled growth, malignant tumors exhibit metastasis. In this process, small clusters of cancerous cells dislodge from the tumor, enter the bloodstream or lymphatic vessels, are carried to other tissues, where they continue to proliferate. In this way, a primary tumor at one site can give rise to secondary tumors at another site.

[0213] The compositions and methods are useful for treating a subject having a benign or malignant tumor by delaying or inhibiting tumor growth in the subject, reducing the growth or size of the tumor, inhibiting or reducing tumor metastasis, and / or inhibiting or reducing symptoms associated with the development or growth of the tumor.

[0214] Malignant tumors that can be treated are classified according to the embryonic origin of the tissue from which the tumor derives. Cancer is a tumor that arises from endodermal or ectodermal tissue, such as the epithelium of the skin or internal organs and glands. The composition is particularly effective in treating cancer. Sarcomas, which occur less frequently, are derived from mesodermal connective tissue, such as bone, fat, and cartilage. Leukemia and lymphoma are malignant tumors of hematopoietic cells in the bone marrow. Leukemia grows as a single cell, while lymphoma tends to grow as a tumor mass. Malignant tumors can appear in many organs or tissues of the body and establish cancer.

[0215] Types of cancer that can be treated with the composition and method include, but are not limited to, bone, bladder, brain, breast, cervical, colorectal, esophageal, kidney, liver, lung, nasopharyngeal, pancreatic, prostate, skin, stomach, and uterine cancers, such as multiple myeloma, adenocarcinoma, and sarcoma. In some embodiments, the composition is used to treat multiple types of cancer together. The composition can also be used to treat metastases or tumors at multiple locations.

[0216] Exemplary tumor cells include, but are not limited to, acute leukemia, acute lymphocytic leukemia, acute myeloid leukemia such as myeloblastic leukemia, promyelocytic leukemia, myelomonocytic leukemia, monocytic leukemia, erythroleukemia and myelodysplastic syndrome, chronic leukemia such as, but not limited to, chronic myeloid (granulocytic) leukemia, chronic lymphocytic leukemia, hairy cell leukemia; polycythemia vera; lymphoma such as, but not limited to, Hodgkin's disease, non-Hodgkin's disease; multiple myeloma such as, but not limited to, smoldering multiple myeloma, non-secretory myeloma, osteosclerotic myeloma, plasma cell leukemia, solitary plasmacytoma and extramedullary plasmacytoma; Waldenström's macroglobulinemia; monoclonal gammopathy of undetermined significance; benign monoclonal gammopathy; heavy chain disease; sarcoma of bone and connective tissue such as, but not limited to, osteosarcoma, osteogenic sarcoma, chondrosarcoma, Ewing's sarcoma, malignant giant cell tumor, fibrosarcoma of bone, chordoma, periosteal sarcoma, soft tissue sarcoma, angiosarcoma (hemangiosarcoma), fibrosarcoma, Kaposi's sarcoma, leiomyosarcoma, liposarcoma, lymphangiosarcoma, schwannoma, rhabdomyosarcoma, synovial sarcoma; brain tumors including, but not limited to, glioma, astrocytoma, brainstem glioma, ependymoma, oligodendroglioma, nonglial tumor, acoustic neuroma, craniopharyngioma, medulloblastoma, meningioma, pineocytoma, pineoblastoma, primary brain lymphoma; breast cancer including, but not limited to, adenocarcinoma, lobular (small cell) carcinoma, intraductal carcinoma, medullary breast cancer, mucinous breast cancer, tubular breast cancer, papillary breast cancer, Paget's disease, and inflammatory breast cancer; adrenal cancer including, but not limited to, pheochromocytoma and adrenocortical carcinoma; thyroid cancer such as, but not limited to, papillary or follicular thyroid cancer, medullary thyroid cancer and anaplastic thyroid cancer; pancreatic cancer including, but not limited to, insulinoma, gastrinoma, glucagonoma, VIPoma, somatostatin-secreting tumor, and carcinoid tumor or islet tumor; pituitary cancer including, but not limited to, Cushing's disease, prolactin-secreting tumor, acromegaly, and diabetes insipidus;Eye cancers, including but not limited to uveal melanomas such as iris melanoma, choroidal melanoma, and ciliary body melanoma, and retinoblastoma; vaginal cancers, including but not limited to squamous cell carcinoma, adenocarcinoma, and melanoma; vulvar cancers, including but not limited to squamous cell carcinoma, melanoma, adenocarcinoma, basal cell carcinoma, sarcoma, and Paget's disease; cervical cancers, including but not limited to squamous cell carcinoma and adenocarcinoma; uterine cancers, including but not limited to endometrial cancer and uterine sarcoma; ovarian cancers, including but not limited to ovarian epithelial cancer, borderline tumors, germ cell tumors, and stromal tumors; esophageal cancers, including but not limited to squamous cell carcinoma, adenocarcinoma, adenoid cystic carcinoma, mucoepidermoid carcinoma, adenosquamous carcinoma, sarcoma, melanoma, plasmacytoma, verrucous carcinoma, and oat cell (small cell) carcinoma; gastric cancers, including but not limited to adenocarcinoma, fungating (polypoid), ulcerated, superficially spreading, diffusely spreading malignant lymphomas, liposarcoma, fibrosarcoma, and carcinosarcoma; colon cancer; rectal cancer; liver cancers, including but not limited to hepatocellular carcinoma and hepatoblastoma; gallbladder cancers, including but not limited to adenocarcinoma; cholangiocarcinoma, including but not limited to papillary, nodular, and diffuse; lung cancers, including but not limited to non-small cell lung cancer, squamous cell carcinoma (epidermoid carcinoma), adenocarcinoma, large cell carcinoma, and small cell lung cancer; testicular cancers, including but not limited to embryonal tumors, seminomas, dysgerminomas, classical (typical), spermatocytic non-seminomas, embryonal carcinoma, teratoma carcinoma, and choriocarcinoma (yolk sac tumor); prostate cancers, including but not limited to adenocarcinoma, leiomyosarcoma, and rhabdomyosarcoma; penile cancers; oral cancers, including but not limited to squamous cell carcinoma; basal cell carcinoma; salivary gland cancers, including but not limited to adenocarcinoma, mucoepidermoid carcinoma, and adenoid cystic carcinoma; pharyngeal cancers, including but not limited to squamous cell carcinoma and verrucous.Cancer tumor cells include, but are not limited to, skin cancers such as basal cell carcinoma, squamous cell carcinoma and melanoma, superficial spreading melanoma, nodular melanoma, acral lentiginous melanoma, lentigo maligna melanoma; kidney cancers including, but not limited to, renal cell carcinoma, adenocarcinoma, Grawitz tumor, fibrosarcoma, transitional cell carcinoma (renal pelvis and / or ureter); Wilms tumor; bladder cancers including, but not limited to, transitional cell carcinoma, squamous cell carcinoma, adenocarcinoma, carcinosarcoma. In one embodiment, the cancer is a brain metastasis in a patient having leukemia.;

[0217] Cancers that can be prevented, treated or otherwise reduced by the composition include myxosarcoma, osteogenic sarcoma, endotheliosarcoma, lymphangioendotheliosarcoma, mesothelioma, synovioma, hemangioblastoma, epithelioma, cystadenocarcinoma, bronchogenic carcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, and stomach cancer (see Fishman et al., 1985, Medicine, 2d Ed., J.B. Lippincott Co., Philadelphia and Murphy et al., 1997, Informed Decisions: The Complete Book of Cancer Diagnosis, Treatment, and Recovery, Viking Penguin, Penguin Books U.S.A., Inc., United States of America for a review of such disorders).

[0218] In further embodiments, the composition is used for prophylactic use, i.e., for prevention, delay in onset, reduction, eradication, or delay in the exacerbation of signs or symptoms after onset, and prevention of recurrence. With respect to prophylactic use, the therapeutically effective amount of the composition or a pharmaceutically acceptable salt thereof described is administered to a subject before onset (e.g., before overt signs of cancer), during the early stages of onset (e.g., at the first signs and symptoms of cancer), or after established development of cancer. Prophylactic administration can be performed from days to years before the appearance of symptoms. Prophylactic administration can be used, for example, for chemopreventive treatment of subjects presenting with precancerous lesions, in those diagnosed with early stage malignancies, and for subsets having a particular susceptibility to a specific cancer (e.g., family, ethnicity, and / or occupation).

[0219] C. Dosage and Effective Amount Dosage and dosing regimen depend on the severity and location of the disorder or injury, and / or the method of administration, and the particular agent being delivered. This can be determined by one of ordinary skill in the art.

[0220] In some embodiments, the dosage is expressed in mg / kg, particularly when expressed as the in vivo dosage of the dendrimer-gene editing composition.

[0221] Typically, the dosage will range from micrograms / kg to up to about 100 mg / kg body weight. The dosage can be, for example, from 0.01 mg / kg to about 1,000 mg / kg per dose, or 0.5 mg / kg to about 1,000 mg / kg, or 1 mg / kg to about 1,000 mg / kg, or from about 10 mg / kg to about 500 mg / kg, or from about 20 mg / kg to about 500 mg / kg, or from 20 mg / kg to about 100 mg / kg per dose, or from 25 mg / kg to about 75 mg / kg per dose, or about 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, or 75 mg / kg per dose.

[0222] Preferably, the dendrimer-gene editing agent composition does not target or otherwise genetically modify non-target cells or healthy cells that may not be present in or associated with the diseased tissue, or it targets or otherwise genetically modifies at a lower level compared to cells associated with a disease or disorder, such as cancer and / or a proliferative disorder. In this way, the by-products and other side effects associated with the composition are reduced. Thus, in a preferred embodiment, the dendrimer composition is administered in an amount that provides an improvement or enhancement of function in an individual having a disease or disorder, such as cancer and / or a proliferative disorder.

[0223] The actual effective amount of the composition may vary depending on factors including the specific agent being administered, the specific composition being formulated, the mode of administration, and the age, weight, condition of the subject being treated, as well as the route of administration, and the disease or disorder. Generally, for intravenous injection or infusion, the dosage is lower than that for oral administration.

[0224] The dosage may be varied and may be administered daily in single or multiple doses over one day or several days. Guidance can be found in the literature regarding appropriate dosages for a given class of pharmaceuticals. The optimal dosing schedule can be calculated from measurements of drug accumulation in the body of the subject or patient. One of ordinary skill in the art can readily determine the optimal dosage, dosing methodology, and repetition rates. The optimal dosage may vary depending on the relative potency of the individual pharmaceutical composition and can generally be inferred based on the effective dosage amounts in vitro and in vivo in animal models.

[0225] Pharmaceutical compositions comprising the dendrimer composition are also provided. "Dosage form" refers to the physical form of a dose of a therapeutic compound intended for administration to a patient, such as a capsule or vial. The term "dosage unit" refers to the amount of a therapeutic compound administered to a patient in a single dose.

[0226] Generally, the timing and frequency of administration will be adjusted to balance the effectiveness of a given treatment or diagnostic schedule with the side effects of a given delivery system.

[0227] In some embodiments, the dosage is administered at a frequency of once daily, twice weekly, once weekly, every two weeks or less, in an amount that provides a therapeutically effective increase in the blood level of the therapeutic agent. If the administration is by a route other than the oral route, the composition may be delivered over more than 1 hour, for example, over 3 - 10 hours, to produce a therapeutically effective dose within 24 hours. Alternatively, the composition may be formulated for controlled release and the composition is administered as a single dose that is repeated on a regimen of once weekly or less frequently.

[0228] It will be understood by those skilled in the art that the administration regimen can be of any length of time sufficient to treat the disorder in the subject. In some embodiments, the regimen includes one or more cycles of a treatment round followed by a drug holiday (e.g., no drug). The drug holiday may be 1, 2, 3, 4, 5, 6, or 7 days, or 1, 2, 3, 4 weeks, or 1, 2, 3, 4, 5, or 6 months.

[0229] D. Control The therapeutic results of a composition comprising one or more gene editing compositions associated or conjugated with a dendrimer may be compared to a control. Suitable controls are known in the art and include, for example, untreated subjects, or subjects treated with a placebo. A typical control is a comparison of the state or symptoms of a subject before and after administration of a glucose dendrimer composition. The state or symptoms may be biochemical, molecular, physiological, or pathological readout information. For example, the effect of a composition on a particular symptom, pharmacological, or physiological indicator may be compared to that of an untreated subject, or the state of the subject before treatment. In some embodiments, the symptom, pharmacological, or physiological indicator is measured in a subject prior to treatment and again one or more times after the start of treatment. In some embodiments, the control is a reference level or average determined based on the measurement of a symptom, pharmacological, or physiological indicator in one or more subjects (e.g., healthy subjects) not having the disease or condition to be treated. In some embodiments, the effect of treatment is compared to a conventional treatment known in the art. In some embodiments, the untreated control subject has the same disease or condition as the subject to be treated.

[0230] In some embodiments, the control comprises an equivalent amount of a gene editing composition delivered alone or conjugated to a dendrimer without a glucose-based branching unit, e.g., a dendrimer of a similar generation, molecular weight, and / or surface group density (e.g., hydroxyl groups). VI. Kits

[0231] The composition may be packaged as a kit. The kit may include a single or multiple doses of a composition comprising one or more gene editing compositions associated or conjugated with a dendrimer (e.g., one or more of the hydroxyl PAMAM dendrimers or glucose dendrimers described in the examples) and instructions for administering the composition. In particular, the instructions direct that an effective amount of the dendrimer composition be administered to an individual with the specified disease / disorder indicated. The composition may be formulated as described above with reference to a particular method of treatment and packaged in any convenient manner.

[0232] The present invention will be further understood by reference to the following non-limiting examples.

Example

[0233] (Example 1) Synthesis of Glucose G1 and G2 Dendrimers Figure 1 is a schematic diagram showing the stepwise synthesis of the first-generation (G1) glucose dendrimer. Figure 2 is a schematic diagram showing the stepwise synthesis of the second-generation (G2) glucose dendrimer using a highly efficient click chemistry approach.

[0234] The GD synthesis was initiated by reacting a hexapropargylated core with an AB4,β-D-glucose-PEG4-azide construct via a click reaction to obtain the first-generation glucose dendrimer (GD1) of Figure 2. The OH groups on GD1 were propargylated to obtain GD1-acetylene 24, which was reacted with β-D-glucose-PEG4-azide to obtain the second generation (GD2) having 24 glucose moieties providing 96 surface hydroxyl groups. The Cy5 fluorescent tag was attached onto GD2 by propargylation of approximately 2 to 3 hydroxyl groups to generate an alkyne-containing GD2 dendrimer. The GD intermediates and final products were purified using dialysis and characterized using 1H NMR.

[0235] The physicochemical properties of the GD2 dendrimer were also evaluated as shown in Table 1 below.

[0236] For the stepwise synthesis of G1-glucose, the hexapropagylated core 1 was treated with the AB4 building block (β-glucose-PEG4-azide), 2, under classical click reagents (CuAAC click reaction) in DMF:H2O (1:1), catalytic amounts of copper sulfate pentahydrate (CuSO4·5H2O) and sodium ascorbate to yield G1-glucose-24-OAc, 3. Compound 3 was then treated under typical Zemplen conditions (to remove the acetate group) to afford the desired product 4 (G1-glucose). The G1 glucose dendrimer has 6 surface glucose units (i.e., 24 surface hydroxyl groups) as shown in Figure 1.

[0237] In some embodiments, the first generation dendrimer D1-acetylene 24 further reacts with AB4 β-D-glucose-PEG4-azide to provide a second generation dendrimer having 24 glucose molecules containing 96 surface hydroxyl groups.

[0238] For the stepwise synthesis of G2-glucose, the G1-glucose dendrimer, 4, was treated with sodium hydride (60% dispersion in mineral oil) at 0 °C for 15 minutes and then with propargyl bromide (80% w / w solution in toluene). The reaction was stirred at room temperature for 8 hours to form compound 5. Compound 5 was then treated with the AB4 building block (β-glucose-PEG4-azide), 2, under classical click reagents (CuAAC click reaction) in DMF:H2O (1:1), catalytic amounts of copper sulfate pentahydrate (CuSO4·5H2O) and sodium ascorbate to yield G2-glucose-96-OAc, 6. Compound 6 was then reacted under typical Zemplen conditions to afford the desired product 7 (G2-glucose).

Table 1

[0239] (Example 2) Synthesis of Second Generation Glucose Dendrimer-Based CRISPR-Cas9-Ribonucleoprotein GD2 Cas9 conjugation was performed using a strain-promoted click chemistry strategy using trans-cyclooctene-tetrazine (TCO-Tz) chemistry under mild catalyst-free conditions. Cas9-2NLS was functionalized with terminal tetrazine (Tz), while GD2 was functionalized with trans-cyclooctene (TCO).

[0240] G2 dendrimer D2-Glu 24 -OH 96 is propargylated with one or more terminal hydroxyl groups suitable for further conjugation to one or more molecules such as Cas9 nuclease. The G2-glucose dendrimer was treated with sodium hydride (60% dispersion in mineral oil) at 0 °C and treated with propargyl bromide at 0 °C and RT for 8 hours to form compound 8. The resulting product 8 was reacted with azide-PEG2-amine (9) to form product 10. Product 10 was labeled with a Cy5 fluorophore, and the resulting intermediate 11 was conjugated with pegylated trans-cyclooctene (TCO) to obtain functionalized Cy5-D-PEG4-TCO (13).

[0241] The success of the synthesis of GD2-Cas9(2NLS)17 was confirmed by MALDI-TOF, and the molecular weight was 183413 Da for Cy5-GD2-Cas9, which was in good agreement with the theoretical molecular weight of 172800 Da for D-Cas9.

[0242] Materials and Methods Biomolecules, Chemicals, and Reagents Reactions were carried out in flame-dried glass vessels under positive Ar or N2 pressure using dry solvents. Commercially available grade reagents and anhydrous solvents were purchased from chemical supply companies and used without further purification.

[0243] 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC.HCl), N,N-diisopropylethylamine (DIPEA), 4-(dimethylamino)pyridine (DMAP), trifluoroacetic acid (TFA), γ-(Boc-amino)butyric acid (Boc-GABA-OH), anhydrous dichloromethane (DCM), N,N’-dimethylformamide (DMF) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Cyanine 5 (Cy5)-mono-NHS ester was purchased from Amersham Bioscience - GE Healthcare. Cyanine 3 (Cy3) trans-cyclooctene (TCO) was purchased from AAT bioquest, Inc. Deuterated solvents dimethyl sulfoxide (DMSO-d6), water (D2O), and chloroform (CDCl3) were purchased from Cambridge Isotope Laboratories Inc. (Andover, MA). Dialysis membranes were purchased from Spectrum Laboratories Inc. (Rancho Dominguez, CA, USA). Cas9 nuclease 2NLS, S. Pyrogenes, and all primers were purchased from SYNTHEGO Corporation (Redwood City, CA). Equipment

[0244] Proton nuclear magnetic resonance( 1 H NMR) spectra were recorded at ambient temperature on a Bruker 500 MHz spectrometer and analyzed using software. 1 H NMR chemical shifts were reported as δ using residual solvents (DMSO-d6, 2.50) and (D2O, 4.79 ppm) as internal standards.

[0245] High-performance liquid chromatography (HPLC) for analysis was performed using a Shimadzu LC-AD HPLC system equipped with a variable wavelength absorbance detector and a C18 reverse-phase column (Waters, BEH300 5 μm, 19 × 250 mm). The eluent was monitored at 210 nm using a photodiode array (PDA) detector, and the fluorescently labeled conjugate was monitored at both 650 nm and 210 nm using fluorescence and PDI detectors, respectively. HPLC elution was performed with a linear gradient of 0% to 90% HPLC-grade acetonitrile (CH3CN) in water (containing 0.1% TFA) over 40 minutes, maintaining a flow rate of 1.0 mL / min.

[0246] Ultrafiltration and SEC chromatography Removal of excess reagents and by-products after each step of synthesis and buffer exchange was performed by ultrafiltration using a 0.5 mL Amicon filtration unit equipped with an MWCO of 30 kDa or 100 kDa. The product and intermediate were further purified by size exclusion column (SEC) chromatography using PBS as the mobile phase.

[0247] Sample preparation and MALDI-TOF analysis Cas9 protein: The Cas9 protein was desalted prior to MALDI analysis. A fresh MALDI matrix, 3,5-dimethoxy-4-hydroxycinnamic acid (sinapinic acid) (10 mg / mL acetonitrile:water (1:1) containing 0.1% trifluoroacetic acid), was prepared. The Cas9 protein (2 μL) was deposited onto a MALDI sample plate, and then the matrix (2 μL) was deposited onto the air-dried sample and air-dried for 10 - 20 minutes. MALDI-TOF MS analysis was performed on a Voyager DE-STR MALDI-TOF operating in linear positive ion mode.

[0248] Dynamic light scattering (DLS) The particle sizes of the dendrimer and the Cas9 conjugate were determined by dynamic light scattering (DLS) using a Zetasizer Nano ZS (Malvern instrument Ltd. Worchester, U.K.) equipped with a 50 mW He-Ne laser (633 nm). The conjugate was dissolved in deionized water (18.2 Ω) to a solution with a final concentration of 0.2 mg / mL. The solution was filtered through a cellulose acetate membrane (0.45 m, PALL Life Science), and the DLS measurement was repeated three times at 25 °C and a scattering angle of 173°.

[0249] The G2 glucose dendrimer was prepared as in Example 1. Figures 3A - 3C are schematic diagrams showing the stepwise synthesis of G2-glucose-PEG4-TCO (3A) and the chemical structures of the intermediate TCO-PEG4-NHS ester (3B) and Cy5 (3C) used in the synthesis shown in Example 4. The subscript numbers in the formula indicate the number of bonds for each dendrimer.

[0250] Figure 3 is a schematic diagram showing the Me-Tz-linked Cas9 nuclease 2NLS (S.pyogenes) and the TCO-linked glucose dendrimer that react under physiological conditions to form the Cy5-D-Cas9(2NLS) conjugate. Figure 3 is a schematic diagram showing the click chemistry strategy using trans-cyclooctene-tetrazine (TCO-Tz) chemistry used in the preparation of the Cy5-D-Cas9(2NLS) conjugate.

[0251] To enable delivery to damaged neurons and reactive glia, constructs of glucose dendrimer-Cas9 conjugates complexed with appropriate guide RNAs were prepared. Conjugates of dendrimers made from glucose and ethylene glycol building blocks containing multiple glucose moieties on the surface are useful for targeted neuronal delivery of CRISPR-Cas9 ribonucleoproteins.

[0252] Figure 3 is a schematic diagram showing the stepwise synthesis of G2-glucose-PEG4-TCO and synthetic intermediates. The G2-glucose dendrimer was treated with sodium hydride (60% dispersion in mineral oil) at 0 °C, and propargyl bromide was added at 0 °C and RT for 8 hours to form compound 8. The resulting product 8 was reacted with azido-PEG2-amine (9) to form product 10. Product 10 was labeled with the Cy5 fluorophore, and the resulting intermediate 11 was conjugated with pegylated trans-cyclooctene (TCO) to obtain functionalized Cy5-D-PEG4-TCO 13.

[0253] Figure 4 is a schematic diagram showing the stepwise synthesis of Cy5-G2-glucose-Cas9(2NLS). The synthetic scheme showing Me-Tz-linked Cas9 nuclease 2NLS (S. pyogenes) 16 and TCO-linked G2-glucose dendrimer 13 was reacted under a highly specific inverse Diels-Alder click reaction (IEDDA) to form the Cy5-G2-glucose-Cas9(2NLS) conjugate 17.

[0254] Results The GD2 Cas9 conjugation was successfully performed using a strain-promoted click chemistry strategy using trans-cyclooctene-tetrazine (TCO-Tz) chemistry under mild catalyst-free conditions. Cas9-2NLS was functionalized with terminal tetrazine (Tz), and simultaneously GD2 was functionalized with trans-cyclooctene (TCO) as described above for the PAMAM hydroxyl dendrimer. Furthermore, the success of the synthesis of GD2-Cas9(2NLS) and the molecular weight of the conjugate were determined by MALDI-TOF to be 183,413 Da. The peak of 183413 Da for Cy5-GD2-Cas9 almost coincides with the theoretical molecular weight of 172800 Da for D-Cas9 (Figure 5).

[0255] The second-generation glucose dendrimer (GD2) is formed from 24 glucose molecules (96 surface hydroxyl groups) used for Cas9 conjugation. Glucose dendrimers are mainly made from a central core of di-pentaerytol and a glucose moiety containing one or more branched units of the monosaccharide glucose molecule. Unlike hydroxyl PAMAM dendrimers, glucose dendrimers are mainly taken up by damaged neurons and are observed to specifically target hyperexcitable neurons in both cultured and in vivo mouse models.

[0256] Figure 5 is the MALDI-TOF of Cy5-GD2-Cas9 in Figure 4 to confirm the synthesis of the conjugate.

[0257] (Example 3) Synthesis of Hydroxyl PAMAM Dendrimer-Based CRISPR-Cas9 Ribonucleoprotein Materials and Methods Biomolecules, Chemicals, and Reagents The reaction was carried out in a glass vessel that was flame-dried under positive Ar or N2 gas pressure using a dry solvent. Commercially available grade reagents and anhydrous solvents were purchased from chemical supply companies and used without further purification. Ethylenediamine core polyamidoamine (PAMAM) dendrimer, generation 6.0, hydroxy surface (G6-OH; diagnostic grade; consisting of 256 hydroxyl end groups), methanol solution (13.75% w / w) was purchased from Dendritech Inc. (Midland, MI, USA). D6-OH in methanol was dried under reduced pressure, then dissolved in water and lyophilized for further conjugation. 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC·HCl), N,N-diisopropylethylamine (DIPEA), 4-(dimethylamino)pyridine (DMAP), trifluoroacetic acid (TFA), γ-(Boc-amino)butyric acid (Boc-GABA-OH), anhydrous dichloromethane (DCM), N,N'-dimethylformamide (DMF) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Cyanine 5 (Cy5)-mono-NHS ester was purchased from Amersham Bioscience - GE Healthcare. Cyanine 3 (Cy3) trans-cyclooctene (TCO) was purchased from AAT bioquest, Inc. Deuterated solvents dimethyl sulfoxide (DMSO-d6), water (D2O), and chloroform (CDCl3) were purchased from Cambridge Isotope Laboratories Inc. (Andover, MA). Dialysis membranes were purchased from Spectrum Laboratories Inc. (Rancho Dominguez, CA, USA). Cas9 nuclease 2NLS, S. Pyrogenes, and all primers were purchased from SYNTHEGO Corporation (Redwood City, CA).

[0258] Equipment Proton nuclear magnetic resonance (1H NMR) spectra were recorded at ambient temperature on a Bruker 500 MHz spectrometer and analyzed using software.1 1H NMR chemical shifts are reported as δ using residual solvents (DMSO-d6, 2.50) and (D2O, 4.79 ppm) as internal standards.

[0259] Analytical high-performance liquid chromatography (HPLC) was performed using a Shimadzu LC-AD HPLC system equipped with a variable wavelength absorbance detector and a C18 reverse-phase column (Waters, BEH300 5 μm, 19×250 mm). The eluent was monitored at 210 nm using a photodiode array (PDA) detector, and the fluorescently labeled conjugate was monitored at both 650 nm and 210 nm using fluorescence and PDI detectors, respectively. HPLC elution was performed with a linear gradient of 0%–90% HPLC grade acetonitrile (CH3CN) in water (containing 0.1% TFA) over 40 min, maintaining a flow rate of 1.0 mL / min.

[0260] Synthesis of the compounds shown in Figures 6 and 7 Synthesis of D-GABABoc, 3 A solution of PAMAM G6-OH1 (1.00 g, 0.017 mmol) in DMF (12 mL) was treated with Boc-GABA-OH (0.069 g, 0.34 mmol), DMAP (0.0782 g, 0.408 mmol) and stirred at room temperature for 5 min. Then EDC.HCI (0.046 g, 0.374 mmol) was added portionwise to the reaction mixture over 5 min. The reaction mixture was stirred at room temperature for 36 h. The crude product was transferred to a 3 kD MW cut-off cellulose dialysis tube and dialyzed against DMF for 12 h followed by water for 24 h. The aqueous layer was frozen and lyophilized to give the desired product 3 as a hygroscopic white solid (0.973 g, 95%). 1HNMR (500 MHz, DMSO-d6) δ 8.10 - 7.70 (m, internal amide H), 6.60 (s, GABA amide H, 10H), 4.74 (s, surface OH, 213H), 3.99 (s, ester-linked H, 22H), 3.39 (t, J = 5.0 Hz, dendrimer-CH2), 3.40 - 3.35 (m, dendrimer CH2), 3.11 (m, dendrimer-CH2), 2.89 (m, dendrimer CH2), 2.73 - 2.65 (m, dendrimer CH2), 2.45 (m, dendrimer-CH2), 2.21 (m, dendrimer CH2), 1.64 - 1.59 (m, GABA linker-CH2, 25H), 1.36 (s, Boc group, 85H). HPLC C 18 Retention time 19 minutes.

[0261] Synthesis of D-GABA-NH2, 4 The Boc-protected GABA linker containing PAMAM G6-OH3 (250 mg, 0.004 mmol) was treated with a TFA / DCM (3:4) solvent mixture. The reaction was stirred at room temperature for 12 hours, then diluted with MeOH and concentrated in vacuo (this step is necessary to remove excess TFA and hydrolytically cleave the GABA linker). The crude product was used without any further purification in the next step. 1 1H NMR (500 MHz, DMSO-d6) δ 8.50 - 7.75 (m, internal amide H), 5.50 - 4.50 (broad s, surface-OH), 4.00 (s, ester-linked H), 3.50 - 2.25 (m, dendrimer-CH2), 1.93 - 1.59 (m, GABA linker-CH2).

[0262] Synthesis of Cy5-D, 5 A solution of compound 4 (287 mg, 0.0048 mmol) in DMF (5 mL) was treated with DIPEA to adjust the pH of the reaction mixture (about 7.0 - 7.5). The reaction was then treated with Cy5-NHS ester (8.7 mg, 0.0115 mmol, 1.2 eq) and stirred at room temperature for 12 h. It was then dialyzed against DMF for 12 h and subsequently against water for 24 h. The aqueous layer was frozen and lyophilized to give the desired product 5 as a blue solid (85% yield). 1 H NMR (500 MHz, DMSO-d6) δ 8.25 - 7.75 (m, internal amide H), 7.30 (s, Cy5 H), 7.10 (s Cy5 H), 6.70 (s, GABA amide H), 6.50 (m Cy5 H), 6.25 (m Cy5 H), 4.75 (s, surface OH, 226H), 4.00 (m, ester CH2), 3.50 - 2.00 (m, dendrimer CH2), 1.64 - 1.59 (s, 31H), 1.25 (s, 66H), 0.8 (s, 21H). HPLC C18 retention time (MeCN in water containing 0.1% TFA, linear gradient, 40 min). HPLC C18 retention time: 17.5 min.

[0263] Synthesis of Cy5-D-PEG4-TCO, 6 A solution of compound 5 (48 mg, 0.0008 mmol) in DMF (5 mL) was treated with DIPEA to adjust the pH of the reaction mixture (about 7.0 - 7.5). The reaction was treated with TCO-PEG4-NHS ester (4 mg, 0.0080 mmol) and the reaction mixture was stirred at room temperature for 12 h. It was then dialyzed against DMF for 12 h and subsequently against water for 24 h. The aqueous layer was frozen and lyophilized to give the desired product as a blue solid (55% yield).

[0264] 11H NMR (500 MHz, DMSO-d6) δ 8.14 - 7.73 (m, internal amide H), 7.35 (m, Cy5 H), 7.25 (m, Cy5 H), 7.05 (m, Cy5 H), 6.6 (m, Cy5 H), 6.3 (m, Cy5 H), 6.83 (s, GABA amide H), 5.65 - 5.50 (m, TCO H), 5.45 - 5.35 (m, TCO H), (4.74 (s, surface OH, H), 4.01 - 3.39 (t, J = 5.0 Hz, ester-CH2), 3.50 - 2.00 (m, dendrimer CH2), 1.9 (s, 24H), 1.6 (s, 80H), 1.2 (s, 126H), 0.8 (s, 80H). HPLC C18 retention time: 19.5 min.

[0265] Ultrafiltration and SEC chromatography Removal of excess reagents and by-products after each step of synthesis and buffer exchange was carried out by ultrafiltration using a 0.5 mL Amicon filtration unit equipped with an MWCO of 30 kDa or 100 kDa. The products and intermediates were further purified by size exclusion column (SEC) chromatography using PBS as the mobile phase.

[0266] Sample preparation and MALDI-TOF analysis PAMAM Dendrimer Conjugate: All MALDI samples were desalted prior to MALDI analysis. The MALDI matrix 2'-4'-6'-trihydroxyacetophenone monohydrate (THAP) (10 mg) was dissolved in 1 mL of acetonitrile: water (1:1) in water containing 0.1% trifluoroacetic acid. Next, 2 μL of the PAMAM dendrimer was deposited on the MALDI sample plate. The matrix (10 mg / mL, 2 μL) was deposited on the air-dried sample and air-dried for 10 - 20 minutes. MALDI-TOF MS analysis was performed in the reflectron positive mode. MALDI-TOF MS analysis was performed on a Bruker Voyager DE-STR MALDI-TOF (Mass Spectrometric and Proteomics core, Johns Hopkins University, School of Medicine) operating in the linear positive ion mode.

[0267] Cas9 Protein: The Cas9 protein was desalted prior to MALDI analysis. A fresh MALDI matrix, 3,5-dimethoxy-4-hydroxycinnamic acid (sinapic acid) (10 mg / mL in acetonitrile: water (1:1) containing 0.1% trifluoroacetic acid), was prepared. The Cas9 protein (2 μL) was deposited on the MALDI sample plate, and then the matrix (2 μL) was deposited on the air-dried sample and air-dried for 10 - 20 minutes. MALDI-TOF MS analysis was performed on a Voyager DE-STR MALDI-TOF operating in the linear positive ion mode.

[0268] Dynamic Light Scattering (DLS) The particle sizes of the dendrimer and the Cas9 conjugate were determined by dynamic light scattering (DLS) using a Zetasizer Nano ZS (Malvern instrument Ltd. Worchester, U.K.) equipped with a 50 mW He-Ne laser (633 nm). The conjugate was dissolved in deionized water (18.2 Ω) to a solution with a final concentration of 0.2 mg / mL. The solution was filtered through a cellulose acetate membrane (0.45 μm, PALL Life Science), and the DLS measurement was repeated three times at 25 °C and a scattering angle of 173°.

[0269] Results Synthesis and Characterization of Cy5-D-PEG4-TCO The Cy5-D-PEG4-TCO conjugate was synthesized using a PAMAM-G6-OH (D6-OH, 256 free hydroxyl groups) dendrimer (Example 3). D6-OH (13.75% w / w) in methanol was dried under reduced pressure, then dissolved in water and lyophilized for further conjugation. The lyophilized monofunctionalized D6-OH was treated with N-(3-dimethylaminopropyl)-N’-ethylcarbodiimide hydrochloride (EDC.HCl) and 4-(dimethylamino)pyridine (4-DMAP) in DMF at room temperature for 36 hours with 4-tert-butoxycarbonylamino)butyric acid (Boc-GABA-OH) to functionalize it with a Boc-protected amine, obtaining a Boc-protected bifunctional dendrimer product. The crude dendrimer was dialyzed against ultrapure water through a 3.5 kDa membrane for 24 hours and then lyophilized. 1By \(^1\)H NMR, the appearance of the tert-butyl proton of the Boc group at δ 1.3 ppm as a singlet and the methylene proton of GABA at δ 1.6 ppm were shown. The peak at δ 3.9 ppm was related to the methylene proton of the dendrimer adjacent to the hydroxyl group once converted to an ester, and the amide proton from the GABA linker also appeared at δ 6.8 ppm. Subsequently, the Boc group was deprotected under weakly acidic conditions using trifluoroacetic acid (TFA) (1:4) in dichloromethane (DCM) to obtain a bifunctional dendrimer. The excess TFA was removed by co-evaporation with methanol, and the next step was carried out using the obtained crude product without further purification. The complete disappearance of the Boc proton was 1 confirmed by \(^1\)H NMR, and at the same time, ester hydrolysis was not observed under these conditions. The total number of amine groups was maintained at about 10. Then the bifunctional dendrimer was treated with the fluorescent dye Cy5 to obtain dendrimer 4 in which about 1 - 2 Cy5 bonds were successfully formed on the dendrimer surface. The \(^1\)H NMR (DMSO-d6, 500 MHz) characterizations of the dendrimer conjugates, D-GABA-Boc, D-GABA-NH2, Cy5-D, Cy5-D-PEG4-TCO (in DMSO-d6) 1 showed the appearance of the Cy5 signal in the aromatic region, and the HPLC retention time shifted from 19.0 to 17.5 minutes, confirming the formation of the product. After Cy5 binding, the remaining amine groups were reacted with a heterobifunctional (NHS-PEG4-TCO) linker containing trans-cyclooctene. This heterobifunctional linker was used to form a chemical bond between the dendrimer and Cas9. The degree of conjugation at each step of the synthesis was calculated based on the change in the molecular weight measured by \(^1\)H-NMR and MALDI-TOF.

[0270] Dendrimer Cas9 conjugation was performed using a strain-promoted click chemistry strategy using trans-cyclooctene-tetrazine (TCO-Tz) chemistry under mild catalyst-free conditions (Kim, E. & Koo, H. Chem Sci 10, 7835-7851, (2019)). Cas9-2NLS was functionalized with terminal tetrazine (Tz), and simultaneously D6-OH was functionalized with trans-cyclooctene (TCO) for the click reaction. First, Cas9 nuclease 2NLS (S.pyogenes) (1000 picomoles at 20 μM in 50 μL) was treated with hetero-bifunctional PEGylated methyl-S-S-tetrazine (Me-Tz-PEG4-S-S-NHS) (10 molar equivalents in 10-20 μL of anhydrous DMSO) and incubated for 1 hour. Excess Me-Tz-PEG4-S-S-NHS and by-products were removed by ultrafiltration. The number of Tz groups bound per Cas9 was determined using MALDI-TOF spectroscopy based on the change in molecular weight corresponding to the total molecular weight. PEGylated trans-cyclooctene (PEG4-TCO)-linked dendrimer 6 (61 μg, in 200 μL PBS) was reacted with 8 via a TCO-Tz click reaction to obtain crude product 9. The resulting crude product was purified by ultrafiltration. The "click chemistry reaction" used between 1,2,4,5-tetrazine (Tz) and trans-cyclooctenenes (TCO) proceeds via an inverse electron demand Diels-Alder reaction (IEDDA) and subsequently proceeds under mild physiological conditions to form a dihydropyridazine bond. Chemoselective TCO-Tz ligation has an ultra-fast kinetics (>800 M -1 s -1 ). The click ligation was carried out at neutral pH, aqueous conditions, and room temperature. Due to its ultra-fast kinetics, selectivity, and long-term aqueous stability, TCO-Tz is an ideal pair for low-concentration dendrimer-Cas9 coupling reactions. Chemically synthesized D-Cas9(2NLS) was further purified on a GE Healthcare Sephadex G-25 column and concentrated by ultrafiltration.

[0271] Furthermore, the successful synthesis of D-Cas9(2NLS) was confirmed by gel electrophoresis. The molecular weight was determined by MALDI-TOF. The PAMAM G6 dendrimer showed a peak at 57859 Da, Cas9 showed peaks at 162884 Da (molecular ion peak), 81193 Da (M2 + ) and 54238 Da (M3 + ), and D-Cas9 showed a peak at 213099 Da (molecular ion peak). The peak at 213099 Da for D-Cas9 was almost identical to the theoretical molecular weight of 225000 for D-Cas9. The change in size before and after modification was determined by DLS measurement. The hydrodynamic diameter of PAMAM-G6-OH was 4.6 ± 1.2 nm, Cas9 was 9.5 ± 1.1 nm, and D-Cas9 was 13.2 ± 1.6 nm. The concentration of Cas9 in the Cas9 protein and the D-Cas9 construct was determined from the absorbance at 280 nm using a NanoDrop 2000 (Thermofisher Scientific). All other intermediates were 1 characterized using 1H NMR, MALDI-TOF, and HPLC.

[0272] (Example 4) In vitro tests of conjugates related to gene editing Materials and methods Cell line The GFPd2-expressing human embryonic kidney 293T (HEK293T) cell line was generously provided by Green Lab (Institute for NanoBio Technology, and Translational Tissue Engineering Center, Johns Hopkins University). The cells were cultured in Dulbecco's Modified Eagle Medium (DMEM, ATCC, Manassas, VA) supplemented with 10% (v / v) heat-inactivated fetal bovine serum (FBS, Invitrogen Corp., Carlsbad, CA) and 1% penicillin / streptomycin (P / S, Invitrogen Corp., Carlsbad, CA). The cell medium was replaced with Opti-MEM (Thermo Scientific, Rockford, IL) for transfection studies. The cells were maintained at 37°C and 5% CO2 in a humidified atmosphere.

[0273] The ARPE-19 cells, an immortalized human retinal pigment epithelial cell line, were also used for this study. The cells were cultured in Dulbecco's Modified Eagle Medium (DMEM, ATCC, Manassas, VA) supplemented with 10% (v / v) heat-inactivated fetal bovine serum (FBS, Invitrogen Corp., Carlsbad, CA) and 1% penicillin / streptomycin (P / S, Invitrogen Corp., Carlsbad, CA). The cells were maintained at 37°C and 5% CO2 in a humidified atmosphere.

[0274] Methods Study of time-dependent Cy5-D-Cas9 uptake GFP-expressing HEK-293T cells were seeded in glass-bottom culture dishes and grown for 24 - 48 hours to 70 - 80% confluence. The cells were treated with Cy5 fluorescently labeled dendrimer (Cy5-D) and Cas9 conjugate Cy5-labeled dendrimer (Cy5-D-Cas9, 9) or Cy5-D-EGFP in DMEM supplemented with 1% P / S (serum-free medium). The cells were then washed with PBS (×3) and fixed in 5% formalin solution. The cells were incubated and confocal microscope images were taken by a Zeiss Axiovert 200 system equipped with an LSM 510-Meta confocal module. The image acquisition parameters were maintained constant during imaging. The images were processed by Zen 2011 software (Zeiss). Z-stack images were analyzed using Zen software and 3D surface rendering was performed using Imaris version 8.1 software (Bitplane USA, Concord, MA, USA).

[0275] Image analysis Live cell images were taken at the time points set with a Zeiss Axiovert 200 phase contrast microscope (Carl Zeiss). The threshold for the images was automated by the Triangle method incorporated in ImageJ.

[0276] D-Cas9 / sgRNA, Cas9 / sgRNA RNP preparation As shown in Table 2, different amounts of D-Cas9-2NLS / Cas9-2NLS conjugate were mixed with sgRNA in PBS buffer, mixed at room temperature, and incubated at 4°C for 24 hours to form RNP complexes.

Table 2

[0277] Lipofection. Lipofectamine transfection with Cas9 was performed according to the manufacturer's protocol. 10 μg of Cas9, 5 μg of sgRNA, and 3 μL of Lipofectamine 2000 were used in a total volume of 100 μL. Lipofection was carried out in Opti-MEM medium without serum, and an equal volume of growth medium was added to the cells 1 hour after lipofection to minimize cytotoxicity.

[0278] HEK293T cell transfection Cells were seeded in 12-well tissue culture plates at a density of (0.84 - 2.5)×10 5 cells per well and grown for 12 - 24 hours. Before treatment, the cell culture medium was replaced with Opti-MEM low-serum medium.

[0279] D-Cas9 / sgRNA genome editing efficiency study HEK293T GFP reporter cells were cultured in DMEM containing 10% PBS and 1% penicillin / streptomycin at 37 °C / 5% CO2. For flow cytometry experiments, cells were seeded in 12-well plates at a cell density of 5×10 5 cells per well and incubated overnight. The medium was replenished with 500 μL of fresh medium, and 100 μL of RNP was added. D-Cas9 RNP was prepared by mixing D-Cas9-2NLS and sgRNA at a molar ratio of 1:10 24 hours before treatment. The sgRNA had the following sequences. sgRNA for GFP 5’-GCACGGGCAGCTTGCCGG-3’ (SEQ ID NO: 1) sgRNA for VEGFA sgRNA-1 5’C * G * G * GGAGGAGGUGGUAGCUG 3’ (SEQ ID NO: 2) sgRNA-2 5’G * C * C * GCCGGCCGGGGAGGAGG3’ (SEQ ID NO: 3)

[0280] As a control study, cells were treated with Lipofectamine 2000 (3 μL / well, in 12-well plates) complexed with Cas9-2NLS. Untreated GFP-expressing HEK293 cells were used as the control group. Three days after treatment, cells were collected using 0.25% trypsin-EDTA, spun down, resuspended in buffer, and fixed with 4% PFA (for 10 minutes at room temperature). After fixing the cells, the cells were spun down and resuspended in 200 μL of PBS containing 2% FBS. For the VEGF sgRNA study, cells were incubated overnight at 4 °C with a VEGF (Alexa 488) monoclonal antibody. The cell population was analyzed for genome editing efficiency and quantified via a Sony SH800 cell sorter for markers against GFP and VEGFA. Data were analyzed using FlowJo v10.

[0281] Cytotoxicity of D-Cas9 / sgRNA RNP and Cas9 / sgRNA RNP in HEK293 cells Cytotoxicity and cell viability were assayed by treating HEK293T GFP-expressing cells in 96-well plates with different formulations of the RNP construct. Cells were seeded in 96-well plates (15,000 cells / well) and incubated for 24 hours until 40 - 50% confluency. Cells were treated with different concentrations of RNP. Twenty-four hours after incubation, cell viability / cytotoxicity was determined using a WST-8 assay (Dojindo Molecular Technologies) according to the manufacturer's protocol. Cells were replenished with 100 μL of fresh medium and treated with 10 μL of WST-8 reagent. The cells were then incubated at 37 °C for 3 hours, and absorbance was measured at 450 nm. During incubation, the WST-8 tetrazolium salt is reduced by dehydrogenase in live cells to form a yellow formazan dye that shows absorbance at 450 nm. The concentration of the formazan dye is directly proportional to the density of viable cells. Relative cell viability was defined as the percentage of viability compared to the untreated control.

[0282] PCR Amplification of Genomic DNA DNA from GFP-expressing HEK293 cells in the control (without D-Cas9 / sgRNA RNP) or D-Cas9 / sgRNA RNP-treated cells was amplified using primers designed to amplify only the gene-edited sequences. PCR was performed according to the manufacturer's protocol using a forward primer (Forward primer - CTGGTCGAGCTGGACGGCGACG (SEQ ID NO: 5)) and a reverse primer (Reverse primer - CACGAACTCCAGCAGGACCATG (SEQ ID NO: 6)). The PCR products were analyzed on a 1% (wt / vol) TBE agarose gel cast with SYBR safe (Thermo Fisher). Band intensities were measured using ImageJ (available on the World Wide Web at : / / imagej.nih.gov / ij / ; National Institute of Health, Bethesda, MD, USA), and the percentage of indel formation was calculated using the following formula: % Indel = 100 - [1 - [1 - fCut]] 1 / 2 | (where cut (fCleaved) is the total relative density of the cleaved bands divided by the sum of the relative densities of the cleaved and uncleaved bands, as previously described (Guschin, D. Y. et al., Methods Mol Biol 649, 247 - 256, (2010)).

[0283] Results Chemically synthesized Cy5-D-Cas9(2NLS) and gRNAs transcribed in vitro against GFP (DNA target sequence 5’GGAGCGCACCATCTTCTTCA 3’; (SEQ ID NO: 4)), gRNA against VEGFA (target sequence 5’C * G * G * GGAGGAGGUGGUAGCUG 3’; (SEQ ID NO: 2), and 5’G * C * C *GCCGGCCGGGGAGGAGG 3’ (SEQ ID NO: 3) was co-cultured with Cy5-D-Cas9(2NLS) or Cas9(2NLS) in an appropriate buffer to prepare an RNP complex (Table 2). RNA was resuspended or diluted using nuclease-free water to prevent degradation. Pre-assembly of protein and RNA components is important to avoid premature degradation of off-target effects.

[0284] Efficient delivery and subcellular localization of the D-Cas9 / sgRNA RNP cargo were studied by confocal microscopy. Human embryonic kidney (HEK)-293T cells were transfected with Cy5-D-Cas9-EGFP (without nuclear localization sequence) specially synthesized to evaluate the fate of the RNP in the cytosolic compartment of the cells. After 24 hours of incubation, most of the dendrimer Cy5 signal (red fluorescence) overlapped with the Cas9-EGFP signal (green fluorescence). At 24 hours, it was also observed that the lysosomes (magenta fluorescence) overlapped. However, after 48 hours of incubation, it was clear that the endosomes / lysosomes did not overlap with either the red or green fluorescence. This indicated that the RNP had escaped from the endosomes / lysosomes.

[0285] Cy5-D-Cas9(2NLS)-treated cells were also evaluated for the subcellular localization of Cas9. Live GFP-expressing HEK293 cells were imaged at different time points (24 hours and 36 hours) using a confocal microscope. Cy5-D-Cas9(2NLS) was successfully internalized into the cytosol, and a significant proportion of Cy5-D-Cas9(2NLS) migrated to the nucleus for genome editing. After 36 hours of incubation, most of the dendrimer Cy5 signal (red fluorescence) overlapped with the nucleus (blue fluorescence). The nuclear entry of Cy5-D-Cas9(2NLS) was facilitated by the nuclear localization signal (NLS) fused to the recombinant Cas9 protein. In the cytosol, Cy5-D-Cas9(2NLS) undergoes glutathione-mediated disulfide reduction to release the Cas9(2NLS) cargo into the cytosol, which then migrates to the nucleus. Once the dendrimer Cas9 conjugate was efficiently delivered into the cytosol or Cy5-D-Cas9(2NLS), the conjugate directly invaded the nucleus through the nuclear pore complex.

[0286] The delivery and genome editing of D-Cas9 RNP were also evaluated. Here, different ratios of Cy5-D-Cas9(2NLS) conjugate and different ratios of gene-targeting guide RNA (sgRNA) in PBS were incubated at 4 °C for 24 hours to form RNP for the optimal stoichiometry for efficient cell transfection (Table 1). PBS was used as a buffer to form an RNP formulation with improved protein stability compared to standard acidic buffers. The chemical conjugation of the dendrimer to the Cas9 protein does not interfere with the intrinsic charge of the Cas9 protein or the interaction between Cas9 and sgRNA.

[0287] Figure 9 is a schematic diagram showing the pathway of nuclear entry of Cy5-D-Cas9(2NLS). Once the dendrimer Cas9 conjugate is efficiently delivered into the cytosol, Cy5-D-Cas9-2NLS undergoes reduction by intracellular glutathione to release the Cas9(2NLS) cargo, and finally Cas9(2NLS) localizes in the nucleus or the Cy5-D-Cas9(2NLS) conjugate is delivered into the nucleus through the nuclear pore complex.

[0288] Genome editing of the GFP gene by D-Cas9 / Lipo Cas9 (RNP). The in vitro efficiency of the D-Cas9 / sgRNA RNP system for genome editing was evaluated in HEK293T cells. Different D-Cas9 / Lipo-Cas9 RNP formulations used for the study are listed in Table 3.

Table 3

[0289] Loss of GFP fluorescence was measured 3 days after transfection via flow cytometry to assay the editing efficiency. Success of gene editing results in loss of green fluorescence that can be detected by flow cytometry. A dendrimer-based delivery platform was compared with Lipofectamine 2000 (Lipo), a commercially available lipofectamine-based delivery vehicle.

[0290] The results are shown in FIGS. 10A to 10D. The optimal RNP formulation is Entry 1. FIGS. 10A and 10B are bar graphs showing the % of GFP-positive cells in D-Cas9 / sgRNA and Lipo Cas9 / sgRNA RNP-treated cells compared to HEK293T cells (GFP-negative) and GFP-expressing HEK293 cells (GFP-positive) based on FACS analysis. FIG. 10B is an enlarged bar graph of the samples D-Cas9 / sgRNA and Lipo Cas9 / sgRNA RNP-treated cells. FIG. 10C is a bar graph showing the percentage of gene-edited cells (GFP-negative cells) in D-Cas9 / sgRNA and Lipo Cas9 / sgRNA RNP-treated cells compared to GFP-expressing HEK293 cells (GFP-positive). The data are presented as mean ± s.d. (n = 3). FIG. 10D is a bar graph showing the percentage of gene-edited cells (GFP-negative cells) in HEK293T cells treated with different formulations of Cas9 / sgRNA and Lipo Cas9 / sgRNA shown in Table 2. The percentage of cell viability was also measured by CCK-8 assay in control cells, or cells treated with D-Cas9 / sgRNA and Lipo Cas9 / sgRNA RNP.

[0291] (Example 6) Genome editing of vascular endothelial growth factor A (VEGF-A) gene by D-Cas9 / Lipo Cas9 (RNP). Materials and methods The dose response of D-Cas9 (sgRNA) RNP was evaluated with respect to cell viability and cytotoxicity. GFP-expressing cells were treated for 3 days with different formulations of Cy5-D-Cas9(2NLS) / Cas9(2NLS) and sgRNA targeting GFP.

[0292] The loss of GFP fluorescence was measured by flow cytometry to quantify the editing efficiency. D-Cas9 RNP had the maximum efficiency with 10 μg / mL -1 of Cas9.

[0293] The genomic editing efficiency was measured using a T7 endonuclease I (T7EI)-based genomic detection assay (The GeneArt Genomic Cleavage Detection kit, Thermos Fisher). D-Cas9 / RNP against GFP showed a frequency of indel formation of 26% using the T7 endonuclease (T7E1) mismatch detection assay. The predicted cleavage sites of the GFP target sequence are indicated by the dotted lines in Fig. 11.

[0294] The amount of VEGF A protein was quantified 4 days after transfection via flow cytometry to assay the editing efficiency. For this study, recombinant Alexa Fluor 488 anti-VEGFA antibody (abcam) was used according to the manufacturer's protocol.

[0295] The percentage of VEGF-positive cells in ARPE-19 cells treated with D-Cas9 / sgRNA and Lipo Cas9 / sgRNA RNP (VEGFA guide RNA2) was compared with VEGF antibody-treated and untreated cells using flow cytometry. The percentage of gene-edited cells (VEGF-negative cells) in ARPE-19 cells treated with D-Cas9 / sgRNA RNP and either VEGF sgRNA-1 or VEGF sgRNA-2 was compared with VEGF antibody-treated (VEGF+) and untreated (VEGF-) ARPE-19 cells based on FACS analysis.

[0296] Results Cy5-D-Cas9(2NLS) does not cause significant cytotoxicity in GFP-expressing HEK293 cells, but consistent with the results in the literature, Lipo RNA shows significantly higher cytotoxicity (about 20 - 25% cell death) (Figs. 10A - 10D).

[0297] CRISPR-Cas9 RNP-mediated genome editing to disrupt the VEGF-A gene was also investigated in the ARPE-19 human RPE cell line. Two different gRNAs were used to target the VEGF-A gene. VEGF-A is a diffusible mitogen secreted by RPE and other cells in the eye in response to hypoxia and inflammatory conditions (Yiu, G., et al., Investigative Ophthalmology & Visual Science 57, 5490-5497, (2016)). This study is a proof-of-concept genome manipulation study with high potential in ophthalmic applications.

[0298] Figures 12A and 12B are bar graphs showing the percentage of gene-edited cells (VEGF-negative cells) in ARPE-19 cells treated with Cas9 / sgRNA and Lipo Cas9 / sgRNA RNPs compared to VEGF antibody-treated (VEGF+) and untreated (VEGF-) ARPE-19 cells based on FACS analysis. Data are presented as mean ± s.d. (area presented) (n = 3). Figure 10B is an enlarged bar graph showing the percentage of gene-edited cells (i.e., VEGF-negative cells) in ARPE-19 cells treated with Cas9 / sgRNA and Lipo Cas9 / sgRNA RNPs. Figure 10C is a bar graph showing the percentage of gene-edited cells (i.e., VEGF-negative cells) in ARPE-19 cells treated with different dosages of Cas9 / sgRNA and Lipo Cas9 / sgRNA RNPs as indicated.

[0299] The sgRNA against GFP showed a significant GFP knockout effect compared to the untreated control and the Lipofectamine Cas9 / sgRNA system. Compared to the untreated control, Cy5-D-Cas9(2NLS) RNP (entry 1 in Table 2) induced nearly complete (100%) editing, which was significantly higher than the Lipo (∼50%) RNP.

[0300] The success of gene editing results in a decrease in the Alexa488-tagged cell population that can be easily detected by flow cytometry. Here, a dendrimer-based delivery platform was compared with the commercially available Lipofectamine 2000 (Lipo). The sgRNA against VEGFA showed significant gene editing ability compared to the untreated control and the Lipofectamine Cas9 / sgRNA system. Compared to the untreated control, Cy5-D-Cas9(2NLS)RNP (10 μg / mL Cas9) induced editing (about 20%), which was significantly higher than that of Lipo (about 3%)RNP (Figures 10A - 10B). In addition, the dose response of D-Cas9(sgRNA) / Lipo Cas9(sgRNA)RNP was evaluated in ARPE-19 cells. VEGFA-expressing cells were treated for 3 days with various formulations of Cy5-D-Cas9(2NLS) / Lipo Cas9(2NLS) and sgRNA targeting VEGF (Figure 10C). The gene editing efficiency was measured by flow cytometry to quantify the editing efficiency. The D-Cas9 RNP against VEGFA had the maximum efficiency with 10 μg / mL -1 of Cas9.

[0301] Surprisingly, sgRNA-1 against VEGFA (target sequence: 5’C * G * G * GGAGGAGGUGGUAGCUG3’ (SEQ ID NO: 2)) showed significant gene editing ability compared to SgRNA-2 (target sequence: 5’G * C * C * GCCGGCCGGGGAGGAGG3’ (SEQ ID NO: 3)) (Figures 13A - 13C). Compared to the untreated control, Cy5-D-Cas9(2NLS)RNP and sgRNA-1 (10 μg / mL Cas9) induced editing (about 20%) (Figures 12A - 12C). However, the D-Cas9 RNP or Lipo Cas9 RNP containing sgRNA-2 did not induce a visible gene editing efficiency under the current treatment protocol. Here, the gene editing efficiency was measured by flow cytometry to quantify the editing efficiency.

[0302] Abstract We developed a successful synthesis of a CRISPR / Cas9 delivery system conjugated to a hydroxyl PAMAM dendrimer using a highly specific inverse Diels–Alder click reaction (IEDDA). Hydroxyl-terminated PAMAM dendrimers are well-defined hyperbranched polymeric nanoparticles that have been found to preferentially target activated macrophages in inflammation / neuroinflammation models (Nance, E. et al., Journal of Neuroinflammation 14, 252, (2017); Turk, B. R. et al., Annals of Neurology 84, 452-462, (2018); Sharma, R. et al., J Control Release 323, 361-375, (2020); Mishra, M. K. et al. ACS Nano 8, 2134-2147, (2014); Sharma, A. et al., Science Advances 6, eaay8514, (2020)). The inherent targeting properties of hydroxyl PAMAM dendrimers depend on their small size, surface functionality, and excellent water solubility, and non-toxicity and renal clearance have been established to enable further development of this system as a better drug delivery platform (Menjoge, et al., Drug Discov Today 15, 171-185, (2010)).

[0303] Cas9 (S. pyogenes) nuclease was covalently conjugated to the 6th generation PAMAM dendrimer (PAMAM-G6-OH) via a glutathione-sensitive linker (Le Rhun, et al., RNA Biol 16, 380-389, (2019)). The sgRNA was then complexed with D-Cas9 to form the D-Cas9(sgRNA) RNP complex. Once efficiently delivered to the cytosol, the D-Cas9(sgRNA) complex undergoes reduction by intracellular glutathione, releasing the Cas9 / sgRNA cargo, which ultimately translocates to the nucleus. Here, nuclear translocation of CRISPR / Cas9 is conferred by a nuclear localization signal (NLS), a short sequence of amino acids that transports nuclear proteins into the nucleus. A commercially available Cas9 with 2NLS modifications was specifically selected for this study.

[0304] This is the first study showing that the dendrimer-Cas9 conjugate can directly deliver the CRISPR Cas9 RNP into the intracellular environment in vitro. The Cas9 RNP conjugated to the dendrimer demonstrated dose-dependent knockdown in green fluorescent protein (「GFP」)-expressing HEK293 cells in vitro. The D-Cas9 RNP targeting the GFP gene in cells expressing a stable form of the GFP reporter resulted in nearly quantitative (about 100%) GFP knockout in HEK cells, as quantified by flow cytometry. The control RNP complexed with Lipofectamine 2000 gave only about 50% gene editing efficiency in vitro. Furthermore, D-Cas9 RNP was significantly less toxic than the lipofectamine method in both the ARPE-19 cell and HEK293 cell lines. The D-Cas9(2NLS)RNP targeting the VEGFA gene resulted in a cell population with about 20% VEGFA gene editing. The D-Cas9 RNP against both the VEGFA and GFP genes had the maximum efficiency with 10 μg / mL -1 of Cas9.

Claims

**Claim 1** (a) a dendrimer, and (b) a gene editing system A genome editing composition comprising: The genome editing composition, wherein the dendrimer is covalently conjugated to the gene editing system via a linker as needed. **Claim 2** The genome editing composition according to claim 1, wherein the gene editing system is a protein-guided gene editing system selected from the group consisting of a CRISPR system, zinc finger nuclease (ZFN), and transcription activator-like effector nuclease (TALEN). **Claim 3** The genome editing composition according to claim 1 or 2, wherein the gene editing system is a CRISPR / Cas system. **Claim 4** The genome editing composition according to any one of claims 1 to 3, wherein the CRISPR system comprises a Cas nuclease and a single guide RNA (sgRNA). **Claim 5** The genome editing composition according to claim 4, wherein the Cas nuclease is selected from the group consisting of Cas9, CasX, Cas7-11, CasFx, Cas12a, and Cas13. **Claim 6** The genome editing composition according to claim 4 or 5, wherein the Cas nuclease comprises one or more nuclear localization signals. **Claim 7** The genome editing composition according to any one of claims 4 to 6, wherein the Cas nuclease is a Cas9 nuclease. **Claim 8** The genome editing composition according to any one of claims 4 to 7, wherein the dendrimer is covalently conjugated to the Cas9 nuclease and optionally to the sgRNA. **Claim 9** The genome editing composition according to any one of claims 4 to 8, wherein the Cas9 nuclease is a Streptococcus pyogenes Cas9 nuclease. **Claim 10** The genome editing composition according to any one of claims 4 to 9, wherein the ratio of the Cas nuclease to the protein dendrimer is between 1:1 and 4:1, and the Cas nuclease is conjugated to the dendrimer. **Claim 11** The genomic editing composition according to any one of claims 1 to 10, wherein the dendrimer is covalently conjugated to the gene editing system via one or more of disulfide, ester, ether, or amide bonds, and optionally via a hydrocarbon or oligoethylene glycol chain.

12. The genomic editing composition according to any one of claims 1 to 11, wherein the dendrimer is covalently conjugated to the gene editing system via a releasable bond.

13. The genomic editing composition according to any one of claims 1 to 12, wherein the dendrimer is covalently conjugated to the gene editing system via a glutathione-sensitive disulfide bond.

14. The genomic editing composition according to claim 13, wherein the linkage comprises a gamma-aminobutyric acid linker.

15. The genomic editing composition according to any one of claims 1 to 14, wherein the dendrimer is a first-generation, second-generation, third-generation, fourth-generation, fifth-generation, sixth-generation, seventh-generation, eighth-generation, or ninth-generation dendrimer.

16. The genomic editing composition according to any one of claims 1 to 15, wherein the dendrimer is a poly(amidoamine) (PAMAM) dendrimer.

17. The genomic editing composition according to any one of claims 1 to 16, wherein the dendrimer comprises hydroxyl, amine, carboxylic acid, and / or acetamide groups.

18. The genomic editing composition according to any one of claims 1 to 17, wherein the dendrimer is a hydroxyl-terminated PAMAM dendrimer.

19. The genomic editing composition according to any one of claims 1 to 18, wherein the dendrimer is a fourth-generation, fifth-generation, or sixth-generation hydroxyl-terminated PAMAM dendrimer.

20. The genomic editing composition according to any one of claims 1 to 15, wherein the dendrimer is a glucose dendrimer comprising a central core of dipentaerythritol and one or more branched units of monosaccharide glucose molecules, optionally conjugated with linkers thereto.

21. The glucose dendrimer has the following structure: [Chemical 3] The genomic editing composition according to claim 20, which is a first-generation dendrimer having the same.

22. The glucose dendrimer has the following structure: 【Chemical Formula 4】 The genome editing composition according to claim 20, wherein the dendrimer is a second-generation dendrimer having the following structure: **Claim 23** The genome editing composition according to any one of claims 1 to 22, wherein the dendrimer is further conjugated to one or more therapeutic agents, prophylactic agents, or diagnostic agents selected from the group consisting of small molecules, antibodies or antigen-binding fragments thereof, nucleic acids, and polypeptides. **Claim 24** The genome editing composition according to claim 23, wherein the therapeutic agent is selected from the group consisting of anti-inflammatory agents, antioxidants, and immunomodulatory agents. **Claim 25** The genome editing composition according to claim 23, wherein the diagnostic agent is selected from the group consisting of fluorescent dyes, near-infrared dyes, SPECT imaging agents, PET imaging agents, and radioisotopes. **Claim 26** A pharmaceutical preparation comprising the genome editing composition according to any one of claims 1 to 25 and a pharmaceutically acceptable carrier or excipient. **Claim 27** The pharmaceutical preparation according to claim 26, wherein the preparation is formulated for systemic or topical administration. **Claim 28** The pharmaceutical preparation according to claim 26 or 27, wherein the preparation is formulated for parenteral or enteral administration. **Claim 29** The pharmaceutical preparation according to any one of claims 26 to 28, wherein the preparation is formulated for intramuscular, intraperitoneal, intravenous, or subcutaneous injection. **Claim 30** The pharmaceutical preparation according to claim 26 or 27, wherein the preparation is formulated for nasal administration. **Claim 31** A method of altering, adding, and / or deleting a genomic segment in a target cell of a subject in need of altering, adding, and / or deleting a genomic segment, the method comprising administering to the subject an effective amount of the pharmaceutical preparation according to any one of claims 26 to 30. **Claim 32** The method according to claim 31, wherein the pharmaceutical preparation is administered by parenteral or enteral administration. **Claim 33** The method according to claim 31, wherein the pharmaceutical preparation is administered by intramuscular, intraperitoneal, intravenous, or subcutaneous injection. **Claim 34** The method according to any one of claims 31 to 33, wherein the pharmaceutical preparation comprises the genome editing composition comprising a Cas9 nuclease and an sgRNA specific for the genomic segment in the target cell. **Claim 35** The method according to any one of claims 31 to 34, wherein the pharmaceutical preparation is administered in an effective amount to treat a genetic disorder.

36. The method according to claim 35, wherein the genetic disorder is selected from the group consisting of cystic fibrosis, hemophilia, abnormal hemoglobinopathy, xeroderma pigmentosum, and lysosomal storage disease.

37. The method according to claim 36, wherein the abnormal hemoglobinopathy is sickle cell anemia or beta-thalassemia.

38. The method according to claim 35, wherein the genetic disorder is selected from the group consisting of eye diseases, neurological and / or neurodegenerative diseases, neurodevelopmental diseases, and cancers.

39. The method according to claim 38, wherein the target cells are selected from the group consisting of reactive microglia, macrophages, astrocytes, retinal pigment epithelial cells, neurons, ganglion cells, and other neuron cells in the brain and eye.

40. The method according to claim 38 or 39, wherein the eye disease is age-related macular degeneration, choroidal neovascularization, retinitis pigmentosa, or Stargardt disease.

41. The method according to claim 40, wherein the sgRNA is specific for vascular endothelial growth factor (VEGF) for the treatment of AMD.

42. The method according to claim 41, wherein the pharmaceutical preparation is administered in an effective amount to induce a decrease of about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% to a maximum of 100% in the expression, translation, or activity of VEGF in the target cells, and the target cells are retinal cells.

43. The method according to claim 38, wherein the neurological and / or neurodegenerative diseases are selected from the group consisting of Huntington's disease, amyotrophic lateral sclerosis (ALS), Alzheimer's disease, Parkinson's disease, childhood cerebral adrenoleukodystrophy (ccALD), muscular dystrophy, Friedreich's ataxia, spinocerebellar ataxia, Duchenne muscular dystrophy, and spinal muscular atrophy.

44. The method according to claim 38, wherein the neurodevelopmental diseases are selected from the group consisting of cerebral palsy, fragile X syndrome, Down syndrome, Tay-Sachs disease, Sandhoff disease, Niemann-Pick disease, and sphingolipidosis.

45. The method according to claim 38, wherein the cancer is selected from the group consisting of bone cancer, bladder cancer, brain cancer, breast cancer, cervical cancer, colorectal cancer, esophageal cancer, kidney cancer, liver cancer, lung cancer, nasopharyngeal cancer, pancreatic cancer, prostate cancer, skin cancer, stomach cancer, and uterine cancer.

46. The method according to claim 45, wherein the pharmaceutical formulation is administered in an effective amount to induce a decrease of about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% to a maximum of 100% in the expression, translation, or activity of one or more cancer genes in the cancer.

47. The method according to claim 45 or 46, wherein the pharmaceutical formulation is administered in an effective amount to induce a decrease of about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% to a maximum of 100% in the expression, translation, or activity of one or more immune regulatory factors.

48. The method according to claim 47, wherein the immune regulatory factor is PD-1 or PD-L1.

49. The method according to any one of claims 31 to 47, comprising altering, adding, and / or deleting at least one nucleotide in the genomic segment in the target cell.

Images