Fusarium solani and application thereof in agilawood fermentation and aroma enhancement

By inoculating Fusarium ceramia CX-1 on agarwood, the problems of low efficiency and unstable quality in the existing artificial agarwood aroma formation technology are solved, significantly improving the aroma quality and active ingredient content of agarwood, and shortening the production cycle.

CN120330060APending Publication Date: 2025-07-18SOUTH CHINA INST OF COLLABORATIVE INNOVATION
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510340948.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-21
Publication Date
2025-07-18

AI Technical Summary

Technical Problem

The existing artificial agarwood artificial fragrance forming technology has low efficiency and unstable quality, and chemical residue risks. The microbial bacterial strain screening and action mechanism need to be studied in depth, resulting in a long time for high-quality agarwood to form, and insufficient aroma complexity and effective ingredients content.

Method used

Fusarium solani CX-1, a Fusarium solani CX-1 selected from a healthy agarwood tree, was used to ferment the fermentation broth on the agarwood powder to increase the content of sesquiterpenes and ketones. The fermentation conditions were 26-30℃ for 1-3 days.

Benefits of technology

The content of sesquiterpenes and ketones in agarwood has been significantly improved, the production cycle of agarwood has been shortened, and the aroma quality and active ingredient content of agarwood has been improved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120330060A_ABST
    Figure CN120330060A_ABST
Patent Text Reader

Abstract

The invention discloses fusarium solani and application thereof in agilawood fermentation and aroma enhancement. The fusarium solani is obtained by separating and purifying agilawood, and is preserved in Guangdong Microbial Culture Collection Center on September 11, 2024, and the preservation number is GDMCC NO.65118. The fusarium solani has been preserved in the Guangdong Microbial Culture Collection Center. The address of the preservation unit is the fifth floor of the building 59, No.100 courtyard, Xianlie Middle Road, Guangzhou City. By utilizing fusarium solani, under specific process conditions, the content of sesquiterpenoids and chromone in agilawood can be increased to a certain range. By accelerating the accumulation of the characteristic components of the agilawood, the agilawood production period is greatly shortened, and the agilawood has a huge market prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a strain of Fusarium solani and its application in enhancing the fragrance of Aquilaria sinensis through fermentation. Background Art

[0002] As a rare medicinal and spice resource, Aquilaria sinensis has made significant research progress in the fields of resource protection and efficient production in recent years. Currently, global Aquilaria sinensis mainly relies on natural wild resources. However, due to overharvesting and the long incense formation cycle, natural Aquilaria sinensis is on the verge of exhaustion. To address the resource crisis, artificial cultivation and induced incense formation technologies have become research hotspots, and a standardized production model is gradually being explored.

[0003] The main means of artificial incense formation mainly include three directions: physical damage, chemical induction, and microbial inoculation. The physical method simulates the natural incense formation process by mechanically wounding the tree trunk, but the efficiency is low and the quality is unstable; the chemical method uses specific agents to stimulate the Aquilaria sinensis tree to produce defensive resin, which can shorten the incense formation time to 1 - 2 years, but there is a risk of chemical residues; the microbial method screens specific fungal strains to simulate the natural infection mechanism and is regarded as a greener technology closer to natural Aquilaria sinensis, but the strain screening and action mechanism still need to be further studied. The current mainstream production still mainly combines physical and chemical methods.

[0004] Although breakthroughs have been made in artificial incense formation technology, there is still an obvious gap between the product quality and natural Aquilaria sinensis. The insufficient complexity of the fragrance and the content of active ingredients are the main bottlenecks. Future research needs to focus on the molecular biological analysis of the incense formation mechanism, develop a technical system for precisely regulating secondary metabolites, and at the same time optimize the environmental control and harvesting standards in large-scale production. Among them, high-quality Aquilaria sinensis often takes several years to form. Therefore, how to improve the fragrance quality of Aquilaria sinensis through biotechnology means has important practical significance and economic value. Summary of the Invention

[0005] The purpose of the present invention is to overcome the disadvantages and deficiencies of the prior art and provide a strain of Fusarium solani.

[0006] Another purpose of the present invention is to provide the application of the above-mentioned Fusarium solani in enhancing the fragrance of Aquilaria sinensis through fermentation. The purpose of the present invention is achieved by the following technical solutions:

[0007] A strain of Fusarium solani, obtained by sampling, screening, and enriching from a healthy Aquilaria sinensis tree, named Fusarium solani CX-1.

[0008] The preservation number of the Fusarium solani is GDMCC NO.65118, and it was deposited in the Guangdong Provincial Microbial Culture Collection Center (GDMCC) on September 11, 2024. The deposit address is the 5th floor of Building 59, No. 100 Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences.

[0009] The colony of the Fusarium solani is relatively large, white, nearly circular, and villous. There are diaphragms in the hyphae that divide the hyphae into several segments, and each segment contains cytoplasm and one or more nuclei. There are many large conidia, which are mart-shaped, with the top cell being blunt and round, the basal cell heel being not obvious, and the multiple septa being unclear. There are many small conidia, which are oval.

[0010] The Fusarium solani can ferment agarwood to obtain sesquiterpenoids and chromones.

[0011] Application of the Fusarium solani in enhancing the fragrance of agarwood fermentation.

[0012] Application of the Fusarium solani in the production of sesquiterpenoids and chromones.

[0013] The chromones include at least one of 2-(2-phenylethyl)chromone, 6-methoxy-2-(2-phenylethyl)chromone, 2-(4-methoxyphenylethyl)chromone, and 6,7-dimethoxy-2-(phenylethyl)chromone.

[0014] The sesquiterpenoids include guaiene, eucalyptol, guaiol, aristolene, guaiacyl acetate, viridiflorol, costol, 1H-Cyclopenta[1,3]cyclopropa[1,2]benzen-3-ol,

[0015] octahydro-3,7-dimethyl-4-(1-methylethyl)-,(3R,3aR,3bR,4S,7R,7aR)-, α-Kessyl acetate, α-costol, Cubebol, Aristolactone, Globulol, β-Eudesmol, Longifolene aldehyde, Ginsenol, Dehydrofuranone, β-Santalol, Eremophilone, (-)-Isolongifolol, Hydroxyvaleric acid, Isospathulenol, Mustakone, (-)-Thujopsene, 4(15),5,10(14)-germacratrien-1-ol, Isoaromadendrene epoxide, α-Costal, Alantolactone, α-Cyperone, Bicyclo[4.1.0]heptan-2-one,3,4,4-trimethyl-3-[(1E)-3-methyl-1,3-butadien-1-yl]-,(1R,3R,6R)-rel-, Longifolene, 1H-Cyclopenta[1,3]cyclopropa[1,2]benzen-3-ol,octahydro-3,7-dimethyl-4-(1-methylethyl)-,(3R,3aR,3bR,4S,7R,7aR)-, Curcumol, (+)-4,11(13)-Eudesmadien-12-ol, trans-Valerate, Tris(trimethylsilyl) arsenite, Ylangenol, Hexamethylcyclotrisiloxane, or at least one of them.

[0016] A method for enhancing the fragrance of agarwood by fermentation, comprising the following steps:

[0017] Inoculate Fusarium solani f. sp. cucurbitae into a culture medium, cultivate to obtain a fermentation broth, spray it on agarwood powder, and ferment to obtain a fermentation product rich in sesquiterpenoids and chromones.

[0018] The agarwood is the resin-containing wood of Aquilaria sinensis (Lour.) Spreng. of the family Thymelaeaceae; preferably, the agarwood is the agarwood after incense formation.

[0019] The agarwood powder is the powder passed through a 30-50 mesh sieve after pulverization.

[0020] The incense formation is natural incense formation or artificial incense formation.

[0021] The incense formation is for more than one year; preferably, it is for more than one year of incense formation and more than one year of aging.

[0022] The culture medium is PDB liquid medium.

[0023] The culture condition is to cultivate until OD600 is greater than 2.

[0024] The ratio of the fermentation broth to the wood powder is 1-2 mL: 1-2 g.

[0025] The fermentation conditions are culturing at 26-30 °C for at least 1 day; preferably 1-3 days.

[0026] The present invention has the following advantages and effects compared with the prior art:

[0027] 1. A strain of Fusarium solani was screened from a healthy Aquilaria sinensis tree and named Fusarium solani CX-1. This strain was deposited at the Guangdong Provincial Microbial Culture Collection Center on September 11, 2024, with the deposit number: GDMCC NO. 65118.

[0028] 2. After fermenting Aquilaria sinensis by inoculating the fermentation broth of Fusarium solani provided by the present invention, the contents of linalool extract, sesquiterpenoids and chromones in Aquilaria sinensis can be significantly increased. Moreover, the fermentation time has an important impact on the increase of the content of linalool extract, the content of characteristic substances of Aquilaria sinensis, and the antioxidant activity of linalool extract, which proves that this strain has broad application prospects in the industrial production of Aquilaria sinensis. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 It is the growth curve of Fusarium solani;

[0030] Figure 2 It is the morphological diagram of Fusarium solani in the culture medium;

[0031] Figure 3 It is the spore morphology diagram of Fusarium solani;

[0032] Figure 4 It is the phylogenetic tree of Fusarium solani;

[0033] Figure 5 It is the schematic diagram of Aquilaria sinensis raw material;

[0034] Figure 6 It is the GC chromatogram of linalool extract. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0035] The present invention will be further described in detail below with reference to the embodiments and the drawings, but the embodiments of the present invention are not limited thereto.

[0036] If the specific test conditions are not specified in the following embodiments, they are usually in accordance with the conventional test conditions or the test conditions recommended by the reagent company. The materials, reagents, etc. used, unless otherwise specified, are all reagents and materials obtained from commercial sources.

[0037] Example 1 Isolation, purification and identification of Fusarium solani

[0038] After the fresh agarwood samples were collected from healthy Aquilaria sinensis trees in the Xiangbo Garden of Dongguan City (ensuring no pests and diseases) and air-dried in the shade for one year, they were cut into small cubes with a side length of about 1 cm. After surface disinfection, the samples were cut open and their interiors were closely attached to PDA plates. After the plates were sealed, they were placed upright in an incubator at a constant temperature of (28 ± 1) °C. After the medium was covered with mycelium, the mycelium tip inoculation method was used to purify the strains, and this was repeated 3 - 4 times until a pure-cultured strain was obtained. Finally, one strain that was easy to culture and had stable subculture characteristics was selected as the target strain, and this strain was numbered CX-1.

[0039] The selected target strain CX-1 was cultured upside down on a PDA plate at (28 ± 1) °C for 7 d, and the colony morphology was observed ( Figure 2 ). The spore morphology was observed by taking the bacterial suspension under a microscope ( Figure 3 ). The colony of strain CX-1 was relatively large, white, nearly circular, and villous. There were diaphragms in the mycelium that divided the mycelium into several segments, and each segment contained cytoplasm and one or more nuclei. There were many large conidia, which were Mart-shaped, with the top cell being blunt and round, the basal cell heel being not obvious, and the multiple septa being unclear; there were many small conidia, which were oval. Combining with "Fungal Identification Handbook" (Wei Jingchao), CX-1 was preliminarily determined to be Fusarium sp.

[0040] The strain was identified using 18S rDNA, and the primers and amplification systems used are shown in Table 1 and Table 2.

[0041] Table 1 Primer information

[0042]

[0043] Table 2 PCR amplification reaction system and conditions

[0044]

[0045] After 18S rDNA nucleotide sequence analysis, the length of the 18S rDNA nucleotide sequence of the strain was measured to be 557 bp (SEQ ID No.1). After splicing the 18S rDNA nucleotide sequence of the target strain, it was compared with the 18S rDNA nucleotide sequences of known strains in the GenBank database through the Blast program on the NCBI website, and a phylogenetic tree was constructed using the Mega7 software. By comparing the 18S rDNA nucleotide sequence of this strain with the 18S rDNA nucleotide sequences of known strains in the GenBank database through the Blast program on the NCBI website, it was found that this strain was most closely related to the genus Fusarium, and its gene homology was 99.46%. A phylogenetic tree was constructed using the Mega7 software, and the strain with the highest homology was AF178407.1.

[0046] The 18S rDNA of strain CX-1 is as follows:

[0047] CCGTAGGTGAACCTGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAACGTTGCCTCGGCGGGAACAGACGGCCCTGAAACGATGGGCCGCCCCCGCCAGAGGACCCCCTGTCTCTGTTTTTTATTAGTGTATCTCTGAGTAACCAAGCAAATAAATTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACAACCCTCAGGCCCCCGGGCCTGGCGTTGGGGATCGGCGGAGCCCCCCGCGGGCACACGCCGTCCCCCAAATACAGTGGCGGTCCCGCCGCAGCTTCCAATGCGTAGTAGCTAACACCTCGCAACTGGAGAGCGGCGCGGCCACGCCGTAAAACACCCAACTTTTAGAACGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAAT。

[0048] Based on the above identification results of strain CX-1, CX-1 was identified as Fusarium solani. The above target strain was deposited at the Guangdong Microbial Culture Collection Center on September 11, 2024, with the deposit number: GDMCC NO.65118, and the address of the depositary institution is the 5th floor, Building 59, No. 100 compound, Xianlie Middle Road, Guangzhou.

[0049] Example 2 Preparation of Fusarium solani Fermentation Broth

[0050] Take 1 ml of the purified and preserved Fusarium solani liquid and inoculate it into 100 ml of PDB liquid medium. Incubate at (28±1)°C and 120 rpm for about 2 days until the OD600 reaches 2.0. Centrifuge the Fusarium solani liquid at 4000 rpm for 5 min, then remove the supernatant and add 250 ml of 0.5% sterile physiological saline. After shaking for 2 min, the Fusarium solani fermentation broth is obtained.

[0051] Method for increasing characteristic substances of Aquilaria sinensis by fermentation with Fusarium solani

[0052] Aquilaria sinensis: The resin-containing wood of the plant Aquilaria sinensis (Lour.) Spreng. in the Thymelaeaceae family, provided by Dongguan Xiangcheng Industrial Co., Ltd., was aged for one year after being harvested with agarwood formation for one year, and then pulverized and passed through a 40-mesh sieve.

[0053] Weigh 100 g of the above-mentioned Aquilaria sinensis powder, spray the fermentation broth of Fusarium solani in Example 2 onto the Aquilaria sinensis powder, with the ratio of material to liquid being 2:1 (g:ml). Place the inoculated Aquilaria sinensis powder in an incubator at a constant temperature of (28±1)°C for 3 days.

[0054] Example 4

[0055] Other conditions are the same as in Example 3, except that the fermentation time is 1 day.

[0056] Example 5

[0057] Other conditions are the same as in Example 3, except that the fermentation time is 2 days.

[0058] Comparative Example 1

[0059] Other operations are the same as in Example 3, except that the fermentation broth is replaced by 100 ml of 0.5% sterile physiological saline.

[0060] Comparative Example 2

[0061] Other operations are the same as in Example 4, except that the fermentation broth is replaced by 100 ml of 0.5% sterile physiological saline.

[0062] Comparative Example 3

[0063] Other operations are the same as in Example 5, except that the fermentation broth is replaced by 100 ml of 0.5% sterile physiological saline.

[0064] Example 6

[0065] The fermented Aquilaria sinensis in Examples 3 to 5 and Comparative Examples 1 to 3 was placed in an oven at 45°C for 24 h. The determination of the content of ethanol-soluble extracts was referred to the cold maceration method in the Chinese Pharmacopoeia (2015 Edition): Take about 4 g of the above-mentioned fermented and dried Aquilaria sinensis sample, accurately weigh it, place it in a 250-ml conical flask, accurately add 100 ml of 95% ethanol, tightly stopper it, and macerate it coldly. Shake it constantly within the first 6 hours, then let it stand for 18 hours, quickly filter it through a dry filter, accurately measure 20 ml of the subsequent filtrate, place it in an evaporating dish that has been dried to a constant weight, evaporate it to dryness on a water bath, dry it at 105°C for 3 hours, place it in a desiccator to cool for 30 minutes, and quickly and accurately weigh it. Calculate the content (%) of ethanol-soluble extracts in the test sample based on the dried product.

[0066] Content of ethanol extracts:

[0067]

[0068] Note: χ——Alcohol extract content (%)

[0069] m1——Mass of the evaporating dish (g);

[0070] m2——Total mass of the evaporating dish and the sample (g);

[0071] M——Mass of the sample (g).

[0072] The results are shown in Table 3 below.

[0073] Table 3 Alcohol extract content of Aquilariae Lignum

[0074] Example Alcohol extract content (%) Example 3 5.54 Example 4 5.40 Example 5 5.42 Comparative Example 1 5.21 Comparative Example 2 4.90 Comparative Example 3 5.13

[0075] It can be seen from the results in Table 3 that the fermentation of Fusarium solani f. sp. cucurbitae fermentation broth can increase the alcohol extract content of Aquilariae Lignum, and within a certain fermentation time, with the increase of fermentation time, the increase effect of the alcohol extract content of Aquilariae Lignum is better. Compared with the comparative example, the fermentation of Fusarium solani f. sp. cucurbitae fermentation broth can increase the alcohol extract content of Aquilariae Lignum by 5.65% - 10.20%.

[0076] Example 7

[0077] The contents of sesquiterpenoids, chromones, and aromatic substances in the alcohol extracts of Examples 3 - 5 and Comparative Examples 1 - 3 were detected by gas chromatography - mass spectrometry (GC - MS). GC - MS sample preparation: Take 10 ml of anhydrous ethanol to dissolve the above - mentioned alcohol extract to prepare a GC - MS test sample. The detection conditions of the gas chromatography - mass spectrometry (GC - MS) are as follows:

[0078] a) Chromatographic column: HP - 5 (30m × 0.25mm × 0.3μm);

[0079] b) Chromatographic column temperature: Linear programmed temperature rise from 50°C to 140°C, rate 3°C / min; then linear programmed temperature rise from 140°C to 160°C, rate 1°C / min; then linear programmed temperature rise from 160°C to 280°C, rate 4°C / min, hold for 10 minutes;

[0080] c) Carrier gas: Nitrogen, purity ≥ 99.999%, flow rate 1.0 ml / min;

[0081] d) Injection port temperature: 250°C;

[0082] e) Detector temperature: 280°C;

[0083] f) Detector: Hydrogen flame ionization detector;

[0084] g) Injection volume: 1.0 μL;

[0085] h) Split ratio: 10:1;

[0086] i) Ion source temperature: 230 °C;

[0087] j) Ionization energy: 70 eV;

[0088] k) Full scan mode;

[0089] l) Scanning range: 50 - 500 m / z.

[0090] The results are shown in Table 4 and Figure 6 as follows.

[0091] Table 4 Analysis of the components of agarwood oil

[0092]

[0093]

[0094]

[0095] Note: "-" indicates that the substance was not detected.

[0096] It can be seen from Example 3 in Table 4 that under the action of the fermentation broth of Fusarium solani, the content of characteristic substances in agarwood oil can be significantly increased. The total content of sesquiterpenoids in the fermented agarwood oil is 10320 μg / g, and the total content of chromones is 13318 μg / g. Compared with Comparative Example 1, the total content of sesquiterpenoids increased by 28.86% and the total content of chromones increased by 72.54%.

[0097] It can be seen from Example 4 in Table 4 that under the action of the fermentation broth of Fusarium solani, the content of characteristic substances in agarwood oil can be significantly increased. The total content of sesquiterpenoids in the fermented agarwood oil is 6402 μg / g, and the total content of chromones is 9021 μg / g. Compared with Comparative Example 2, the total content of sesquiterpenoids increased by 31.92% and the total content of chromones increased by 104.19%.

[0098] It can be seen from Example 5 in Table 4 that under the action of the fermentation broth of Fusarium solani, the content of characteristic substances in agarwood oil can be significantly increased. The total content of sesquiterpenoids in the fermented agarwood oil is 7034 μg / g, and the total content of chromones is 8477 μg / g. Compared with Comparative Example 3, the total content of sesquiterpenoids decreased slightly and the total content of chromones increased by 8.32%.

[0099] As can be seen from Examples 3, 4, and 5 in Table 4, with the increase in fermentation time, the total content of terpenoids and the total content of chromones in agarwood generally show an increasing trend.

[0100] As can be seen from Comparative Examples 1, 2, and 3 in Table 4, with the increase in the soaking time in physiological saline, the content of some active substances in the leaching solution has changed. However, the degree of change does not show a statistical difference. It is only due to the change in the leaching rate of agarwood in the solution due to different soaking times. Compared with the examples with added fermentation broth, the change in the content of active ingredients can be ignored, proving that the fermentation broth effectively increases the yield of active substances.

[0101] In summary, the Fusarium solani fermentation broth and fermentation time in this application have important effects on the content of ethanol extracts of agarwood and the content of characteristic substances of agarwood.

[0102] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. A Fusarium solani, characterized in that: It is obtained by sampling, screening and enrichment from fresh agarwood samples, named Fusarium solani CX-1, with the preservation number of GDMCC NO.65118, and has been preserved in the Guangdong Provincial Microbial Culture Collection Center on September 11, 2024. The preservation address is the 5th floor of Building 59, No. 100 Compound, Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences.

2. The Fusarium solani according to claim 1, characterized in that: The colony of the Fusarium solani is relatively large, white, nearly round, villous. There are diaphragms in the hyphae to divide the hyphae into several segments, and each segment contains cytoplasm and one or more nuclei. The number of macroconidia is large, in the shape of Mat, the top cell is blunt round, the basal cell heel is not obvious, and the multi-septa are not clear. The number of microconidia is large, oval.

3. The Fusarium solani according to claim 1, characterized in that: The Fusarium solani can ferment sesquiterpenoids and chromones using agarwood as a raw material.

4. Use of the Fusarium solani according to any one of claims 1 to 3 in enhancing the fragrance of agarwood by fermentation.

5. Use of the Fusarium solani according to any one of claims 1 to 3 in the production of sesquiterpenoids and chromones.

6. A method for enhancing the fragrance of agarwood by fermentation, characterized in that It includes the following steps: Inoculate the Fusarium solani into a medium, culture to obtain a fermentation broth, spray it on agarwood powder, and ferment to obtain a fermentation product rich in sesquiterpenoids and chromone components.

7. The method according to claim 6, characterized in that: The agarwood is the resin-containing wood of Aquilaria sinensis (Lour.) Spreng. of the Thymelaeaceae family; The agarwood powder is the powder passed through a 30-50 mesh sieve after being crushed.

8. The method according to claim 6, characterized in that: The medium is PDB liquid medium; The culture condition is to culture until OD600 is greater than 2.

9. The method according to claim 6, characterized in that: The ratio of the fermentation broth to the wood powder is 1-2 mL: 1-2 g.

10. The method according to claim 6, characterized in that: The fermentation condition is to culture at 26-30 °C for at least 1 day.