Lactobacillus crispatus and use thereof

Abstract

The invention provides lactobacillus crispatus, which is preserved in the general microbiological center of the China Committee for Culture Collection of Microorganisms on February 7, 2023, and the preservation number is CGMCC (China General Microbiological Culture Collection Center) No. 26503. The bacillus subtilis can play a relatively strong role in inhibiting pathogenic bacteria such as gardnerella vaginalis, escherichia coli and staphylococcus aureus at the same time, and also has a certain role in inhibiting candida albicans, two-way proteurella and Atortoria vaginalis. Therefore, the lactobacillus crispatus has the potential of maintaining the environment in the vagina to be faintly acid and improving the mucosal immunity and infection resistance of a host, and can be used for preventing and treating vaginal infection and inflammation, and maintaining, improving or recovering the steady state of the environment in the vagina.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine. Specifically, the present invention relates to a Lactobacillus crispatus and its uses. Background Art

[0002] Among the diseases related to vaginal infections, bacterial vaginosis (BV) is the most common. Epidemiological surveys show that the main cause of this disease is the reduction of dominant lactobacilli that maintain the normal acidic vaginal environment, while the increase of various other anaerobic microorganisms. The dominant lactobacilli are replaced by Gardnerella vaginalis and mixed anaerobic bacteria. Gardnerella vaginalis is one of the most common pathogenic bacteria of BV in women. The typical clinical features of bacterial vaginosis are the appearance of foul-smelling, watery, gray secretions in the patient's vagina. Patients may also develop many complications due to pathogen infections, such as chronic cervicitis, pelvic inflammatory disease, endometritis, and even infertility. Vulvovaginal candidiasis (VVC), commonly known as yeast infection, is the second most common vaginal infection after bacterial vaginosis. The dominant bacteria are mostly Candida albicans (white candida). Studies have found that approximately 78% of women have at least had VVC caused by Candida albicans infection once in their lifetime, 65% of women have 3 or fewer annual episodes, and 35% of women have 4 or more annual episodes. VVC usually presents as vulvar itching, burning, dysuria, and vaginal curd-like secretions, often causing a decline in the quality of life of patients and a serious national economic burden. The pathogenesis of VVC is relatively complex and is considered a multifactorial disease. Among them, vaginal microbial imbalance, estrogen level, host susceptibility factors, genetic susceptibility factors, and the morphology of candida are all related to the occurrence of the disease. The imbalance of the vaginal microecosystem is closely related to the occurrence of these two vaginal infection diseases.

[0003] The vaginal microbiota is different from the microbiota in other parts. For healthy individuals, the lower the diversity of the vaginal microbiota, the more conducive it is to maintaining vaginal health. The female vagina is a closed body cavity with many bacteria present. Since there is no air in the deep part of the vagina, the parasitic bacteria are mainly facultative anaerobes and anaerobes. More than 50 kinds of microorganisms parasitize in the vagina of healthy women. Under normal conditions, the ratio of anaerobes to aerobes is about 10:1, and the proportion of Lactobacillus is the highest, which plays an important role in maintaining the vaginal microecological balance. Under normal circumstances, Lactobacillus coexists with other microorganisms in the vagina, in a state of microecological balance. Once affected by various factors, Lactobacillus loses its dominance, while the number of pathogenic bacteria and conditional pathogenic bacteria increases. At this time, the enzyme spectrum changes accordingly, breaking the microecological balance and leading to the occurrence of diseases. Lactobacillus maintains the stability of the vaginal microecology through multiple mechanisms: fermenting glycogen in epithelial cells to produce lactic acid and maintaining the acidic pH value of the vagina; competing with pathogenic bacteria for adhesion to vaginal epithelial cells; producing broad-spectrum antibacterial factor H2O2; Lactobacillus and its metabolites stimulating the immune function of vaginal epithelial cells and inhibiting the growth and reproduction of pathogenic bacteria.

[0004] Currently, for the treatment of BV, Western medicine treatment is mainly adopted, and antibacterial drugs such as antibiotics, including metronidazole, clindamycin, tinidazole, etc., are often used. However, the generation and persistent existence of pathogenic biofilms can lead to disease recurrence. According to the "Diagnosis and Treatment Guidelines for Bacterial Vaginosis", the recurrence rate of BV patients after oral metronidazole treatment is 20% at 1 month, 40% at 3 months, and as high as 60% at 12 months. By the 12th month after treatment, 84% of the patients have abnormal vaginal flora. In addition, long-term and large-scale use of antibiotics not only increases the drug resistance of pathogenic bacteria, but also inhibits the reproduction of some vaginal flora, while enabling the original small amount of Candida albicans to multiply in large numbers, resulting in vaginal flora disorders. At present, the role of live bacteria preparations in the treatment of BV is still controversial. Relevant clinical studies show that the application of current live bacteria preparations is mainly divided into two types: the application of probiotics after conventional antibiotic treatment or the application of probiotics alone. The results of multiple clinical trials of combined treatment show inconsistent results, and it is impossible to determine whether antibiotics combined with probiotics can be used for the treatment of bacterial vaginosis. In addition, some studies have shown that some patients using probiotic preparations alone have not obtained satisfactory curative effects. Therefore, there is still a great controversy about the effect of probiotics in the treatment of BV, and a large number of tests are still needed for exploration and research. The currently marketed probiotic drug for the treatment of bacterial vaginosis is mainly Ding Junsheng (Live Lactobacillus Capsules for Vaginal Use) developed by Inner Mongolia Shuangqi Pharmaceutical Co., Ltd. For the treatment of VVC, the commonly used drugs for the treatment of VVC in clinical practice are mainly azoles and polyenes. For example, compound metronidazole suppositories are often used for the treatment of mycotic vaginitis. However, with the long-term use of clinical antifungal drugs, Candida albicans shows phenotypic changes, virulence factor mutations, and an increase in the infection of non-Candida albicans, challenging the therapeutic effect of traditional antibacterial drugs. In the treatment of various VVC patients, lactobacilli can be used as adjuvant treatment drugs in combination with antibacterial drugs such as azole drugs, with a certain curative effect. However, compared with conventional antifungal drug treatment, there is currently not enough evidence to show that the use of lactobacillus preparations alone has a certain curative effect on the treatment of VVC.

[0005] Therefore, there is an urgent need for a lactobacillus with good cell adhesion and bacteriostatic ability, so as to inhibit the growth of a variety of pathogenic bacteria. Summary of the Invention

[0006] The present invention aims to solve at least one of the technical problems existing in the prior art to at least some extent.

[0007] Therefore, the inventor isolated a strain from the vaginal secretions of a healthy reproductive-aged woman in Zhejiang Province. After identification, the strain was Lactobacillus crispatus (Lactobacillus crispatus HY1467). Through experiments, it was found that the Lactobacillus crispatus had superior cell adhesion ability, enabling it to adhere to vaginal epithelial cells, form a microecological barrier, and prevent pathogen colonization or competition for epithelial cell receptors. Experiments proved that this Lactobacillus crispatus had a strong ability to adhere to Hela cells and a strong ability to produce lactic acid, capable of reducing the pH and inhibiting the reproduction of pathogenic bacteria. Therefore, this Lactobacillus crispatus had the potential to maintain a weakly acidic environment in the vagina, enhance the host mucosal immunity and anti-infection ability, thereby preventing vaginal infections and treating inflammation.

[0008] In view of this, in the first aspect of the present invention, the present invention provides a Lactobacillus crispatus (Lactobacillus crispatus HY1467). According to the embodiments of the present invention, this Lactobacillus crispatus was deposited with the China General Microbiological Culture Collection Center on February 7, 2023, with the deposit number CGMCC No. 26503, and the deposit address being: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences. As mentioned above, the inventor isolated this strain from the vaginal secretions of a healthy reproductive-aged woman in Zhejiang Province. After further identification of the biochemical characteristics of this strain, it was found that this bacterium could produce a large amount of lactic acid, thus having the ability to maintain the acidic pH value of the vagina. In addition, this bacterium could simultaneously have a strong inhibitory effect on the pathogenic bacteria Gardnerella vaginalis (GV), Escherichia coli (EC), and Staphylococcus aureus (SA). Through experiments, it was found that this bacterium could inhibit the formation of the biofilm of Candida albicans (CA), thereby inhibiting the growth of Candida albicans. In addition, it also had a certain inhibitory effect on Atopobium vaginae (FV) and Prevotella bivia (PB) in the vagina. Therefore, this Lactobacillus crispatus had the potential to maintain a weakly acidic environment in the vagina, enhance the host mucosal immunity and anti-infection ability, and thus had the ability to prevent vaginal infections and treat inflammation.

[0009] According to the embodiments of the present invention, the 16S rDNA of the Lactobacillus crispatus has the nucleotide sequence shown in SEQ ID NO: 1.

[0010]

[0011] In the second aspect of the present invention, the present invention provides a Lactobacillus crispatus. According to an embodiment of the present invention, the 16S rDNA of the Lactobacillus crispatus has one of the following nucleotide sequences: (1) the nucleotide sequence shown in SEQ ID NO:1; (2) a nucleotide sequence having at least 99.8%, 99.9% or higher homology with the nucleotide sequence shown in SEQ ID NO:1; (3) a nucleotide sequence having one or more, such as 1, 2, 3, 4, 5 or more nucleotide substitutions, deletions or insertions in the nucleotide sequence shown in SEQ ID NO:1. The Lactobacillus crispatus of the present invention can simultaneously exhibit a strong inhibitory effect on pathogenic bacteria Gardnerella vaginalis (GV), Escherichia coli (EC), and Staphylococcus aureus (SA). Through experiments, it is found that this bacterium can inhibit the formation of Candida albicans (CA) biofilm, thereby inhibiting the growth of Candida albicans. In addition, it also has a certain inhibitory effect on Atopobium vaginae (FV) and Prevotella bivia (PB). Therefore, this Lactobacillus crispatus has the potential to maintain a weakly acidic environment in the vagina, improve host mucosal immunity and anti-infection ability, thereby having the ability to prevent vaginal infections and treat inflammation.

[0012] According to an embodiment of the present invention, the 16S rDNA gene sequence of the Lactobacillus crispatus contains the nucleotide sequence shown in SEQ ID NO:1.

[0013] According to an embodiment of the present invention, the microorganism described in the first aspect or the second aspect further includes at least one of the following additional technical features:

[0014] According to an embodiment of the present invention, the gene sequence of the Lactobacillus crispatus further contains a nucleotide sequence selected from one of the following: (1) the nucleotide sequence shown in SEQ ID NO:24; (2) a nucleotide sequence having at least 97%, 98%, 99% or higher homology with the nucleotide sequence shown in SEQ ID NO:24; (3) a nucleotide sequence having one or more, such as 1, 2, 3, 4, 5 or more nucleotide substitutions, deletions or insertions in the nucleotide sequence shown in SEQ ID NO:24. Therefore, the microorganism of the present invention can be specifically identified through the above nucleotide sequences.

[0015] According to an embodiment of the present invention, the gene sequence of the Lactobacillus crispatus further contains the nucleotide sequence shown in SEQ ID NO:24.

[0016] According to a specific embodiment of the present invention, the nucleotide sequence of the 16S rDNA of Lactobacillus crispatus has at least about 99% sequence identity with the nucleotide sequence shown in SEQ ID NO: 1.

[0017] According to a specific embodiment of the present invention, Lactobacillus crispatus can produce at least 9.0 - 10.0 g / L of lactic acid under effective culture.

[0018] According to a specific embodiment of the present invention, Lactobacillus crispatus can produce at least 9.1 g / L, 9.2 g / L, 9.3 g / L, 9.4 g / L, 9.5 g / L, 9.6 g / L, 9.7 g / L, 9.8 g / L, 9.9 g / L, 10.0 g / L of lactic acid under effective culture.

[0019] According to a specific embodiment of the present invention, Lactobacillus crispatus has at least a 94 - 97% antibacterial rate against GV.

[0020] According to a specific embodiment of the present invention, Lactobacillus crispatus has at least a 94%, 95%, 96%, 97% antibacterial rate against GV.

[0021] According to a specific embodiment of the present invention, Lactobacillus crispatus has at least a 58 - 61% antibacterial rate against PB.

[0022] According to a specific embodiment of the present invention, Lactobacillus crispatus has at least a 58%, 59%, 60%, 61% antibacterial rate against PB.

[0023] According to a specific embodiment of the present invention, Lactobacillus crispatus has at least a 57 - 60% antibacterial rate against FV.

[0024] According to a specific embodiment of the present invention, Lactobacillus crispatus has at least a 57%, 58%, 59%, 60% antibacterial rate against FV.

[0025] According to a specific embodiment of the present invention, Lactobacillus crispatus has at least a 78 - 82% antibacterial rate against EC.

[0026] According to a specific embodiment of the present invention, Lactobacillus crispatus has at least a 78%, 79%, 80%, 81%, 82% antibacterial rate against EC.

[0027] According to a specific embodiment of the present invention, Lactobacillus crispatus has at least a 70 - 75% antibacterial rate against SA.

[0028] According to a specific embodiment of the present invention, Lactobacillus crispatus has at least a 70%, 71%, 72%, 73%, 74%, 75% antibacterial rate against SA.

[0029] According to a specific embodiment of the present invention, Lactobacillus crispatus has an antibacterial rate of at least 45-50% against CA.

[0030] According to a specific embodiment of the present invention, Lactobacillus crispatus has an antibacterial rate of at least 45%, 46%, 47%, 48%, 49%, 50% against CA.

[0031] In a third aspect of the present invention, the present invention provides a primer set for detecting Lactobacillus crispatus described in the first or second aspect. According to an embodiment of the present invention, the primer set includes a forward primer and a reverse primer; the forward primer has the nucleotide sequence shown in SEQ ID NO: 2; the reverse primer has the nucleotide sequence shown in SEQ ID NO: 3. Using the primer set of the present invention, it can highly match the DNA sequence of Lactobacillus crispatus described in the first or second aspect and only produce specific amplification in Lactobacillus crispatus. This enables the primer to accurately and reliably identify Lactobacillus crispatus and exclude the interference of other non-target strains.

[0032] In a fourth aspect of the present invention, the present invention provides a microbial preparation. According to an embodiment of the present invention, the microbial preparation contains Lactobacillus crispatus described in the first or second aspect. As mentioned above, the inventors of the present invention isolated a new Lactobacillus crispatus, which has strong inhibitory effects on pathogenic bacteria GV, EC, SA, and CA. Therefore, this Lactobacillus crispatus can be made into a microbial preparation to facilitate patients' taking.

[0033] According to an embodiment of the present invention, the microbial preparation further includes a pharmaceutically acceptable carrier or excipient.

[0034] In a fifth aspect of the present invention, the present invention provides a single-dose preparation. According to an embodiment of the present invention, it includes 1×10 6 ~1×10 10 CFU of Lactobacillus crispatus described in the first or second aspect as an active ingredient.

[0035] According to an embodiment of the present invention, it includes 10 6 CFU, 10 7 CFU, 10 8 CFU, 10 9 CFU, 10 10 CFU of Lactobacillus crispatus described in the first or second aspect as an active ingredient.

[0036] According to an embodiment of the present invention, it includes 1×10 6 ~1×10 9 CFU of Lactobacillus crispatus described in the first or second aspect as an active ingredient.

[0037] In the sixth aspect of the present invention, the present invention provides the use of the Lactobacillus crispatus described in the first aspect or the second aspect, the microbial preparation described in the fourth aspect, or the single-dose preparation described in the fifth aspect in the preparation of a drug for treating and / or preventing vaginal pathogenic bacteria infection or related diseases caused by vaginal pathogenic bacteria infection.

[0038] In the seventh aspect of the present invention, the present invention provides the use of the Lactobacillus crispatus described in the first aspect or the second aspect, the microbial preparation described in the fourth aspect, or the single-dose preparation described in the fifth aspect in the preparation of a drug for inhibiting vaginal pathogenic bacteria.

[0039] According to an embodiment of the present invention, the use described in the sixth aspect or the seventh aspect further includes at least one of the following additional technical features:

[0040] According to an embodiment of the present invention, the vaginal pathogenic bacteria are selected from at least one of Gardnerella vaginalis (GV), Escherichia coli (EC), Staphylococcus aureus (SA), Atopobium vaginae (FV), Prevotella bivia (PB), and Candida albicans (CA).

[0041] According to an embodiment of the present invention, the vaginal pathogenic bacteria are selected from at least one of Gardnerella vaginalis (GV), Escherichia coli (EC), Staphylococcus aureus (SA), and Candida albicans (CA).

[0042] According to an embodiment of the present invention, the related diseases caused by the vaginal pathogenic bacteria infection include bacterial vaginosis, aerobic vaginitis, vulvovaginal candidiasis, trichomonal vaginitis, mixed vaginitis, HPV infection, gonorrhea, chlamydia infection, urinary tract infection, or pelvic inflammatory disease.

[0043] In the eighth aspect of the present invention, the present invention provides the application of the Lactobacillus crispatus described in the first aspect, the microbial preparation described in the second aspect, or the single-dose preparation described in the third aspect in the preparation of a product for regulating the balance of vaginal flora.

[0044] According to an embodiment of the present invention, the product includes at least one of a drug and an external health care product.

[0045] In a ninth aspect of the present invention, the present invention provides a molecular marker of the Lactobacillus crispatus as described in the first aspect or the second aspect. According to an embodiment of the present invention, the molecular marker comprises a nucleotide sequence selected from one of the following: (1) the nucleotide sequence shown in SEQ ID NO:24; (2) a nucleotide sequence having at least 97%, 98%, 99% or higher homology with the nucleotide sequence shown in SEQ ID NO:24; (3) a nucleotide sequence having one or more, such as 1, 2, 3, 4, 5 or more nucleotide substitutions, deletions or insertions in the nucleotide sequence shown in SEQ ID NO:24.

[0046] According to an embodiment of the present invention, the molecular marker has the nucleotide sequence shown in SEQ ID NO:24.

[0047] AGGATGCGACAGTAGTTGGCTTAACGCCTAATAATTCAGCTAAGTCCTTTTGTGTGTAATGATATTTTTTTCTTAACTTACGTATATTTTCTCCGATAGCATTCAAATTTTTCACCACCTCATAAGCCAATTATACATTTATTCCGTATAAAATAAACAATTTTTTGTATGTTTTATCCATATTTATGTTGACAATACATTTTATCCGTAGTTTAATATTAGATGTAGCGAATGAAAAGGAGGTTAGTTGAGTGAAATTCACATTGAAGCAAGCAAGAAACTATGCTGACTTTAGTCAAGCAGATATGGCTAAGCACCTTCATGTAGGATTGAATACCTATAGAAACTATGAGAATGGTACAACTCCTATGAGAATTAGAACTGCAGAGATGTTTTCTGATTTAACTGGTGTTCCTTTTGATCAGATTATTTTTTATTCTGATACTACGGATAAAATGTAGAAAAGGAGGCGACAAAATGACAATTAGGGAAGCGTGTTTGAAAGCAAAAAAAGAGGGCCGTGGCATAACTCGTAAAAGTTATGGCCAACGACCACCT(SEQ ID NO:24)

[0048] According to an embodiment of the present invention, the primers of the molecular marker include the primer set described in the third aspect.

[0049] In the tenth aspect of the present invention, the present invention provides a method for detecting Lactobacillus crispatus described in the first aspect or the second aspect. According to an embodiment of the present invention, the method includes: amplifying the DNA of the strain to be detected using the primer set described in the third aspect, so as to obtain Lactobacillus crispatus described in the first aspect or the second aspect. As described above, the primer set described in the third aspect is a specific primer for Lactobacillus crispatus of the present invention, which can highly match the DNA sequence of Lactobacillus crispatus described in the first aspect or the second aspect, and only produce specific amplification in the Lactobacillus crispatus. By using the method of the present invention, Lactobacillus crispatus of the present invention can be efficiently and simply identified and detected.

[0050] According to an embodiment of the present invention, the product of the amplification treatment has the nucleotide sequence shown in SEQ ID NO:24, which is an indication that the strain to be detected is Lactobacillus crispatus described in the first aspect or the second aspect. Using the primer set described in the third aspect can amplify the nucleotide sequence shown in SEQ ID NO:24. The nucleotide sequence shown in SEQ ID NO:24 is a specific fragment marker of Lactobacillus crispatus of the present invention, providing a reliable tool and basis for identifying and detecting Lactobacillus crispatus of the present invention.

[0051] According to an embodiment of the present invention, the method for detecting Lactobacillus crispatus described in the first aspect or the second aspect includes the following steps: extracting a DNA sample from the strain to be detected, performing PCR amplification on the DNA sample using the primer set described in the third aspect, and then comparing the amplification result with the molecular marker described in the ninth aspect, so as to identify whether the strain to be detected is Lactobacillus crispatus described in the first aspect or the second aspect. By using the method of the present invention, Lactobacillus crispatus of the present invention can be efficiently and simply identified and detected.

[0052] In the eleventh aspect of the present invention, the present invention provides the use of the molecular marker described in the ninth aspect for identifying and detecting Lactobacillus crispatus described in the first aspect or the second aspect.

[0053] The additional aspects and advantages of the present invention will be partly given in the following description, partly become obvious from the following description, or be understood through the practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] The above and / or additional aspects and advantages of the present invention will become obvious and easy to understand from the description of the embodiments in conjunction with the following drawings, wherein:

[0055] Figure 1 is a colony morphology diagram of Lactobacillus crispatus HY1467 according to an embodiment of the present invention;

[0056] Figure 2It is the cell morphology diagram of Lactobacillus crispatus HY1467 according to an embodiment of the present invention;

[0057] Figure 3 It is the PCR amplification electrophoresis pattern of primer 12-p1 for 4 Lactobacillus crispatus strains according to an embodiment of the present invention, where M is Marker, 1 uses the supernatant after lysis of HY1467 as the template, 2 uses the supernatant after lysis of HY00744 as the template, 3 uses the supernatant after lysis of HY05276 as the template, and 4 uses the supernatant after lysis of HY00939 as the template;

[0058] Figure 4 It is the PCR amplification electrophoresis pattern of primer 4-p3 for 4 Lactobacillus crispatus strains according to an embodiment of the present invention, where M is Marker, 1 uses the supernatant after lysis of HY1467 as the template, 2 uses the supernatant after lysis of HY00744 as the template, 3 uses the supernatant after lysis of HY05276 as the template, and 4 uses the supernatant after lysis of HY00939 as the template;

[0059] Figure 5 It is the hemolysis experiment result diagram of Lactobacillus crispatus HY1467 according to an embodiment of the present invention;

[0060] Figure 6 It is the BV pharmacodynamic animal experiment result diagram according to an embodiment of the present invention;

[0061] Figure 7 It is the VVC pharmacodynamic animal experiment result diagram according to an embodiment of the present invention. Detailed implementation manners

[0062] The following specific embodiments illustrate the implementation manners of the invention of the present application. Those skilled in the art can easily understand other advantages and effects of the invention of the present application from the content disclosed in this specification.

[0063] Term definitions

[0064] In the present application, the term "Lactobacillus crispatus" or "L. crispatus" generally refers to a species of the genus Lactobacillus. This species is generally distinguished from other Lactobacillus based on the polynucleotide sequence of the ribosomal 16S rDNA gene.

[0065] In the present application, the term "effective culture conditions" generally refers to the environment in which Lactobacillus crispatus is placed or exposed to promote the growth of the bacterium. Therefore, this term generally refers to the culture medium, temperature, atmospheric conditions, substrate, stirring conditions, etc. that can affect the growth of the bacterium.

[0066] In the present application, the term "antibiotic-sensitive" means that bacteria have weak resistance to antibiotics, and under the condition of administering a small amount of the drug, it can affect the normal growth of the bacteria. According to an embodiment of the present invention, Lactobacillus crispatus HY1467 is sensitive to clindamycin and cefuroxime antibiotics.

[0067] In the present application, the term "vagina" generally refers to the vaginal region or division or surrounding area, including the labia, vulva, cervix, uterus, fallopian tubes, ovaries, urethra, bladder, anus, and rectum, including their mucosal tissues.

[0068] In the present application, the terms "disease" or "disorder" are used interchangeably and generally refer to any change in the state of the body or certain organs that impedes or disrupts the performance of functions, and / or causes symptoms such as discomfort, dysfunction, pain, or even death in a person suffering from or in contact with the disease.

[0069] In the present application, the term "pathogenic" (e.g., "pathogenic bacterium") generally refers to a substance, microorganism, or condition capable of causing disease. In certain contexts, pathogens also include microorganisms (e.g., bacteria) that are associated with a disease or disorder but for which a causal relationship (e.g., a direct causal relationship) has not yet been established or remains to be established. In some embodiments, microorganisms that are not pathogens and can be symbionts can cause or be associated with a disease or dysbiosis, depending on various factors (e.g., the immune status of the site, the abundance of the microbial taxon, etc.). Such microorganisms are referred to as "pathogenic organisms".

[0070] In the present application, the terms "vaginal flora" or "vaginal microbiota" are used interchangeably and generally refer to the microorganisms colonizing the vagina.

[0071] In the present application, the term "inhibit" generally refers to the process of inhibiting or impeding the growth, reproduction, and activity of bacteria.

[0072] In the present application, the term "isolated", when applied to a nucleic acid or protein, generally means that the nucleic acid or protein is substantially free of other cellular components with which it is associated in its natural state. For example, it can be in a homogeneous state and can be in a dry solution or an aqueous solution. Purity and homogeneity are typically determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid chromatography.

[0073] The term "isolated" when applied to bacteria generally refers to bacteria that have been (1) separated from at least some of the components with which they were associated at the time of their original production (whether in nature or in an experimental setting), and / or (2) bacteria that have been artificially produced, prepared, purified, and / or manufactured, such as by using artificial culture conditions, such as (but not limited to) culturing on plates and / or in fermenters. Isolated bacteria include those bacteria that are cultured, even if such cultures are not monocultures. Isolated bacteria can be separated from at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% or more of the other components with which they were originally associated. In embodiments, the isolated bacteria are greater than about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or greater than about 99%. According to embodiments of the present invention, the bacterial populations provided in the present application include isolated bacteria. According to embodiments of the present invention, the compositions provided in the present application include isolated bacteria. According to embodiments of the present invention, the bacteria administered are isolated bacteria.

[0074] In the present application, the term "pharmaceutically acceptable carrier" generally refers to a substance that facilitates the administration of an active agent to a subject and is absorbed by the subject and that can be included in the compositions of the present application without causing significant adverse toxicological effects to the patient. Non-limiting examples of pharmaceutically acceptable carriers include water, NaCl, saline solution, lactated Ringer's solution, common sucrose, common glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavors, salt solutions, alcohols, oils, gelatin, carbohydrates such as lactose, amylose or starch, fatty acid esters, hydroxypropylmethylcellulose, polyvinylpyrrolidone, and dyes, etc. Such products can be sterilized, and those skilled in the art will recognize that other pharmaceutical carriers can also be used in the present application.

[0075] In the present application, the term "CFU (Colony-Forming Units)" generally refers to the total number of microbial communities such as bacteria, fungi, yeast, etc. in a product, and is usually used for calculating the number of viable bacteria.

[0076] The term "CFU / dose" means the amount of bacteria present in the composition / food or dietary supplement / drug provided to a subject per day or per administration. For example, in certain embodiments, Lactobacillus crispatus in the food or dietary supplement is present in an amount of 10 6 to 10 10 CFU / dose (e.g., 10 6 to 10 9CFU / dose). In such an embodiment, if Lactobacillus crispatus is administered in a food product (e.g., in a solid beverage, yogurt), the food product (e.g., solid beverage, yogurt) provided to the subject daily or each time may contain about 10 6 to 10 10 CFU of Lactobacillus crispatus. Of course, alternatively, the amount of this bacterium can be administered in multiple doses, as long as the total amount of Lactobacillus crispatus received by the subject within any specific time period (e.g., each 24-hour period) is from about 10 6 to about 10 10 CFU of the bacterium, that is, the Lactobacillus crispatus in the above-mentioned food product or dietary supplement is present in an amount of 10 6 to 10 10 CFU / dose (e.g., 10 6 to 10 9 CFU / dose).

[0077] In this application, the term "treatment and / or prevention" not only includes treating and / or preventing a disease, but generally includes preventing the onset of the disease, slowing or reversing the disease process, preventing or slowing the onset of one or more symptoms associated with the disease, reducing and / or alleviating one or more symptoms associated with the disease, reducing the severity and / or duration of the disease and / or any symptoms associated therewith, and / or preventing a further increase in the severity of the disease and / or any symptoms associated therewith, preventing, reducing or reversing any physiological damage caused by the disease and any pharmacological effects that are generally beneficial for treating the patient. The compositions of this application do not need to achieve complete cure or eradication of any symptoms or manifestations of the disease to form viable therapeutic agents. As recognized in the relevant art, a drug used as a therapeutic agent can reduce the severity of a given disease state, but does not need to eliminate every manifestation of the disease to be considered a useful therapeutic agent. Similarly, a prophylactic treatment does not need to be completely effective in preventing the onset of a disorder. Simply reducing the impact of the disease in a subject (e.g., by reducing the number or severity of its symptoms, or by enhancing the effectiveness of another treatment, or by producing another beneficial effect), or reducing the likelihood of the disease occurring or worsening is sufficient.

[0078] In this application, the term "about" generally means varying within a range of about 0.5% - 10% above or below the specified value, e.g., within a range of about 0.5%, about 1%, about 1.5%, about 2%, about 2.5%, about 3%, about 3.5%, about 4%, about 4.5%, about 5%, about 5.5%, about 6%, about 6.5%, about 7%, about 7.5%, about 8%, about 8.5%, about 9%, about 9.5%, or about 10% above or below the specified value.

[0079] Embodiments of the present invention will be described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as a limitation to the present invention. For those technologies or conditions not specified in the embodiments, they shall be carried out according to the technologies or conditions described in the literature in the field or according to the product instructions. For reagents or instruments not specified by the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0080] Example 1 Screening and Isolation of Lactobacillus crispatus

[0081] (1) Sample collection

[0082] The samples were sourced from naturally fermented foods with regional characteristics, vaginal secretion samples of volunteers meeting the inclusion criteria collected by hospital gynecologists, and human samples (feces and breast milk).

[0083] (2) Strain isolation

[0084] The vaginal secretions of healthy women of childbearing age were serially diluted tenfold with physiological saline. The diluent of an appropriate dilution gradient was spread on an anaerobic blood agar plate (purchased from Huankai Microorganisms) and incubated at 37 °C in an anaerobic workstation for 48 - 72 h. Single colonies with different morphologies were picked and streaked for purification on the blood agar plate, and then continued to be cultured. The pure culture was picked for strain identification (16S rDNA sequencing). Through identification and screening, a strain of Lactobacillus crispatus was obtained and named Lactobacillus crispatus HY1467.

[0085] After determining the species of the strain, the pure culture (Lactobacillus crispatus HY1467) was inoculated into MRS broth medium (purchased from Qingdao Haibo) for amplification culture. When the strain grew to an appropriate concentration, a sterile 50% glycerol solution was mixed evenly with the same volume of liquid culture and stored in a -80 °C strain bank.

[0086] Example 2 Identification of Lactobacillus crispatus

[0087] (1) Colony characteristics

[0088] Using an inoculation loop to dip the bacterial liquid in the strain tube and streak inoculate on an MRS plate, and incubate anaerobically at 37 °C for 48 h, then observe the colony morphology on the plate. As Figure 1 shown, after culturing on the MRS plate, this strain formed round, irregular-edge, milky-white colonies with a raised middle.

[0089] (2) Staining and microscopic examination

[0090] Using an inoculation loop to pick 1 loop of sterilized distilled water onto a clean glass slide, pick a single colony from the MRS plate, mix it evenly with the distilled water and spread it on the glass slide, stain it according to the instructions of the Gram staining solution kit (purchased from Qingdao Haibo), and then observe the cell morphology under an electron microscope. As Figure 2As shown, after the strain was stained and observed under an optical microscope, it could be determined that the bacteria were Gram-positive and the bacterial cells were short rod-shaped.

[0091] (3) Biochemical identification analysis

[0092] ① Lactobacillus culture: The target strain was inoculated into MRS broth medium (purchased from Qingdao Haibo), placed in an anaerobic incubator, and cultured at 37°C for 24 h.

[0093] ② Bacterial suspension preparation: The strain fermentation broth was centrifuged at 4000 rpm for 5 min in a centrifuge, the supernatant was removed, the bacterial pellet was washed with physiological saline, then centrifuged at 4000 rpm for 5 min, the supernatant was removed, the bacterial pellet was washed with physiological saline again, centrifuged at 4000 rpm for 5 min to remove the supernatant, and physiological saline was added and mixed evenly with the bacterial pellet for standby.

[0094] ③ 1% sodium hippurate identification experiment: 50 μL of the bacterial suspension was aspirated and added to a 1% sodium hippurate identification tube. After sealing with a sealing film, it was cultured in a 37°C water bath for 2 h. Then, 200 μL of ninhydrin solution (3.5% ninhydrin solution: 0.175 g of ninhydrin hydrate, 2.5 mL of acetone, 2.5 mL of butanol) was slowly added along the tube wall without shaking, and the result was judged after placing it in a 37°C water bath for 10 min.

[0095] ④ Other identification experiments: 50 μL of the bacterial suspension was aspirated and added to a biochemical identification tube (Note: After adding the bacterial liquid to the esculin identification tube, the liquid surface needs to be covered with sterile liquid paraffin). After sealing with a sealing film, it was placed in an anaerobic incubator and cultured at 37°C for 48 h, and then the result was judged. The judgment results are shown in Table 1:

[0096] Table 1 Judgment results of Lactobacillus crispatus identification tubes

[0097]

[0098] Note: + represents positive; - represents negative; +w represents weakly positive.

[0099] The biochemical identification results showed that Lactobacillus crispatus could utilize 9 other carbon sources (esculin, cellobiose, maltose, mannitol, salicin, sorbitol, sucrose, inulin, lactose) except for raffinose and 1% sodium hippurate.

[0100] (4) 16S rDNA identification

[0101] The above-mentioned Lactobacillus crispatus was amplified and sequenced by 16S rDNA. After obtaining the sequence, it was subjected to BLAST alignment in the NCBI database. The 16S alignment results showed that the above strain was Lactobacillus crispatus, named Lactobacillus crispatus HY1467. The 16S rDNA determined gene sequence is as follows:

[0102]

[0103] (5) Specific nucleotide sequence molecular marker

[0104] ① Specific primer design

[0105] a. Screening of specific nucleotide sequence fragments: The whole genome of strain HY1467 was sequenced and genome analysis was carried out. It was compared and analyzed with the genome sequences of Lactobacillus crispatus strains included in the NCBI database. Through the comparative analysis of the genome sequences of other Lactobacillus crispatus strains, the specific nucleotide sequences of Lactobacillus crispatus HY1467 were screened out.

[0106] b. Primer design: Primers were designed for the specific gene nucleotide sequences screened in step a. Specific primer fragments with a predicted product length of approximately 200 to 800 bp were designed for the screened specific nucleotide sequences, and 10 pairs of primers were designed for other nucleotide sequences on the whole genome as controls. The primer sequences are shown in Table 2:

[0107] Table 2 Primer list

[0108]

[0109]

[0110] c. Primer screening: Lactobacillus crispatus HY1467 and 3 strains of the same species (specific strain information is shown in Table 3) were used as control groups to prepare templates. Single colonies were picked into 50 μL of lysis buffer (TaKaRa) respectively. After simple centrifugation, they were lysed at 80 °C for 15 min, centrifuged at 4000 rpm for 5 min, and the supernatant was used as the template. Through primer screening, 12-p1 was selected for PCR amplification experiment. The PCR amplification system was 12.5 μL of Taq enzyme, 1 μL of F, 1 μL of R, 1.5 μL of template, and supplemented with ddH2O to 25 μL; the PCR reaction conditions are shown in Table 4 below, and PCR experiments were carried out. After the PCR experiment, 1.5 g of agarose was added to 100 mL of 1×TAE buffer, heated and melted thoroughly, 5 μL of Gel Red dye was added, and poured into the gel plate to solidify for later use. 4 μL of the PCR product was taken for agarose gel electrophoresis. The electrophoresis conditions were as follows: voltage 130 V, current 400 mA, time 35 min.

[0111] Table 3 Strain information

[0112] Strain number Identification name HY1467 Lactobacillus crispatus HY00744 Lactobacillus crispatus HY05276 Lactobacillus crispatus HY00939 Lactobacillus crispatus

[0113] Note: The strains with strain numbers HY00744, HY05276, and HY00939 in Table 3 are Lactobacillus crispatus screened from the samples collected by the inventors according to Example 1. In order to verify the specificity of the above specific nucleotide sequence for Lactobacillus crispatus HY1467, the above primers were used to perform PCR amplification on HY1467 and 3 strains of the same species respectively.

[0114] Table 4 PCR reaction conditions

[0115]

[0116] Among the primers designed for the specific nucleotide sequence, when the PCR amplification experiment was carried out with 12-p1 as the primer, only HY1467 had a specific amplification band, and the band was clear and had a high concentration, and there were relatively few primer dimers, while HY00744, HY05276, and HY00939 had no amplification bands. The agarose gel electrophoresis detection pattern is shown in Figure 3 . When the PCR amplification experiment was carried out with primers designed from other nucleotide sequences, there was a situation where bands were also amplified in the control bacteria group (taking 4-p3 as an example, the agarose gel electrophoresis detection pattern is shown in Figure 4 ). Therefore, it shows that the primer 12-p1 is a molecular marker primer for HY1467, and the amplification product generated by this primer is a molecular marker for Lactobacillus crispatus HY1467. The size of the amplification product of the 12-p1 primer is 558 bp, and the nucleotide sequence is as shown in SEQ ID NO:24. Thus, it was determined that the nucleotide sequence shown in SEQ ID NO:24 is a part of the specific nucleotide sequence screened in step a, further verifying that the primer 12-p1 can be used as a specific primer for Lactobacillus crispatus HY1467, and the nucleotide shown in SEQ ID NO:24 is a specific nucleotide sequence marker for Lactobacillus crispatus HY1467, which provides a reliable tool and basis for identifying and detecting Lactobacillus crispatus HY1467.

[0117] AGGATGCGACAGTAGTTGGCTTAACGCCTAATAATTCAGCTAAGTCCTTTTGTGTGTAATGATATTTTTTTCTTAACTTACGTATATTTTCTCCGATAGCATTCAAATTTTTCACCACCTCATAAGCCAATTATACATTTATTCCGTATAAAATAAACAATTTTTTGTATGTTTTATCCATATTTATGTTGACAATACATTTTATCCGTAGTTTAATATTAGATGTAGCGAATGAAAAGGAGGTTAGTTGAGTGAAATTCACATTGAAGCAAGCAAGAAACTATGCTGACTTTAGTCAAGCAGATATGGCTAAGCACCTTCATGTAGGATTGAATACCTATAGAAACTATGAGAATGGTACAACTCCTATGAGAATTAGAACTGCAGAGATGTTTTCTGATTTAACTGGTGTTCCTTTTGATCAGATTATTTTTTATTCTGATACTACGGATAAAATGTAGAAAAGGAGGCGACAAAATGACAATTAGGGAAGCGTGTTTGAAAGCAAAAAAAGAGGGCCGTGGCATAACTCGTAAAAGTTATGGCCAACGACCACCT(SEQ ID NO:24).

[0118] d. During the experiment, the inventors found that when using the 12-p1 primer to sequence multiple Lactobacillus crispatus HY1467 samples, there were differences in individual bases between the amplified product sequences and the nucleotide sequence shown in SEQ ID NO:24. However, compared with the control bacteria, they all had specific amplified bands, and the bands were clear and had a high concentration, with relatively few primer dimers. Therefore, after multiple sequencing and alignment, the homology range between the molecular marker of Lactobacillus crispatus HY1467 and the nucleotide sequence shown in SEQ ID NO:24 was determined, that is, the molecular marker of Lactobacillus crispatus HY1467 has a nucleotide sequence with at least 97%, 98%, 99% or higher homology with the nucleotide sequence shown in SEQ ID NO:24.

[0119] Example 3 Strain Characteristics

[0120] (1) Antibiotic Sensitivity Test

[0121] Lactobacillus crispatus HY1467 was cultured in MRS broth, and then the bacterial solution was evenly spread on an MRS plate. After the bacterial solution was absorbed and dried, antibiotic susceptibility test strips were applied, and then anaerobically cultured at 37°C for 48 h. The diameter of the inhibition zone was measured using a vernier caliper. The antibiotic sensitivity of the strain was judged by the diameter of the inhibition zone of the strain to the antibiotic susceptibility test strips. The results are shown in Table 5. The strain was resistant to metronidazole, norfloxacin, ofloxacin, ciprofloxacin, and kanamycin, and sensitive to clindamycin and cefuroxime.

[0122] Table 5 Results of Antibiotic Sensitivity Test

[0123]

[0124] Note: S: Sensitive (15 - 20 mm, highly sensitive; >20 mm, extremely sensitive); I: Intermediate (10 - 14 mm, moderately sensitive); R: Resistant (<10 mm, insensitive)

[0125] (2) Toxicity Test

[0126] ① Hemolysis Experiment

[0127] The bacterial solution in the frozen stock tube of the strain was dipped and streaked on an anaerobic blood agar plate, and anaerobically cultured at 37°C for 48 h. The change in the color of the blood agar plate around the colony was observed. The results of the hemolysis experiment are as Figure 5 shown. Grayish-white small colonies appeared in the medium around the colony, and there was no hemolysis ring around the colony, indicating that Lactobacillus crispatus HY1467 was γ-hemolytic, that is, non-hemolytic.

[0128] ② Mouse Toxicity Experiment

[0129] Five mice weighing 18 - 22 g were used. Each mouse was orally gavaged with 0.5 ml of fresh bacterial solution (not less than 1.0×10 9 CFU / 0.5 ml) once a day for 3 consecutive days. From the first day of gavage, the mice were continuously observed until the 7th day, and the survival and weight of the mice were observed. The experimental results showed that after the mice were orally gavaged with the fresh bacterial solution of Lactobacillus crispatus HY1467, all of them survived healthily and their weights increased.

[0130] (3) Determination of Metabolite Content

[0131] ① D-Lactic Acid Detection

[0132] A D-lactic acid detection kit (purchased from Sigma-Aldrich) was used to detect the D-lactic acid production in the supernatant of Lactobacillus. The method used by this kit is as follows: D-lactic acid is oxidized by a specific D-lactic acid dehydrogenase to produce a color reaction, which has a proportional relationship with the D-lactic acid concentration, and the absorbance at 450 nm is measured.

[0133] ② L-Lactic Acid Detection

[0134] Filter the supernatant with a 0.22 μm sterile filter membrane. Measure the L-lactic acid concentration using a biosensor.

[0135] Lactobacillus crispatus HY1467 was cultured in MRS broth for 24 h. The detection results of D-lactic acid and L-lactic acid are shown in Table 6. Organic acids such as D-lactic acid and L-lactic acid are antibacterial substances, which can compete with pathogenic bacteria for nutrients and adhesion sites, and improve the mucosal immunity and anti-infection ability of the host. Among them, the content of D-lactic acid in the metabolites of Lactobacillus crispatus HY1467 is 4.14 g / L, the content of L-lactic acid is 5.55 g / L, the total acid production of Lactobacillus crispatus HY1467 is 9.69 g / L, while the total acid production of Lactobacillus delbrueckii subsp. bulgaricus DJS is only 5.48 g / L. The acid production of Lactobacillus crispatus HY1467 is higher than that of Lactobacillus delbrueckii subsp. bulgaricus DJS. Therefore, Lactobacillus crispatus HY1467 has the potential to improve the mucosal immunity and anti-infection of the host, thereby preventing vaginal infections and treating inflammation.

[0136] Table 6 Determination results of metabolite content

[0137] Metabolite Lactobacillus crispatus HY1467 Lactobacillus delbrueckii subsp. bulgaricus DJS D-lactic acid 4.14 g / L 5.24 g / L L-lactic acid 5.55 g / L 0.24 g / L

[0138] Example 4 Application function analysis

[0139] (1) Antibacterial experiment

[0140] ① Preparation of working bacterial solution: Inoculate lactobacilli into MM medium (modified MRS broth, the composition of which is: peptone 10 g / L, beef extract 5.0 g / L, yeast extract 4.0 g / L, glucose 15 g / L, K2HPO4 2.0 g / L, ammonium citrate 1.0 g / L, sodium acetate 2.5 g / L, magnesium sulfate 0.2 g / L, manganese sulfate 0.05 g / L) at an inoculation amount of 0.5%, and culture in an anaerobic workstation. Six pathogenic bacteria (Gardnerella vaginalis ATCC14018, abbreviated as GV; Escherichia coli ATCC 25922, abbreviated as EC; Staphylococcus aureus ATCC25923, abbreviated as SA; Fannyhessea vaginae CCUG 38953, abbreviated as FV; Prevotella bivia NCTC 11156, abbreviated as PB; Canidia albicans ATCC 10231, abbreviated as CA) were cultured in an appropriate medium. After the target strain was cultured, the supernatant was collected by centrifugation, and the cell-free supernatant was obtained by filtering with 0.22 μm, and used immediately or stored in a -80 °C refrigerator. After the pathogenic bacteria were cultured, the OD 600 value was measured and diluted to about OD 600The value is 0.005 (the viable count remains at 5.0×10 5 CFU / mL to 5.0×10 6 CFU / mL) (WS / T 650—2019 Antibacterial and Bacteriostatic Efficacy Evaluation Methods).

[0141] ② Interaction: Take the same volume of supernatant and pathogenic bacteria liquid and mix them evenly. Immediately take 100 μL of the evenly mixed bacteria liquid and put it into a blank 96-well plate to measure OD 600 ; The remaining culture medium is placed at 37 °C and cultured anaerobically or aerobically according to the culture conditions of the pathogenic bacteria. After 48 h of culture, take 100 μL of the evenly mixed bacteria liquid and put it into a blank 96-well plate to measure OD 600 . Set up a blank control group, with 2 replicates for each sample. According to the following formula, calculate the bacteriostatic rate of Lactobacillus against pathogenic bacteria.

[0142] Bacteriostatic rate = (A - B) / A * 100%

[0143] A: The OD 600 value increased within 48 h in the positive control group (i.e., blank culture medium);

[0144] B: The OD 600 value increased within 48 h in the experimental group.

[0145] Three different strains of the same bacterial species and the positive drug Ding Junsheng were selected to detect the bacteriostatic performance of the screened Lactobacillus crispatus HY1467. The results are shown in Table 7. This strain has good bacteriostatic effects on GV, PB, FV, EC, SA, and CA at the same time, and has more obvious advantages in the bacteriostasis of GV compared with the positive control group or the control group of different strains of the same bacterial species.

[0146] Table 7 Bacteriostatic experiment results

[0147]

[0148] Note: The strains with strain numbers HY00744, HY00714, and HY01628 in Table 7 are Lactobacillus crispatus strains screened from the samples collected by the inventors according to Example 1 to verify the inhibition rates of Lactobacillus crispatus HY1467 and three strains of the same bacterial species against different pathogenic bacteria.

[0149] (2) Co-culture bacteriostatic experiment

[0150] 1) Lactobacillus and CA interaction co-culture experiment

[0151] Lactobacillus culture: Take a glycerol tube of Lactobacillus crispatus and inoculate it into MM medium (modified MRS broth, the composition of which is: peptone 10 g / L, beef extract 5.0 g / L, yeast extract 4.0 g / L, glucose 15 g / L, K2HPO4 2.0 g / L, ammonium citrate 1.0 g / L, sodium acetate 2.5 g / L, magnesium sulfate 0.2 g / L, manganese sulfate 0.05 g / L). Concentrate or dilute the cultured bacterial solution to about 1×10 9 CFU / mL as the Lactobacillus working bacterial solution.

[0152] Candida albicans (CA) culture: Take a CA glycerol tube and inoculate it into Sabouraud medium. Incubate it aerobically at 37°C. Centrifuge the cultured bacterial solution to remove the supernatant, and then adjust the concentration of the bacterial solution to about 1.0×10 7 CFU / mL as the CA working bacterial solution.

[0153] Take 400 μL of the Lactobacillus and CA working bacterial solutions respectively and inoculate them into 40 ml of MRS liquid medium. CA inoculated alone serves as the blank control group, with 2 replicates in each group. Gently shake the bacterial solution and culture it in an anaerobic workstation at 37°C. Sampling is carried out 20 h after culture, and a chromogenic medium for Candida (purchased from bioMérieux, France) is used to count the viable CA bacteria. The experimental results are shown in Table 8. Lactobacillus crispatus HY1467 has a certain inhibitory effect on the growth of CA.

[0154] Table 8 Results of the antibacterial experiment of co-culture of Lactobacillus and CA

[0155]

[0156] 2) Experiment on the interaction and co-culture of Lactobacillus and Gardnerella vaginalis (GV)

[0157] Lactobacillus culture: Take a glycerol tube of Lactobacillus crispatus and inoculate it into MM medium (modified MRS broth, the composition of which is: peptone 10 g / L, beef extract 5.0 g / L, yeast extract 4.0 g / L, glucose 15 g / L, K2HPO4 2.0 g / L, ammonium citrate 1.0 g / L, sodium acetate 2.5 g / L, magnesium sulfate 0.2 g / L, manganese sulfate 0.05 g / L). Concentrate or dilute the cultured bacterial solution to a concentration of about 1×10 9 CFU / mL as the Lactobacillus working bacterial solution.

[0158] GV culture: Take a GV glycerol tube and inoculate it into BHI liquid medium containing 10% fetal bovine serum. Incubate it anaerobically at 37°C. Centrifuge the cultured bacterial solution to remove the supernatant, and then adjust the concentration of the bacterial solution to about 1.0×10 7 CFU / mL as the GV working bacterial solution.

[0159] 400 μL of Lactobacillus and GV working bacterial solution were respectively inoculated into 40 ml of BHI liquid medium containing 10% fetal bovine serum. GV was inoculated alone as a blank control group, with 2 replicates in each group. They were cultured in an anaerobic workstation and sampled at 27 h after culture. The viable count of GV was detected by fluorescence quantitative qPCR using GV-specific probe primers. The viable count of GV was detected after co-culturing Lactobacillus crispatus with GV for 27 h. The experimental results are shown in Table 9. After co-culturing Lactobacillus crispatus HY1467 with GV for 27 h, the inhibition rate reached 88%, indicating that this strain has a strong inhibitory effect on the growth of GV.

[0160] Table 9 Results of the antibacterial experiment of co-culturing Lactobacillus with GV

[0161]

[0162] (3) Biofilm clearance experiment

[0163] 1) Lactobacillus on GV biofilm clearance experiment

[0164] The bacterial solution after culturing GV was adjusted to 1.0×10 7 CFU / mL and inoculated into a 96-well plate. A total of 2 groups were set up, with 4 parallels in each group. The two groups were respectively added with the same volume of blank MM liquid medium (modified MRS broth, composition: peptone 10 g / L, beef extract 5.0 g / L, yeast extract 4.0 g / L, glucose 15 g / L, K2HPO4 2.0 g / L, ammonium citrate 1.0 g / L, sodium acetate 2.5 g / L, magnesium sulfate 0.2 g / L, manganese sulfate 0.05 g / L) and the supernatant after culturing Lactobacillus crispatus HY1467. They were cultured in a 37°C anaerobic workstation for 24 h.

[0165] After the culture ended, the inhibitory effect of Lactobacillus crispatus HY1467 on GV biofilm formation was determined by the microplate crystal violet staining method. The experimental results are shown in Table 10. The supernatant of Lactobacillus crispatus HY1467 had a strong inhibitory effect on GV biofilm formation, reaching 90.9%. Therefore, it can effectively inhibit the growth of GV.

[0166] Table 10 Results of the Lactobacillus on GV biofilm clearance experiment

[0167] Strain Inhibitory rate of Lactobacillus supernatant on GV biofilm formation Lactobacillus crispatus HY1467 90.9％±1.9％

[0168] 2) Lactobacillus on CA biofilm clearance experiment

[0169] Biofilm clearance inhibition experiment: The bacterial solution after culturing CA was adjusted to 1.0×10 7CFU / mL, 100 μL was taken and inoculated into a 96-well plate. A total of 2 groups were set up, with 4 parallels in each group. The same volume of Sabouraud dextrose broth and the supernatant of Lactobacillus were added to the two groups respectively. It was placed in an anaerobic workstation at 37 °C for 24 h. After the cultivation, the inhibitory effect of Lactobacillus on the formation of CA biofilm was determined by the microplate crystal violet staining method.

[0170] Biofilm removal experiment: The bacterial liquid after culturing CA was adjusted to 1.0×10 7 CFU / mL, inoculated into a 96-well plate. A total of 2 groups were set up, with 4 parallels in each group. It was placed in an anaerobic workstation at 37 °C for 24 h. After 24 h of cultivation, the mixture in the wells was discarded and washed with sterile PBS. The same volume of MM medium (modified MRS broth, the composition of the components was: peptone 10 g / L, beef extract 5.0 g / L, yeast extract 4.0 g / L, glucose 15 g / L, K2HPO4 2.0 g / L, ammonium citrate 1.0 g / L, sodium acetate 2.5 g / L, magnesium sulfate 0.2 g / L, manganese sulfate 0.05 g / L) and the supernatant of Lactobacillus were added to each group respectively, and it was placed at 37 °C for 24 h. After the cultivation, the microplate crystal violet staining method was used to determine the removal effect of the Lactobacillus supernatant on the mature CA biofilm.

[0171] The experimental results are shown in Table 11. Compared with the removal effect on the formed CA biofilm, the inhibitory effect of this Lactobacillus crispatus HY1467 on the formation of CA biofilm was stronger, and the inhibition rate could reach 75.2%.

[0172] Table 11 Experimental results of the removal of CA biofilm by Lactobacillus

[0173]

[0174] (4) Cell adhesion experiment

[0175] ① Preparation of working bacterial liquid: Cultivate Lactobacillus, detect the OD 600 value of the bacterial liquid. The cultured Lactobacillus culture solution was centrifuged at 4 °C and 4000 rpm for 5 min, the supernatant was discarded, and it was washed repeatedly with PBS three times. Finally, the Lactobacillus was resuspended with MEM complete medium (purchased from Zhongqiao Xinzhou). An appropriate amount of the resuspended solution was used to detect the viable count by the method of plate spreading, which was L1.

[0176] ② Cell culture: Hela cells were inoculated into a 24-well plate, with 1.5×10 5 cells / mL in each well, and cultured for 16 h until the confluence rate reached 90%. The HeLa cells cultured in the 24-well plate were washed with serum-free MEM medium (purchased from Zhongqiao Xinzhou), and then counted, denoted as C1.

[0177] ③Interaction: Bacteria and cells were inoculated into the cells at a ratio of 100:1, and incubated at 37°C and 5% CO2 for 1.5 hours. The supernatant after centrifugation was added to the cells as a blank control group. After 1.5 hours, the culture fluid in the wells was collected, and the cells in the wells were washed with MEM medium. After that, 100 μL of trypsin was added to each well for digestion, and then MEM complete medium was added to terminate the reaction. The suspension was collected, and a portion of the cell count C2 was taken, and the number of live Lactobacillus adhering to the cells was detected by the plate coating method L2.

[0178] ④ Calculate the adhesion number and adhesion rate: average Lactobacillus cell adhesion number = L2 / C2.

[0179] The single cell adhesion number of Lactobacillus crispatus HY1467 to Hela cells was 18.69 CFU, indicating that this strain has good adhesion or colonization characteristics to vaginal epithelial cells.

[0180] (5) BV (bacterial vaginosis) animal model efficacy test

[0181] Healthy SPF Balb / c mice, female, 6-8 weeks old, were used for modeling. After adaptive culture, the animals were randomly divided into model group (M), experimental group (Lactobacillus crispatus HY1467) and positive control group (DJS), 8 mice in each group. Before pathogenic bacteria inoculation, animals in each group were pretreated with subcutaneous injection of estradiol benzoate injection, and then GV (20 μl) was administered vaginally to establish BV pathogenic bacteria model. After successful modeling, the experimental group was given Lactobacillus crispatus HY1467 solution (1×10 10 CFU / mL, 20 μL), and the positive control group was given an equal amount of Lactobacillus delbrueckii solution (Dingjunshengzhong strain, 1×10 10 CFU / mL, 20μL), and the model group was treated with an equal volume of saline. After the treatment, each animal was lavaged with 50μL / time PBS, 4 times / animal, and the vagina was lavaged. The fluid was collected and placed in a 1.5mL Eppendorf tube and frozen at -80℃. The qPCR method was used to detect the GV load in the lavage fluid, and then the difference in the GV load in the lavage fluid between the groups was compared.

[0182] The experimental results are as follows Figure 6 The experimental results showed that the use of Lactobacillus crispatus HY1467 to treat BV-infected animal models significantly reduced the GV content in the vagina, and the therapeutic effect was significantly better than that of the positive drug (DJS), indicating that the strain has a good therapeutic effect on BV in mice.

[0183] (6) VVC (vaginal candidiasis) animal model efficacy test

[0184] Healthy SPF-grade Balb / c mice, female, 6 - 8 weeks old, were used for modeling. The animals were adaptively cultured and then randomly divided into groups of 8 each, including a model group (M), an experimental group (Lactobacillus crispatus HY1467), and a positive control group (Metronidazole, Clotrimazole and Chlorhexidine Acetate Suppository). Each group was pretreated with subcutaneous injection of estradiol benzoate injection; CA (15 μL / mouse) was continuously administered from D0 to D2, and from D3 - D7, the experimental group was given Lactobacillus crispatus HY1467 (5×10 9 CFU / mL, 20 μL) vaginally every day, the positive control group was given Metronidazole, Clotrimazole and Chlorhexidine Acetate Suppository (30 mg), and the model group was given an equal volume of normal saline (20 μL). On D8, the vagina was lavaged, and the lavage fluid was diluted and spread on a Candida albicans identification medium (chromogenic medium). After culturing at 37 °C for 48 h, the number of green colonies on the culture dish was observed and counted. One-way ANOVA was performed using GraphPad Prism 5 software, and statistical significance was set at P < 0.05.

[0185] The experimental results are as Figure 7 shown. The results showed that compared with the model group, the content of pathogenic bacteria in the vaginal lavage fluid of the Lactobacillus crispatus HY1467 group was significantly reduced after treatment, which was equivalent to the therapeutic effect of the positive drug Metronidazole, Clotrimazole and Chlorhexidine Acetate Suppository, indicating that this strain has a good therapeutic effect on VVC in mice.

[0186] In the description of this specification, the descriptions referring to terms such as "one embodiment", "some embodiments", "example", "specific example", or "some examples" mean that the specific features, structures, materials, or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described can be combined in a suitable manner in any one or more embodiments or examples. In addition, without contradiction, those skilled in the art can combine and combine the different embodiments or examples described in this specification and the features of different embodiments or examples.

[0187] Although the embodiments of the present invention have been shown and described above, it can be understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those of ordinary skill in the art can make changes, modifications, substitutions, and variations to the above embodiments within the scope of the present invention.

Claims

1. A Lactobacillus crispatus, characterized in that, It was deposited with the China General Microbiological Culture Collection Center on February 7, 2023, and the deposit number is CGMCC No. 26503.

2. A Lactobacillus crispatus, characterized in that, The 16S rDNA of the Lactobacillus crispatus has one of the following nucleotide sequences: (1) The nucleotide sequence shown in SEQ ID NO: 1; (2) A nucleotide sequence having at least 99.8%, 99.9% or higher homology with the nucleotide sequence shown in SEQ ID NO: 1; (3) A nucleotide sequence having one or more, such as 1, 2, 3, 4, 5 or more nucleotide substitutions, deletions or insertions in the nucleotide sequence shown in SEQ ID NO: 1; Preferably, the 16S rDNA gene sequence of the Lactobacillus crispatus comprises the nucleotide sequence shown in SEQ ID NO:

1.

3. A primer set for detecting Lactobacillus crispatus according to claim 1 or 2, characterized in that, It includes a forward primer and a reverse primer; The forward primer has the nucleotide sequence shown in SEQ ID NO: 2; The reverse primer has the nucleotide sequence shown in SEQ ID NO:

3.

4. A microbial preparation, characterized in that, It comprises the Lactobacillus crispatus as claimed in claim 1 or 2.

5. The microbial agent according to claim 4, wherein It further includes a pharmaceutically acceptable carrier or excipient.

6. A single-dose preparation, characterized in that, including 1×10 6 ~1×10 10 CFU Lactobacillus crispatus as claimed in claim 1 as an active ingredient.

7. Use of the Lactobacillus crispatus as claimed in claim 1 or 2, the microbial preparation as claimed in claim 4 or 5, or the single-dose preparation as claimed in claim 6 in the preparation of a drug for treating and / or preventing vaginal pathogenic bacteria infection or related diseases caused by vaginal pathogenic bacteria infection.

8. Use of the Lactobacillus crispatus as claimed in claim 1 or 2, the microbial preparation as claimed in claim 4 or 5, or the single-dose preparation as claimed in claim 6 in the preparation of a drug for inhibiting vaginal pathogenic bacteria.

9. The use according to claim 7 or 8, characterized in that, The pathogenic bacteria are selected from at least one of Gardnerella vaginalis, Escherichia coli, Staphylococcus aureus, Atopobium vaginae, Prevotella bivia and Candida albicans.

10. The use according to claim 7 or 8, characterized in that The vaginal pathogenic bacteria are selected from at least one of Gardnerella vaginalis, Escherichia coli, Staphylococcus aureus and Candida albicans.

11. Application of the Lactobacillus crispatus as claimed in claim 1 or 2, the microbial preparation as claimed in claim 4 or 5, or the single-dose preparation as claimed in claim 6 in the preparation of a product for regulating vaginal flora balance.

12. A molecular marker of Lactobacillus crispatus according to any one of claims 1 or 2, characterized in that, The molecular marker comprises a nucleotide sequence selected from one of the following: (1) The nucleotide sequence shown in SEQ ID NO: 24; (2) A nucleotide sequence having at least 97%, 98%, 99% or higher homology with the nucleotide sequence shown in SEQ ID NO: 24; (3) A nucleotide sequence having one or more, such as 1, 2, 3, 4, 5 or more nucleotide substitutions, deletions or insertions in the nucleotide sequence shown in SEQ ID NO:

24.

13. The molecular marker according to claim 12, wherein The molecular marker has the nucleotide sequence shown in SEQ ID NO:

24.

14. The molecular marker according to claim 12, wherein The primer of the molecular marker includes the primer group as claimed in claim 3.

15. A method for detecting Lactobacillus crispatus according to claim 1 or 2, characterized in that, It includes: The DNA of the strain to be detected is amplified by using the primer group as claimed in claim 3 to obtain the Lactobacillus crispatus as claimed in claim 1 or 2.

16. The method according to claim 15, wherein The product of the amplification treatment has the nucleotide sequence shown in SEQ ID NO: 24, which is an indication that the strain to be detected is Lactobacillus crispatus as claimed in claim 1 or 2.

17. The method according to claim 16, wherein It includes the following steps: extracting a DNA sample from the strain to be detected, performing PCR amplification treatment on the DNA sample using the primer set as claimed in claim 3, and then comparing the amplification result with the molecular marker in claim 12, so as to identify whether the strain to be detected is Lactobacillus crispatus as claimed in claim 1 or 2.

18. Use of the molecular marker as claimed in claim 12 for identifying and detecting Lactobacillus crispatus as claimed in claim 1 or 2.

Images