Anti-aging compound probiotics and application thereof
The anti-aging complex probiotics combined with specific proportions have significantly improved the antioxidant enzyme activity, solved the problem of poor effect of existing probiotic products, and achieved significant anti-aging and antioxidant effects.
Patent Information
- Application Number
- CN202510492251.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-18
- Publication Date
- 2025-07-18
AI Technical Summary
The existing anti-aging probiotic products have not been ideal for their effectiveness and are difficult to meet the practical application needs.
Complex probiotics of Bifidobacter brevis TG030, Lactobacillus plantarum TG026, Pilocona lacticococcus TG005, C. rhamnosus TG013, Lactobacillus fermented mucinous TG018 and Staphylococcus xylose TG022 were used to form a lyophilized preparation in combination according to specific proportions to prepare anti-aging and antioxidant products.
It significantly improves the activity of antioxidant enzymes in vitro, enhances antioxidant defense capabilities, slows down the aging process, improves the aging condition, and prolongs healthy lifespan.
Smart Images

Figure CN120330098A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to an anti-aging composite probiotic and application thereof, belonging to the technical field of microorganisms. Background Art
[0002] Aging is an inevitable physiological process, an inevitable law of the life process, and a high-risk factor for some major diseases (such as tumors, diabetes, cardiovascular diseases, and neurodegenerative diseases). Therefore, aging has always been a long-lasting research field for scientists. With the improvement of global medical standards and public health conditions, the average life expectancy of human beings has been significantly extended, and population aging has become a global trend. With the deepening of the problem of global population aging, the extension of life span itself is a happy thing, but it is accompanied by various aging diseases that have gradually become important diseases that threaten people's lives and health, and the economic burden on families and countries is increasing. Therefore, the study of the mechanism of aging and delaying aging is valued by many scholars.
[0003] However, the anti-aging effects of anti-aging probiotic products in the current prior art are not ideal enough and are difficult to meet the needs of actual applications. Summary of the invention
[0004] The present invention provides an anti-aging composite probiotic and application thereof, which can effectively solve the above problems.
[0005] An anti-aging composite probiotic comprises: Bifidobacterium breve TG030, Lactobacillus plantarum TG026, Pediococcus acidilactici TG005, Lactobacillus rhamnosus TG013, Lactobacillus mucilaginosus TG018, and Staphylococcus xylosus TG022; the ratio of the live bacteria amount is 0.5-1.5: 0.5-1.5: 1.5-2.5: 0.5-1.5: 0.5-1.5: 1.5-2.5.
[0006] In some embodiments, the anti-aging composite probiotics include: Bifidobacterium breve TG030, Lactobacillus plantarum TG026, Pediococcus acidilactici TG005, Lactobacillus rhamnosus TG013, Lactobacillus fermentum TG018, and Staphylococcus xylosus TG022; the ratio of the amount of live bacteria is 1:1:2:1:1:2.
[0007] In some embodiments, the deposit number of the Bifidobacterium breve TG030 is CCTCCNO:
[0008] M20232503, the preservation number of Lactobacillus plantarum TG026 is CCTCC NO: M 20231024, the preservation number of Pediococcus acidilactici TG005 is CCTCC NO: M 20241349, the preservation number of Lactobacillus rhamnosus TG013 is CCTCC NO: M2023036, the preservation number of Lactobacillus fermentans TG018 is CCTCC NO: M2023514, and the preservation number of Staphylococcus xylosus TG022 is CCTCC NO: M2023516.
[0009] In some embodiments, the anti-aging composite probiotics further include pharmaceutically acceptable excipients.
[0010] In some embodiments, the anti-aging composite probiotics are freeze-dried preparations.
[0011] A use of the anti-aging composite probiotic in the preparation of anti-aging products.
[0012] An application of the anti-aging composite probiotic in the preparation of antioxidant products.
[0013] In some embodiments, the product comprises a health food or a medicine.
[0014] The beneficial effects of the present invention are:
[0015] The anti-aging composite probiotics of the present invention have a unique advantage in that each probiotic is derived from a natural strain of the human intestine, which not only ensures its stability and safety in the human body, but also greatly reduces potential immune rejection reactions, making the composite probiotics more reliable and effective during application.
[0016] The anti-aging composite probiotics of the present invention achieves synergistic effects among the strains by screening and scientifically compounding multiple functional strains. This compounding method has shown significant antioxidant enzyme activity in in vitro experiments, can effectively remove free radicals, and slow down the cell aging process, thus showing unique application potential in the anti-aging field.
[0017] The anti-aging composite probiotics of the present invention also showed excellent therapeutic effects in animal experiments. Through experimental verification of aging model mice, the composite probiotics can significantly increase the antioxidant enzyme activity in the serum of mice and enhance their antioxidant defense ability in vivo; at the same time, it can also effectively reduce the expression level of inflammation-related indicators in the kidney tissue of mice and reduce the inflammatory response, thereby improving the aging condition of mice as a whole and prolonging their healthy lifespan. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] To more clearly illustrate the technical solutions of the embodiments of the present invention, the following will briefly introduce the drawings required for the embodiments. It should be understood that the following drawings only show some embodiments of the present invention, and therefore should not be regarded as limiting the scope. For those of ordinary skill in the art, without creative efforts, other related drawings can also be obtained based on these drawings.
[0019] Figure 1 Determination of the catalase (CAT) enzyme activity of the composite probiotic TGMIX in Example 2.
[0020] Figure 2 Determination of the superoxide dismutase (SOD) enzyme activity of the composite probiotic TGMIX in Example 2.
[0021] Figure 3 Determination of the catalase (CAT) enzyme activity of mouse serum in Example 3.
[0022] Figure 4 Determination of the malondialdehyde (MDA) concentration of mouse serum in Example 3.
[0023] Figure 5 Determination of the superoxide dismutase (SOD) enzyme activity of mouse serum in Example 3.
[0024] Figure 6 Determination of the relative expression level of TNF-α in mouse kidney tissue in Example 3.
[0025] Figure 7 Determination of the relative expression level of IL-10 in mouse kidney tissue in Example 3.
[0026] Figure 8 Microscopic examination diagram of mouse kidney tissue sections in Example 3. Detailed implementation manners
[0027] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are some, but not all, of the embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of protection of the present invention. Therefore, the following detailed description of the embodiments of the present invention provided in the drawings is not intended to limit the scope of the claimed invention, but merely represents the selected embodiments of the present invention.
[0028] An embodiment of the present invention provides an anti-aging compound probiotic TGMIX, comprising: Bifidobacterium breve TG030, Lactiplantibacillus plantarum TG026, Pediococcus acidilactici TG005, Lactobacillus rhamnosus TG013, Lactobacillus mucosae TG018, Staphylococcus xylosus TG022; in a viable cell count ratio of 0.5 - 1.5:0.5 - 1.5:1.5 - 2.5:0.5 - 1.5:0.5 - 1.5:1.5 - 2.5. Each bacterium is derived from the human intestine, with stability and safety. Through the compounding of functional strains, a significant synergistic effect is produced, and outstanding antioxidant enzyme activity is shown in in vitro experiments. This compound functional probiotic TGMIX has a significant therapeutic effect on senescence model mice, improving the antioxidant enzyme activity in the mouse serum and reducing the expression level of renal tissue inflammation.
[0029] In some embodiments, the anti-aging compound probiotic comprises: Bifidobacterium breve TG030, Lactiplantibacillus plantarum TG026, Pediococcus acidilactici TG005, Lactobacillus rhamnosus TG013, Lactobacillus mucosae TG018, Staphylococcus xylosus TG022; in a viable cell count ratio of 1:1:2:1:1:2. Different strains in the TGMIX compound probiotic cooperate with each other under a specific ratio to produce a synergistic effect. For example, Bifidobacterium breve TG030 and Lactiplantibacillus plantarum TG026 may regulate the balance of the intestinal flora, provide a suitable growth environment for other strains, and promote their growth and metabolism, thereby improving the overall antioxidant capacity. The metabolites of different strains complement each other and act together on the synthesis and activity regulation of superoxide dismutase. For example, Pediococcus acidilactici TG005 and Lactobacillus rhamnosus TG013 may produce some precursor substances or cofactors, which can promote the synthesis of superoxide dismutase or improve its stability under a specific ratio, thereby enhancing its enzyme activity. Under a specific ratio, the TGMIX compound probiotic can significantly improve the activity of superoxide dismutase, thereby more effectively scavenging superoxide anion free radicals in the body, reducing oxidative stress damage, and delaying cell senescence. This provides technical support for the development of probiotic products with stronger antioxidant effects.
[0030] In some embodiments, the preservation number of Bifidobacterium breve TG030 is CCTCC NO: M20232503, the preservation number of Lactiplantibacillus plantarum TG026 is CCTCC NO: M20231024, the preservation number of Pediococcus acidilactici TG005 is CCTCC NO: M20241349, the preservation number of Lactobacillus rhamnosus TG013 is CCTCC NO: M2023036, the preservation number of Lactobacillus mucosae TG018 is CCTCC NO: M2023514, and the preservation number of Staphylococcus xylosus TG022 is CCTCC NO: M2023516.
[0031] In some embodiments, the anti-aging compound probiotics further comprise pharmaceutically acceptable excipients. Pharmaceutically acceptable excipients play various roles in the preparation, such as fillers can increase the volume of the preparation to facilitate its shaping; binders help the adhesion of particles and improve the stability of the preparation; disintegrants can cause the preparation to quickly disintegrate in vivo and promote the release of active ingredients; lubricants can reduce the friction between particles to ensure the smooth progress of the production process; protectants can protect the active ingredients of probiotics and prevent them from being inactivated by external factors during storage and transportation; suspending agents can help probiotics disperse evenly in the liquid and improve their bioavailability in vivo.
[0032] In some embodiments, the anti-aging compound probiotics are freeze-dried preparations. The freeze-drying process can reduce the water content to an extremely low level, reduce the growth of microorganisms and the occurrence of chemical reactions, thereby extending the shelf life of the product and ensuring the quality stability during storage and transportation.
[0033] An embodiment of the present invention provides an application of the anti-aging compound probiotics in the preparation of anti-aging products.
[0034] An embodiment of the present invention provides an application of the anti-aging compound probiotics in the preparation of antioxidant products.
[0035] In some embodiments, the product includes health foods or drugs.
[0036] Example 1 Preparation of Compound Probiotics
[0037] Take Bifidobacterium breve TG030, Lactiplantibacillus plantarum TG026, Pediococcus acidilactici TG005, Lactobacillus rhamnosus TG013, Lactobacillus fermentum TG018, Staphylococcus xylosus TG022, and obtain fermentation broths after culturing them in a fermentation medium at an inoculation amount of 1% respectively. The important components of the fermentation medium are as follows: tryptone 10.0 g / L; sodium chloride 5.0 g / L; disodium hydrogen phosphate 2.5 g / L; glucose 2.0 g / L; beef heart infusion 500.0 mL / L; yeast extract 5.0 g / L; L-cysteine 0.5 g / L.
[0038] Centrifuge the fermentation broths of the six obtained strains respectively, collect the bacterial cells, and resuspend them with physiological saline to obtain bacterial suspensions. According to the ratio of viable cell counts of TGMIX①(1:1:1:1:1:1), TGMIX②(1:1:1:1:1:2), TGMIX③(1:1:2:1:1:1), TGMIX④(1:1:2:1:1:2), compound the bacterial suspensions into compound probiotics.
[0039] Add the compound probiotic TGMIX to the intestinal flora cryoprotectant for freeze-drying at a ratio of 1:8 (w:v / g:mL) based on the weight of the bacterial sludge (take 50 g of food-grade whey protein, 50 g of food-grade collagen peptide, 30 g of food-grade maltodextrin, 60 g of food-grade galactose, 10 g of food-grade lysine, dissolve and mix well in 1000 mL of normal saline, then sterilize by high temperature and high pressure. After taking it out and allowing it to stand and cool at room temperature, place it in a 4°C refrigerator for later use). After vortex mixing, place it in a vacuum freeze-dryer for freeze-drying treatment, and perform freeze-drying according to the procedure in Table 1 to make TGMIX freeze-dried powder.
[0040] Table 1 Formula for the Freeze-Drying Procedure of Intestinal Flora
[0041]
[0042] The preservation information of the probiotics used in this example is as follows:
[0043] Bifidobacterium breve TG030 is preserved in the China Center for Type Culture Collection, with the preservation number CCTCC NO: M20232503, and the preservation time is December 8, 2023 (see Chinese Patent CN 118599716A).
[0044] Lactiplantibacillus plantarum TG026 is preserved in the China Center for Type Culture Collection, with the preservation number CCTCC NO: M20231024, and the preservation time is June 15, 2023.
[0045] Pediococcus acidilactici TG005 is preserved in the China Center for Type Culture Collection, with the preservation number CCTCC NO: M20241349, and the preservation date is June 24, 2024 (see Chinese Patent CN 119345237A).
[0046] Lactobacillus rhamnosus TG013 is preserved in the China Center for Type Culture Collection, with the preservation number CCTCC NO: M2023036, and the preservation time is January 5, 2023, located at the preservation center of Wuhan University (see Chinese Patent CN117247873 A).
[0047] Lactobacillus mucosae TG018 is preserved in the China Center for Type Culture Collection, with the preservation number CCTCC NO: M2023514, and the preservation time is April 10, 2023, located at the preservation center of Wuhan University (see Chinese Patent CN117778236 A).
[0048] Staphylococcus xylosus TG022 was deposited at the China Center for Type Culture Collection, with the deposit number CCTCC NO: M2023516. The depository is located at the Culture Collection Center of Wuhan University, and the deposit date was April 10, 2023 (see Chinese Patent CN116904344 A).
[0049] Example 2 Determination of the antioxidant function of the composite probiotic TGMIX
[0050] After the composite probiotic TGMIX was precisely proportioned and evenly mixed, the bacterial liquid concentration was carefully diluted to 1×10^9 cfu / mL for subsequent determination work. For effective comparative analysis, six single probiotics were each taken with a bacterial suspension of the same concentration of 1×10^9 cfu / mL for parallel determination. In this experiment, a superoxide dismutase (SOD) colorimetric assay kit (provided by ELabscience) and a catalase (CAT) colorimetric assay kit (also provided by ELabscience) were used to conduct detailed enzyme activity determinations. The specific test results are as Figure 1 and Figure 2 shown, with the data being clear and intuitive.
[0051] From Figure 1 it can be clearly seen that the specific values of the catalase (CAT) enzyme activity of each sample are as follows: TGMIX① is 17.24 U / mL, TGMIX② is 29.04 U / mL, TGMIX③ is 30.07 U / mL, TGMIX④ is as high as 42 U / mL, TG022 is 8.63 U / mL, TG030 is 11.58 U / mL, TG013 is 1.84 U / mL, TG018 is 2.21 U / mL, TG005 is 3.51 U / mL, and TG026 is 3.76 U / mL. These data reflect the differences in the performance of each strain in terms of CAT enzyme activity. Among them, the sum of the CAT enzyme activity values of each strain is less than that of the composite probiotic TGMIX, indicating that in the composite probiotic TGMIX, each bacterium plays a synergistic effect to jointly increase the CAT enzyme activity, and among different composite ratios, the CAT enzyme activity of 1:1:2:1:1:2 (MIXTG④) is the highest.
[0052] From Figure 2It can be learned in detail that the specific values of the superoxide dismutase (SOD) enzyme activity of each sample are as follows: TGMIX① is 1671.67 U / mL, TGMIX② is 1845.34 U / mL, TGMIX③ is 1904.81 U / mL, TGMIX④ is as high as 2370.31 U / mL, TG022 is 1256.52 U / mL, TG030 is 671.15 U / mL, TG013 is 1129.01 U / mL, TG018 is 220.67 U / mL, TG005 is 967.33 U / mL, and TG026 is 240.12 U / mL. These data demonstrate the specific performance of each strain in terms of SOD enzyme activity and the synergistic effect exhibited by the compound probiotics. Among different compound ratios, the SOD enzyme activity of 1:1:2:1:1:2 (MIXTG④) is the highest.
[0053] Through the scientific and reasonable compounding of these six probiotics, the antioxidant effect of TGMIX has been significantly improved, which fully demonstrates the superiority of compound probiotics in enhancing antioxidant capacity.
[0054] Example 3 Construction and treatment of senile mouse model
[0055] Thirty male mice of the C57BL / 6J strain, all 6 weeks old, were selected and evenly divided into 3 experimental groups according to their body weights for 10 days of adaptive feeding to ensure that the mice adapted to the experimental environment. After the formal start of the experiment, each group of mice was treated with intraperitoneal injection and freeze-dried powder gavage every day, and the entire experimental period lasted for 8 weeks.
[0056] The specific grouping and treatment methods are as follows:
[0057] ① Con group (blank control group): Intraperitoneally injected with 200 μL of normal saline every day, and at the same time gavaged with 200 μL of normal saline as the baseline control for the experiment;
[0058] ② Mod group (model group): Intraperitoneally injected with 200 μL of D-gal (D-galactose) every day and gavaged with 200 μL of normal saline to construct a senescence model;
[0059] ③ TGMIX group (treatment and prevention group): Intraperitoneally injected with 200 μL of D-gal every day and gavaged with 200 μL of TGMIX compound freeze-dried bacteria powder (concentration 5×10^9 cfu / mL) to evaluate the treatment effect of compound functional probiotics.
[0060] To evaluate the serum antioxidant indexes of senescence model mice, blood samples of mice in each group were collected by orbital blood sampling. Subsequently, the blood samples were centrifuged (centrifugation speed: 3000 rpm, duration: 10 min) to separate and obtain the serum. According to the operation instructions of the Elabscience kit, the contents of CAT (catalase), SOD (superoxide dismutase), and MDA (malondialdehyde) in the serum were measured.
[0061] The specific measurement results are as follows:
[0062] ① Catalase activity (CAT): 70.22 U / mL in the Con group (blank control group), 57.67 U / mL in the Mod group (model group), and 83.30 U / mL in the TGMIX group (treatment and prevention group) (the results are shown in Figure 3 );
[0063] ② Malondialdehyde content (MDA): 64.78 μmol in the Con group (blank control group), 118.14 μmol in the Mod group (model group), and 98.60 μmol in the TGMIX group (treatment and prevention group) (the results are shown in Figure 4 );
[0064] ③ Superoxide dismutase activity (SOD): 7281.38 U / mL in the Con group (blank control group), 6623.06 U / mL in the Mod group (model group), and 7274.26 U / mL in the TGMIX group (treatment and prevention group) (the results are shown in Figure 5 ).
[0065] The experimental results show that the composite functional probiotic TGMIX can effectively relieve the oxidative stress state of the senescence mouse model, significantly enhance the activities of SOD and CAT in the mouse serum, and at the same time significantly reduce the MDA content, showing its potential application value in anti-aging.
[0066] Detection of inflammatory factors in the kidney tissue of senescence model mice
[0067] Extraction of RNA and reverse transcription synthesis of cDNA from the kidney tissue of senescent mice: After cutting and weighing a part of the mouse kidney tissue (weight < 10 mg), the operation was carried out according to the instructions of the total RNA extraction kit (FastPure Cell / Tissue Total RNA Isolation Kit V2). After RNA extraction, the RNA concentration and OD260 / OD280 ratio were measured using an ultraviolet spectrophotometer.
[0068] The extracted RNA (total amount < 500 ng) was reverse-transcribed according to the instructions of the reverse transcription kit (Perfect Real Time). After completion, the cDNA samples were stored at -80 °C.
[0069] According to the SYBR qPCR SuperMix Plus kit instructions, the QPCR reaction system was prepared, and primers for TNF-α, IL-10, and β-actin (internal reference) were added respectively for QPCR quantitative experiments. The relative expression levels of inflammatory factors in kidney tissues were calculated by the 2^-(ΔΔCt) method.
[0070] Primer sequences:
[0071] β-actin-F: GGCTGTATTCCCCTCCATCG (SEQ ID NO:1);
[0072] β-actin-R: CCAGTTGGTAACAATGCCATGT (SEQ ID NO:2);
[0073] Tnf-α-F: AAGGGAGAGTGGTCAGGTTGCC (SEQ ID NO:3);
[0074] Tnf-α-R: TGTGAGGAAGGCTGTGCATTGC (SEQ ID NO:4);
[0075] IL-10-F: GCCACATGCTCCTAGAGCTG (SEQ ID NO:5);
[0076] IL-10-R: CAGCTGGTCCTTTGTTTGAAA (SEQ ID NO:6).
[0077] ① As Figure 6 shown, the relative expression level of TNF-α in the Mod group was 5.49, and that in the TGMIX group was 0.85. The expression level of TNF-α in the Mod group increased significantly, while compared with the Mod group, the expression level of TNF-α in the TGMIX group decreased significantly.
[0078] ② As Figure 7 shown, the relative expression level of IL-10 in the Mod group was 0.28, and that in the TGMIX group was 0.62. The expression level of IL-10 in the TGMIX group was significantly higher than that in the Mod group. Through intragastric preventive treatment with TGMIX, the inflammatory effects caused by the aging model in mice could be effectively alleviated.
[0079] Staining of kidney tissue sections of aging model mice
[0080] The mouse kidney tissues were placed in a 50 mL centrifuge tube containing 4% paraformaldehyde for fixation for 72 h to prepare kidney pathological sections. The mouse kidney tissues of different groups in the 50 mL centrifuge tube fixed with 4% paraformaldehyde were paraffin-embedded, cut into sections of 5-7 microns, and observed under an optical microscope after HE staining.
[0081] As Figure 8 shown, observing the cortical layer of the kidney tissue sections, the capillary endothelial cells of the glomeruli in the Mod group mice were of different sizes and irregular shapes, arranged chaotically, and showed vacuolation and cell atrophy. The capillary endothelial cells of the glomeruli in the Con group and the TGMIX group were arranged tightly and regularly.
[0082] The above are only the preferred embodiments of the present invention and are not used to limit the present invention. For those skilled in the art, the present invention can have various changes and modifications. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.
Claims
1. An anti-aging compound probiotic, characterized in that, Comprising: Bifidobacterium breve TG030, Lactiplantibacillus plantarum TG026, Pediococcus acidilactici TG005, Lactobacillus rhamnosus TG013, Lactobacillus mucosae TG018, Staphylococcus xylosus TG022; in a ratio of viable cell counts of 0.5 - 1.5:0.5 - 1.5:1.5 - 2.5:0.5 - 1.5:0.5 - 1.5:1.5 - 2.
5.
2. The anti-aging compound probiotic according to claim 1, wherein Comprising: Bifidobacterium breve TG030, Lactiplantibacillus plantarum TG026, Pediococcus acidilactici TG005, Lactobacillus rhamnosus TG013, Lactobacillus mucosae TG018, Staphylococcus xylosus TG022; in a ratio of viable cell counts of 1:1:2:1:1:
2.
3. The anti-aging composite probiotics according to claim 1 or 2, characterized in that, The preservation number of Bifidobacterium breve TG030 is CCTCC NO: M 20232503, the preservation number of Lactiplantibacillus plantarum TG026 is CCTCC NO: M20231024, the preservation number of Pediococcus acidilactici TG005 is CCTCC NO: M 20241349, the preservation number of Lactobacillus rhamnosus TG013 is CCTCC NO: M2023036, the preservation number of Lactobacillus mucosae TG018 is CCTCC NO: M 2023514, and the preservation number of Staphylococcus xylosus TG022 is CCTCC NO: M 2023516.
4. The anti-aging compound probiotics according to any one of claims 1 to 3, characterized in that, It further comprises a pharmaceutically acceptable excipient.
5. The anti-aging compound probiotics according to claim 1, characterized in that, The anti-aging compound probiotic is a freeze-dried preparation.
6. Use of the anti-aging compound probiotic according to any one of claims 1 to 5 in the preparation of an anti-aging product.
7. Use of the anti-aging compound probiotic according to any one of claims 1 to 5 in the preparation of an antioxidant product.
8. The application according to claim 6 or 7, characterized in that, The product includes a health food or a drug.
Citation Information
Patent Citations
Staphylococcus xylosus with antioxidant effect and application thereof
CN116904344A
Lactobacillus rhamnosus with antihypertensive effect and application thereof
CN117247873A
Lactobacillus mucilaginosus with phytic acid reducing function and application of lactobacillus mucilaginosus
CN117778236A
Bifidobacterium breve TG030 for inhibiting colon cancer pathogenic bacteria fusobacterium nucleatum and application
CN118599716A
Application of pediococcus acidilactici
CN119345237A