Application of streptomyces noursei PUNP1 in production of gougerotin

By overexpressing the PUNP1 gene in Streptococcus aliensis, the Streptococcus PUNP1 mutant strain was constructed, and the purine remediation synthesis pathway was optimized, the problem of low production efficiency of glutenacetin was solved, high yield and effective inhibition of yeasts were achieved, and the yield and antibacterial effect of glutenacetin was significantly improved.

CN120330118AActive Publication Date: 2025-07-18INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202510787889.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-13
Publication Date
2025-07-18
Estimated Expiration
2045-06-13

AI Technical Summary

Technical Problem

In the prior art, the production efficiency of glutenacetin is low and the application is limited, making it difficult to achieve high yield and effective secretion in Streptocytica, and its antibacterial effect on yeast is not significant.

Method used

Overexpressing the PUNP1 gene in Streptocytica leucorrhea, constructing the PUNP1 mutant strain of Streptocytica puNP1, optimizing the purine remediation synthesis pathway, accelerating adenosine decomposition and nucleotide recovery, improving the synthesis of glutenacetin, a natural nucleoside product, and introducing recombinant plasmids into Streptocytica through ligation transfer, achieving efficient production of glutenacetin and effective inhibition of yeast.

Benefits of technology

The content of glutenin in the fermentation product was significantly improved, reaching 2.56g/L and 3.74g/L, enhancing the antibacterial ability of red yeast, and improving the metabolic efficiency and cell resistance of bacteria.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120330118A_ABST
    Figure CN120330118A_ABST
Patent Text Reader

Abstract

The invention discloses an application of streptomyces noursei PUNP1 in production of gougerotin, and belongs to the technical field of biology. The preservation number of the streptomyces noorsei PUNP1 is CGMCC (China General Microbiological Culture Collection Center) No.34068, the streptomyces noorsei PUNP1 is obtained by overexpressing a PUNP1 gene in streptomyces albidus, and the nucleotide sequence of the PUNP1 gene is as shown in SEQ ID NO: 1. Experimental verification shows that after the streptomyces noursei PUNP1 is subjected to shake flask fermentation and fermentation tank fermentation, the content of the gougerotin in a fermentation product is as high as 2.56 g / L and 3.74 g / L respectively. The invention also finds that the capability of inhibiting rhodotorula of the glutathione produced by the fermentation of the streptomyces noursei PUNP1 is obviously higher than that of the wild strain, which indicates that the streptomyces noursei PUNP1 can obviously improve the production of the glutathione in the fermentation product. The invention provides a scientific basis for improving the yield and cell resistance of the glutathione produced by the streptomyces albidus.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to the application of a Streptomyces nogalater PUNP1 in the production of gougerotin. Background Art

[0002] Gougerotin is a water-soluble basic nucleoside antibiotic, first isolated from Streptomyces gougerotii, with broad-spectrum antibacterial, anti-tumor, antiviral and antifungal activities. However, its application is limited due to its weak antibacterial efficacy and certain mammalian toxicity (mouse LD 50 about 57 mg / kg). Through 13 13C NMR and total synthesis confirmation, the chemical structure of gougerotin consists of two parts: a nucleoside and a peptide moiety. The biosynthesis is controlled by a gene cluster consisting of about 28.7 kb and 15 genes, among which 13 enzyme-encoding genes, 1 regulatory factor gouR and 1 secreted protein gene are involved. The nucleoside part is formed by coupling cytosine with UDP-glucuronic acid to generate CGA, which is converted into 4-amino-CGA and subjected to amidation modification through the action of GouF, GouA, GouH and GouB; the peptide moiety is mainly composed of D-serine and sarcosine, and is assembled through the coordinated action of GouK, GouJ and GouN, among which gouC and gouD are crucial for the modification of sarcosine residues. Gougerotin exerts antibacterial and anti-tumor effects by competitively binding to ribosomal peptidyl transferase, interfering with peptide chain transfer and blocking protein synthesis. To achieve large-scale production, strategies such as gene cluster engineering, precursor feeding such as the addition of cytosine, serine and glycine, and promoter replacement are adopted to obtain high-yield strains in Streptomyces graminearus, and the transporter gouM is activated by gouR regulation to achieve effective secretion of the product and reduce intracellular toxicity. In addition, the research team of the present invention has previously found that gougerotin is an important active ingredient produced by Streptomyces albireticuli CK-15, which can effectively control plant fungal diseases such as Botrytis cinerea of tomato, Phyllosticta theicola of tea, Rhizoctonia solani of corn, Sclerotinia sclerotiorum of soybean and Botrytis cinerea of grape, and has the potential to be developed into a new agricultural antibiotic.

[0003] Purine-nucleoside phosphorylase is a key enzyme in purine metabolism, catalyzing the reaction of adenosine with inorganic phosphate to generate nucleotides and nucleosides, reducing the cell's dependence on de novo purine synthesis. In addition, in Streptomyces calvu, the key genes nucPUNP1 and the downstream enzyme NucV are involved in the early reactions of nucleoside biosynthesis; in Streptomyces coelicolor, the multiple promoter regulation of the rpsO-PUNP1 operon not only affects PUNP1 expression but also regulates RNA stability, thus maintaining nucleotide balance. Meanwhile, PUNP1 plays a regulatory role in the biosynthesis of natural products in Streptomyces, and its functions also involve mRNA stability and poly(A) tail length regulation, providing new insights into the RNA processing mechanism. Based on the important role of PUNP1 in the genus Streptomyces, it is of great significance to explore its role in different Streptomyces strains, and there is no report on the transformation of Streptomyces CK-15 using PUNP1 yet. Summary of the Invention

[0004] The purpose of the present invention is to provide an application of Streptomyces noursei PUNP1 in the production of gougerotin, so as to solve the problems existing in the above-mentioned prior art. The Streptomyces noursei PUNP1 mutant strain constructed by overexpressing PUNP1 in Streptomyces albus can significantly increase the content of gougerotin in the fermentation product.

[0005] To achieve the above purpose, the present invention provides the following solutions:

[0006] The present invention provides a strain of Streptomyces noursei, and the preservation number of Streptomyces noursei PUNP1 is CGMCC No. 34068, the preservation time is April 1, 2025, the preservation unit is the General Microbiology Center of the China Committee for Culture Collection of Microorganisms, and the preservation address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0007] The present invention also provides a construction method of the above-mentioned Streptomyces noursei PUNP1, including the step of overexpressing the PUNP1 gene in Streptomyces albus. The nucleotide sequence of the PUNP1 gene is as shown in SEQ ID NO: 1, and the preservation number of the Streptomyces albus is CGMCC No. 31251.

[0008] The present invention also provides the application of the above-mentioned Streptomyces noursei PUNP1 in any one of the following:

[0009] (1) Application in the production of gougerotin;

[0010] (2) Application in increasing the yield of gougerotin.

[0011] The present invention also provides the application of the Streptomyces nogalater PUNP1 in any of the following;

[0012] (1) Application in inhibiting yeast;

[0013] (2) Application in preparing a yeast bacteriostatic agent.

[0014] The present invention also provides a yeast bacteriostatic agent containing the Streptomyces nogalater PUNP1.

[0015] The present invention also provides a method for increasing the yield of gougerotin, including fermenting the Streptomyces nogalater PUNP1 and separating and extracting gougerotin from the fermentation broth.

[0016] Preferably, the fermentation medium is any one of the following:

[0017] (1) Comprising components in the following amounts: 30 g of corn flour, 20 g of soybean cake powder, 20 g of glucose, 4 g of ammonium sulfate, 3 g of calcium carbonate and 1 L of distilled water;

[0018] (2) Comprising components in the following concentrations: 50 g / L of glucose, 5.3 g / L of fish meal, 10 g / L of ammonium sulfate, 0.5 g / L of magnesium sulfate, 0.25 g / L of dipotassium hydrogen phosphate, 0.4 g / L of potassium dihydrogen phosphate, 0.03 g / L of ferrous sulfate and 0.04 g / L of zinc sulfate, with a pH of 7.

[0019] Preferably, shake flask fermentation culture is carried out using the fermentation medium shown in (1), the culture temperature is 25 - 30 °C, the rotation speed is 200 - 300 rpm, and the culture time is 70 - 80 h.

[0020] Preferably, fermenter fermentation culture is carried out using the fermentation medium shown in (2), the tank temperature for fermenter fermentation culture is 28 - 30 °C, the tank pressure is 0.03 - 0.05 MPa, and the culture time is 120 - 170 h.

[0021] Preferably, continuous feeding is carried out during the fermenter fermentation culture process, and the feeding parameters include: adjusting the pH value to 6.8 after inoculation, adding ammonia water when the pH value drops to 6.0, and dynamically controlling the pH of the fermentation broth to 6.0 with ammonia water as the alkaline solution; starting to add sugar when the residual sugar content drops to 0.5%, and controlling the residual sugar content in the fermentation broth to 0.5% - 0.8% with pre-sterilized 60% glucose solution; starting to add ammonium sulfate when the ammonia nitrogen concentration drops to 500 mg / L, and controlling the ammonia nitrogen concentration in the fermentation broth to 0.5 - 1.0 g / L with pre-sterilized 40% ammonium sulfate solution.

[0022] The present invention discloses the following technical effects:

[0023] The present invention uses Streptomyces albidoflavus CK-15 as the original starting strain, and overexpresses the PUNP1 gene to obtain a PUNP1 overexpressing strain, Streptomyces noursei PUNP1. By overexpressing the PUNP1 gene, the present invention can optimize the purine salvage synthesis pathway in the starting strain. By accelerating adenosine decomposition and nucleotide recycling, it ensures sufficient nucleotides in the cells, thereby promoting the efficient synthesis of DNA, RNA, and the nucleoside natural product gougerotin, while improving RNA stability and reducing the degradation risk of mRNA under environmental stress. Through experiments, it is confirmed that after shake flask fermentation and fermentor fermentation of Streptomyces noursei PUNP1, the contents of gougerotin in the fermentation products can reach as high as 2.56 g / L and 3.74 g / L respectively, significantly increasing the content of gougerotin in the fermentation products. It is also found that the ability of gougerotin produced by Streptomyces noursei PUNP1 to inhibit Rhodotorula is significantly higher than that of the wild-type strain, indicating that Streptomyces noursei PUNP1 can significantly increase the production of gougerotin in the fermentation products. By overexpressing the PUNP1 gene in Streptomyces albidoflavus CK-15, this strategy is of great significance for improving the metabolic efficiency of the strain, the yield of natural products, and the cell resistance. Brief Description of the Drawings

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0025] Figure 1 It is the amplification diagram of the PUNP1 target fragment; M: DL5000 marker; 1-2: PUNP1 amplification products;

[0026] Figure 2 It is the double digestion diagram of the pLQ646 plasmid; M1: DL5000 marker; M2: DL15000 marker; 1-5: linearized vector; 6: pLQ646 plasmid;

[0027] Figure 3 It is the verification diagram of the PUNP1 overexpressing Streptomyces; M: DL5000 marker; 1-3: PUNP1 overexpressing strains; 4: wild-type Streptomyces albidoflavus CK-15;

[0028] Figure 4 It is the growth phenotype of the PUNP1 overexpressing strain;

[0029] Figure 5Detection results of the yield of gougerotin synthesized by the PUNP1 overexpression strain during fermentation; A: LC-MS detection results of gougerotin synthesized by the overexpression strain during fermentation; B: Determination results of the yield of gougerotin synthesized by the overexpression strain during fermentation; The standard error (SEM) concentration and its standard error bars are shown in the figure (n = 3, three biologically independent samples);

[0030] Figure 6 Dry weight change curve of mycelium of the PUNP1 overexpression strain at different fermentation times;

[0031] Figure 7 Determination results of the antibacterial activity of the fermentation broth of the PUNP1 overexpression strain against Rhodotorula;

[0032] Figure 8 Detection results of the cell concentration (A), residual sugar (B), and ammonia nitrogen content (C) of the PUNP1 overexpression strain during fermentation;

[0033] Figure 9 HPLC detection results of gougerotin of the PUNP1 overexpression strain during fermentation. Detailed implementation manners

[0034] The various exemplary implementation manners of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0035] It should be understood that the terms used in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0036] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0037] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific embodiments of the specification of the present invention, which will be obvious to those skilled in the art. Other embodiments obtained from the specification of the present invention will be obvious to those skilled in the art. The specification and examples of the present invention are merely exemplary.

[0038] Regarding "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.

[0039] The Streptomyces albulus CK-15 involved in the embodiments of the present invention was deposited on July 10, 2024 at the General Microbiological Center of the China Committee for Culture Collection of Microorganisms. The deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 31251. It has also been disclosed in multiple patents, such as: CN118995513B A Streptomyces albulus mutant and its application in the production of gougerotin, CN118995552A A Streptomyces albulus mutant, construction method and application. In addition, after the whole genome of this strain was sequenced, the strain was renamed and classified on NCBI in 2024. Streptomyces albulus CK-15 was classified as Streptomyces noursei strain CK-15 (Genebank accession number: NZ_CP026094.1).

[0040] Some reagents in the embodiments of the present invention: The high-fidelity enzyme Phanta Max Super-Fidelity DNA Polymerase P505-d2 was purchased from Nanjing Novoprotein Science and Technology Co., Ltd., and DNA Maker DL5000 and DNA Maker DL15000 were purchased from TaKaRa Company, Japan.

[0041] Example 1 Construction of PUNP1 overexpression mutant

[0042] 1. Amplification of target fragment

[0043] According to the reported gougerotin gene cluster in Streptomyces graminearus on NCBI, after using local BLAST to find the target gene with high similarity from the genome of Streptomyces albulus CK-15 strain, primers were designed and the target fragment was amplified using the extracted Streptomyces genome.

[0044] Primers used for fragment amplification:

[0045] PUNP1-L: 5’-TGAAGAGGTGACGTCCATATGGTGAACGCATCTGTTACCCC-3’, SEQ ID NO.2;

[0046] PUNP1-R: 5’-CTATGACATGATTACGAATTCCTAGATCTTGCTGAGGACCTGG-3’, SEQ ID NO.3.

[0047] PCR reaction system: 13 μL of ddH2O, 25 μL of 2×PhantaMAX Buffer, 1 μL of dNTP mix, 2 μL of forward primer, 2 μL of reverse primer, 1 μL of Phanta Max Super-Fidelity DNA Polymerase P505-d2, 1 μL of DNA, and 5 μL of 50% DMSO.

[0048] PCR reaction conditions: Pre-denaturation: 95°C for 10 min; Denaturation: 95°C for 30 sec, 31 cycles; Annealing: 65°C for 30 sec, 31 cycles; Extension: 72°C for 30 - 60 sec / kb, 31 cycles; Final extension: 72°C for 10 min.

[0049] The gene PUNP1 was amplified by PCR, and the PCR product was detected by electrophoresis in 1% agarose gel. As Figure 1 shown, the electrophoresis detection result was consistent with the size of the target fragment. The size of the target fragment was 816 bp, and the gene sequence (SEQ ID NO.1) was:

[0050] GTGAACGCATCTGTTACCCCCGACATCGACCCGAAGGGGGCCGCGGACGCCGCGGCCGCCCGCCTGCGCGAACTCACCGGTGCCGAGAGCCACGACGTGGCCCTGGTCATGGGCTCCGGCTGGGCCCCGGCCGCCGAGGCCCTGGGCGCGCCCGAGCACGAGTTCCCCGTCACCGAGCTGCCCGGCTTCCCGGCGCCGGCCGTCGCCGGCCACGGCGGCAAGGTCCGCTCGTACCGGATCGGCGAGAAGCGCGCCCTGGTCTTCCTGGGCCGCACCCACTACTACGAGGGCCGCGGCGTCGCCTCGGTCTCGCACGGCGTGCGCACCGCCGTCGCCGCCGGCTGCAAGACCGTGGTGCTCACCAACGGCTGCGGCGGCCTGCGCGACGGCATGCGCCCCGGCCAGCCGGTGCTCATCAGCGACCACCTCAACCTCACCGCCACCTCCCCCATCGTCGGCGCCAACTTCGTCGACCTGACCGACCTGTACTCGCCGCGGCTGCGCGCGCTGTGCAAGGAGGTCGACGCGACCCTGGAGGAGGGCGTCTACGCCCAGCTCCCCGGCCCGCACTACGAGACCCCGGCCGAGATCCGGATGCTCCGCACCATGGGCGCCGACCTGGTCGGCATGTCCACCGTCCTGGAGGCGATCGCCGCCCGCGAGGCCGGCGCCGAGGTGCTGGGCCTGTCGCTGGTGACCAACCTCGCCGCCGGCATGACTGGCGAGCCGCTGAACCACGAGGAGGTGCTCCAGGCGGGCCGCGACTCCGCGATCGCGATGGGCACGCTGCTCGGCCAGGTCCTCAGCAAGATCTAG。

[0051] 2. Double digestion of plasmid

[0052] The extracted plasmid was digested with two enzymes, namely FastDigest EcoRI (FD0274) and FastDigest NdeI (FD0584) from Thermo Scientific. The double digestion system was as follows: 1 μg of DNA; 2 μL of 10× Fast Digest Green Buffer; 1 μL of Fast Digest EcoRI (FD0274); 1 μL of Fast Digest NdeI (FD0584); nuclease-free water was added to make the total volume 20 μL. The reaction conditions were: 37 °C for 40 min. After digestion, gel electrophoresis was performed to confirm the digestion result, and then the digested fragment was recovered by gel extraction. The plasmid pLQ646 was digested with the restriction enzymes EcoRI and NdeI to linearize it, and the linearized fragment after double digestion was detected by agarose gel electrophoresis. The results were as Figure 2 shown. The size of the fragment was consistent with the expected value of 5934 bp.

[0053] The primers for amplifying the target fragment were:

[0054] PUNP1-L: tgaagaggtgacgtccatatgGTGAACGCATCTGTTACCCC, SEQ ID NO.4;

[0055] PUNP1-R: ctatgacatgattacgaattcCTAGATCTTGCTGAGGACCTGG, SEQ ID NO.5.

[0056] The PCR reaction system is shown in Table 1:

[0057] Table 1

[0058]

[0059] The PCR reaction conditions are shown in Table 2:

[0060] Table 2

[0061]

[0062] 3. Ligation of the linearized vector and the target gene, transformation, and verification of the recombinant vector

[0063] Purify the target fragment of the appropriate size and the linearized vector by gel extraction, and assemble them by Gbison Assembly at a vector-to-fragment molar ratio of 1:3 to construct the recombinant pLQ646-PUNP1 (995bp); transform it into Ecoli.DH5α competent cells by chemical transformation. Verify the transformed single colonies by colony or liquid PCR. The verification primers are:

[0064] 152-Long-F: gattaagttgggtaacgcca, SEQ ID NO.6;

[0065] 152-Long-R: ggacaggtatccggtaagcg, SEQ ID NO.7.

[0066] The PCR reaction system is shown in Table 3:

[0067] Table 3

[0068]

[0069] The PCR reaction conditions are shown in Table 4:

[0070] Table 4

[0071]

[0072] After identifying positive clones, send the PCR products to Sangon Biotech for sequencing. Compare the sequencing results with the constructed vector sequence. If the comparison results are consistent, it indicates that the overexpression vector construction is successful.

[0073] Extract the recombinant plasmid that has been successfully constructed and transformed into Ecoli.DH5α, and also transform it into Ecoli.ET12567 (PUZ8002) competent cells by chemical transformation. After picking 3-4 transformed single colonies and verifying them as positive clones by colony or liquid PCR, send the PCR products to Sangon Biotech for sequencing again. Similarly, compare the sequencing results with the constructed vector sequence. If the comparison results are consistent, it further indicates that the overexpression vector construction is successful and has been successfully transferred into Ecoli.ET12567 (PUZ8002).

[0074] Example 2 Conjugal transfer of PUNP1 overexpression strain and wild-type Streptomyces albidoflavus CK-15 strain

[0075] (1) Cultivation of Ecoli.ET12567 cells: Inoculate Escherichia coli ET12567 carrying the target plasmid into LB medium and culture it at 37°C the afternoon before the conjugal transfer experiment. When the OD 600 reaches 0.4 - 0.6, the conjugal transfer experiment can be carried out.

[0076] (2) Cultivation of Streptomyces CK-15 spores: Coat CK-15 spores on SFM solid medium and culture at 30 °C for 3 - 5 days. At this time, the solid medium is covered with grayish-black spores. Collect the spores with a cotton swab into TES buffer solution and directly carry out conjugation transfer; or collect the spores with a cotton swab into 20% glycerol and store them in a -80 °C refrigerator for a long time.

[0077] (3) Cleaning of E. coli ET12567 cells: Add 1 mL of LB medium to each EP tube, pipette and mix well, then centrifuge at 12000 rpm for 1 min to collect the cells; repeat this operation 3 times, and then add 100 μL of medium for thawing in a 10-fold concentrated manner, pipette and mix well.

[0078] (4) Cleaning of Streptomyces spores: Take an appropriate amount of Streptomyces spores and wash them with 1 mL of TES buffer solution, pipette and mix well, then centrifuge at 12000 rpm for 1 min; repeat this operation twice, then wash with 1 mL of TES buffer solution, pipette and mix well, and centrifuge at 12000 rpm for 1 min; after washing the spores twice, thaw them with 500 μL of TES, pipette and mix well.

[0079] (5) After heat shock of Streptomyces spores in a 50 °C water bath for 10 min, add 2×spore pre-germination solution (10 g / L yeast extract; 10 g / L casein hydrolysate; add H2O to 1 L) and 20 μL of 0.5 M calcium chloride and mix well.

[0080] (6) Mix the E. coli ET12567 cells and the heat-shocked spores evenly at a ratio of 10:1 and coat them on SFM solid medium supplemented with 10 mM Mg 2+ and dry them in a laminar flow hood. Then place the plate in a 30 °C incubator and culture for 16 h.

[0081] (7) After 16 h, cover with antibiotics. Each plate needs to be evenly covered with 1.5 mL of ddH2O + 40 μL of Apramycin + 40 μL of Nalidixic acid, dry it in a laminar flow hood, and place it in a 30 °C incubator. After culturing for 3 - 5 days, zygotes usually grow out.

[0082] (8) Pick the zygotes and streak them on SFM solid medium supplemented with a final concentration of 0.1% Apramycin and 0.1% Nalidixic acid and culture for 2 - 3 days.

[0083] (9) After the mycelia grow, transfer them to a seed medium without antibiotics and culture at 30 °C for 2 - 3 days. After the mycelia grow, carry out PCR verification. The verification primers are:

[0084] 152-Long-F: gattaagttgggtaacgcca, SEQ ID NO.8;

[0085] 152-Long-R: ggacaggtatccggtaagcg, SEQ ID NO.9.

[0086] The PCR reaction system is shown in Table 5:

[0087] Table 5

[0088]

[0089] The PCR reaction conditions are shown in Table 6:

[0090] Table 6

[0091]

[0092] (10) For the zygotes with correct PCR verification, after spreading on the SFM antibiotic-free solid medium from the seed medium and culturing until sporulation, the spores were collected and stored at a final concentration of 20% and frozen at -80 °C in the refrigerator.

[0093] Example 3 Screening and verification of PUNP1 overexpression strains

[0094] The recombinant plasmid successfully constructed and transformed into Ecoli.ET12567 (PUZ8002) was introduced into the wild-type Streptomyces albus CK-15 by the method of conjugation transfer. The single colonies grown on the plate after removing the antibiotics were extracted and cultured on the resistance plate containing nalidixic acid and apramycin sulfate to remove Escherichia coli. Then, an appropriate amount of mycelium was picked and cultured in the seed medium containing apramycin sulfate for one generation. PCR verification was carried out using 152-Long-F / 152-Long-R (152-Long-F: GATTAAGTTGGGTAACGCCA (SEQ ID NO.10) / 152-Long-R: GGACAGGTATCCGGTAAGCG, (SEQ IDNO.11), 908bp), and the PCR products were detected by agarose gel electrophoresis.

[0095] The results are as Figure 3 shown. The PUNP1 overexpression strain can amplify a band consistent with the size of the target fragment, indicating that the overexpression Streptomyces strain was successfully constructed.

[0096] The PUNP1 overexpression strain is named Streptomyces noursei PUNP1, which was deposited in the China General Microbiological Culture Collection Center on April 1, 2025. The deposit number is CGMCC No. 34068, and the deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0097] Example 4 Observation on the growth phenotype of the PUNP1 overexpression strain

[0098] The wild-type Streptomyces albulus CK-15 and the PUNP1 overexpression strain (OE PUNP1) were cultured on SFM plates for 4 days, and then the growth of the strains was observed. The results are as Figure 4 shown. The results indicate that the spore production rate of the PUNP1 overexpression strain is significantly faster than that of the wild-type Streptomyces albulus CK-15. Therefore, the overexpression strain PUNP1 can accelerate the spore production rate of the strain.

[0099] Example 5 Detection of the yield of gougerotin in the PUNP1 overexpression strain

[0100] Prepare the soybean cake powder medium (SFM): Weigh 20 g of soybean cake powder, add it to 800 - 900 mL of distilled water and mix well. Sterilize at 121 °C for 20 min. Take the supernatant and filter it with gauze. Then add 20 g of mannitol to the supernatant, and make up to 1 L with distilled water. Mix well and dispense into 4 500-mL Erlenmeyer flasks, and add 4 - 4.5 g of agar powder to each flask. Sterilize at 121 °C for 20 min.

[0101] Prepare the seed medium (g / L): Weigh 20 g of glucose, 6 g of peptone, 6 g of yeast powder, and 10 g of sodium chloride, dissolve them in 1 L of distilled water, and adjust the pH to 7.2 - 7.4.

[0102] Prepare the gougerotin fermentation medium (g / L): Weigh 30 g of corn flour, 20 g of soybean cake powder, 20 g of glucose, 4 g of ammonium sulfate, and 3 g of calcium carbonate, dissolve them in 1 L of distilled water.

[0103] The PUNP1 overexpression strain was cultured on SFM plates, and the spores were collected and stored in glycerol with a final concentration of 20%. Three mutant strains of each PUNP1 overexpression strain were stored. At OD 600The OD values of spores of wild Streptomyces albidoflavus and PUNP1 overexpression strains were detected using a microplate reader at a specific wavelength, and the spore suspensions of all strains were adjusted to the same concentration. After mixing the adjusted spore suspensions of three mutant strains of the overexpression strain of the same gene, 50 μL was evenly spread on an SFM plate and cultured in an incubator at 30 °C for 2 days, then inoculated into a seed medium and cultured on a shaker at 30 °C and 220 rpm for 24 h. It was transferred to 50 mL of freshly prepared Gusbericin fermentation medium for fermentation at an inoculation amount of 10%, and the fermentation conditions were: 30 °C, 220 rpm for 72 h.

[0104] Take 1 mL of the fermentation broth, centrifuge at 4 °C and 4000 rpm for 10 min, dilute the supernatant 10-fold with ddH2O, and filter it through a 0.22 μm aqueous filter membrane for LC-MS analysis. The instrument used for LC-MS was the Agilent series Ultivo triple quadrupole liquid chromatography-mass spectrometry system (LC / TQ). Waters Amide chromatographic column (ACQUITY UPLC BEH Amide Column, 130 Å, 1.7 µm, 2.1 mm × 100 mm, 1 / pk) and guard column (ACQUITY UPLC BEH Amide VanGuard Pre-column, 130 Å, 1.7 µm, 2.1 mm × 5 mm, 3 / pk) were used. Mobile phase A (aqueous phase) was 5 mM ammonium acetate in water, B phase was acetonitrile, the flow rate was 0.3 mL / min, the detection time for each sample was 17 min, and the injection volume was 1.00 μL. The detection conditions are shown in Table 7 - Table 9.

[0105] Table 7 Time Schedule

[0106]

[0107] Table 8 Flushing Method for ACQUITY UPLC BEH Amide Column

[0108]

[0109] Table 9 MRM Conditions

[0110]

[0111] Quantitative detection of gusbericin in the fermentation broth of wild-type Streptomyces albidoflavus CK-15 and PUNP1 overexpression strains was carried out using LC-MS. The results are as Figure 5 shown in Table 10. The results showed that the yield of gusbericin in the PUNP1 overexpression strain was increased by 238% compared with that of the wild-type Streptomyces albidoflavus CK-15, reaching 2.56 g / L.

[0112] Table 10 LC-MS detection results of overexpression strains

[0113]

[0114] Example 6 Detection of mycelial growth of PUNP1 overexpression strain

[0115] The mycelial growth of the overexpression strain was measured by the dry mycelium weight method. Take a clean and dry 1.5 mL EP tube, weigh it on an analytical balance and make a mark. Take 1 mL of the fermentation broth into the EP tube. After centrifuging at 12000 rpm for 2 min, carefully pipette and remove all the supernatant. Then dry it in an oven at 65 °C for 5 d and weigh the EP tube. The difference between the two weights is the dry weight of the mycelium.

[0116] During the fermentation of gougerotin by wild-type Streptomyces albidoflavus CK-15 and the PUNP1 overexpression strain, the fermentation broth at different fermentation time periods was taken to measure the dry weight of the mycelium. As Figure 6 shown, the results show that 0-12 h is the exponential phase. During the exponential phase, the growth rate of the overexpression strain is higher than that of wild-type Streptomyces albidoflavus CK-15. The growth rate of the PUNP1 overexpression strain is faster than that of wild-type Streptomyces albidoflavus CK-15. Both wild-type Streptomyces albidoflavus CK-15 and the PUNP1 overexpression strain reach the highest biomass at 12 h of fermentation; after 12 h, the growth of the cells of the PUNP1 overexpression strain and wild-type Streptomyces albidoflavus CK-15 transfers from the exponential phase to the stationary phase; at 48 h-196 h, the dry weight of the mycelium of the PUNP1 overexpression strain decreases the fastest, and the change in the dry weight of the mycelium of wild-type Streptomyces albidoflavus CK-15 tends to be stable. This indicates that although the cells are growing, the metabolic activity may be affected by the large synthesis of secondary metabolites, consuming the dry matter accumulated by the mycelial growth, thus causing the dry weight of the mycelium to decrease.

[0117] Example 7 Detection of antibacterial activity of the fermentation broth of the PUNP1 overexpression strain

[0118] The antibacterial activity of the fermentation broth of wild-type Streptomyces albidoflavus CK-15 and the PUNP1 overexpression strain was determined by the cylinder-plate method using Rhodotorula as the indicator bacterium. Take 30-50 μL of each of the above two Streptomyces strains stored in 20% glycerol tubes and spread them on SFM plates respectively, and place them in a biochemical incubator at 30 °C for 2 d. Cut 1 cm 2Square pieces were placed in 30 mL of seed medium and cultured at 30 °C and 220 rpm for 24 h to obtain the seed liquid. The seed liquid was inoculated into 50 mL of freshly prepared fermentation medium at an inoculation amount of 10% and cultured at 30 °C and 220 rpm for 72 h. After the culture was completed, 1 mL of the fermentation broth was centrifuged at 12,000 rpm for 1 min, and the supernatant was aspirated with a 1 mL syringe and filtered through a 0.22 μm aqueous filter membrane into a sterile 1.5 mL EP tube. 1 mL of Rhodotorula liquid with an OD value of 1.2 was added to the PDA medium. After mixing, 20 mL of PDA medium containing Rhodotorula was added to each plate. A sterilized Oxford cup was placed on the plate with sterile forceps, and 200 μL of the filtered fermentation broth was aspirated into the Oxford cup. Four replicates were set for each treatment, and the diameter of the inhibition zone was observed and measured after culturing at 30 °C for 48 h.

[0119] Rhodotorula was used as an indicator to measure the inhibition zone of gougerotin. The antibacterial activity of the PUNP1 overexpressing strain against Rhodotorula was determined. Five replicates were set for each treatment. The inhibition zone of the PUNP1 overexpressing strain against the Rhodotorula indicator was significantly larger than that of the wild-type Streptomyces albidus CK-15. Therefore, as Figure 7 shown, the results indicated that the PUNP1 overexpressing strain significantly increased the production of the antibacterial active substance gougerotin compared with the wild-type Streptomyces albidus CK-15.

[0120] Example 8 50 L fermentation test of PUNP1 overexpressing strain

[0121] 1. Detection of the cell concentration, residual sugar, and ammonia nitrogen content of the overexpressing strain in a 50 L fermenter

[0122] (1) Activation of the fermentation strain in an eggplant bottle

[0123] Prepare MS medium: 20 g of soybean cake powder was put into distilled water and boiled for 30 min, filtered through four layers of gauze, and made up to 1000 mL. Each 100 mL was dispensed into a 250 mL Erlenmeyer flask containing 2.0 g of mannitol and 1.7 g of agar powder, and sterilized at 121 °C by high-temperature and high-pressure steam for 30 min. The culture conditions for the spores in the eggplant bottle were 28 - 30 °C for 6 - 8 days.

[0124] (2) Subculture

[0125] Seed medium (M3G): glucose 50 g / L, yeast powder 5 g / L, ammonium sulfate 10 g / L, magnesium sulfate 0.5 g / L, dipotassium hydrogen phosphate 0.8 g / L, potassium dihydrogen phosphate 1.36 g / L, ferrous sulfate 0.03 g / L, zinc sulfate 0.04 g / L, adjusted to pH 7 with NaOH. The culture temperature was 30 °C, the rotation speed was 180 rpm, the fermentation culture period was 31 h, and the pH was 4.0. The inoculation amount was 8 - 10%.

[0126] Fermentation medium (M3G): Glucose 50 g / L, fish meal 5 g / L, ammonium sulfate 10 g / L, magnesium sulfate 0.5 g / L, dipotassium hydrogen phosphate 0.2 g / L, potassium dihydrogen phosphate 0.34 g / L, ferrous sulfate 0.03 g / L, zinc sulfate 0.04 g / L. Adjust the pH to 7 with NaOH.

[0127] Fermentation parameters: Before inoculation, perform tank disinfection at a temperature of 121 °C for 30 min. After cooling to about 30 °C, first adjust the pH of the fermentation medium to 7.0 with ammonia water, then inoculate. Maintain the tank temperature at 30 °C and the tank pressure at 0.05 MPa. Control the fermentation process by continuous feeding. After inoculation, adjust the pH to 6.8. Start feeding ammonia water when the pH drops to 6.0. During the fermentation process, use ammonia water as the alkali solution to dynamically control the pH of the fermentation broth to 6.0. Maintain the ventilation rate at 1 vvm (0.7 m 3 / h), stir at 25 HZ (300 revolutions), and make the dissolved oxygen between 10% - 30% through the coupling of rotation speed and dissolved oxygen.

[0128] Glucose (7.5 kg required): Start feeding supplementary glucose when the residual sugar drops to 0.5%. Control the residual sugar in the fermentation process at 5 - 8 g / L with pre-sterilized 60% glucose solution. Control the NH4 + -N concentration in the fermentation broth at 0.5 - 1.0 g / L with pre-sterilized 40% ammonium sulfate solution. Ammonium sulfate 1.1 kg required: Start supplementing ammonium sulfate when the ammonia nitrogen concentration drops to 500 mg / L. Control the ammonia nitrogen in the fermentation process at 0.5 - 1.0 g / L with pre-sterilized 40% ammonium sulfate solution.

[0129] After disinfection and inoculation, take biochemical samples every 8 h to measure pH, bacterial concentration, residual sugar, ammonia nitrogen, and make slides. Take samples to measure residual sugar and ammonia nitrogen at any time according to the actual situation. Start measuring the titer at 96 h, and the cycle is 120 - 170 h.

[0130] Take samples every 4 h during the fermentation process to measure the bacterial concentration, residual sugar, and ammonia nitrogen content of the fermentation broth. Start supplementing glucose at 33 h of fermentation and start supplementing ammonium sulfate at 94 h of fermentation. The results are as Figure 8 shown. Figure 8 In it, the bacterial concentration of strain A shows a linear increase from 8 - 32 h. The strain shows explosive growth during this stage. The growth of the strain remains stable from 32 - 100 h, and the growth of the strain starts to show a downward trend from 100 - 120 h. Figure 8 In B - C, the corresponding changes in residual sugar and ammonia nitrogen show a negative correlation with the change in bacterial concentration.

[0131] The overexpressing strain of PUNP1 was used for the production of gougerotin in a 50L fermenter. The content of gougerotin in the fermentation broth from 96h to 120h was detected. The fermentation broth at different time points was collected and then centrifuged at 4000 rpm and 4°C for 5 minutes. The supernatant was taken and diluted 40-fold, and then detected by HPLC. The results are as Figure 9 shown. The results showed that gougerotin eluted at 7.936 minutes, indicating that the content of gougerotin in the fermentation broth was the highest at 120h, and the yield reached 3.74 g / L.

[0132] The embodiments described above are only for describing the preferred mode of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solution of the present invention should fall within the protection scope determined by the claims of the present invention.

Claims

1. A Streptomyces noursei PUNP1, characterized in that, The preservation number of Streptomyces nogalater PUNP1 is CGMCC No. 34068.

2. The construction method of Streptomyces nogalater PUNP1 according to claim 1, characterized in that, It includes the step of overexpressing the PUNP1 gene in Streptomyces albidus. The nucleotide sequence of the PUNP1 gene is shown as SEQ ID NO: 1, and the preservation number of the Streptomyces albidus is CGMCC No. 31251.

3. The application of Streptomyces nogalater PUNP1 according to claim 1 in any of the following: (1) The application in the production of gougerotin; (2) The application in increasing the yield of gougerotin.

4. The application of Streptomyces nogalater PUNP1 according to claim 1 in any of the following; (1) The application in inhibiting yeast; (2) The application in preparing a yeast bacteriostatic agent.

5. A yeast bacteriostatic agent, characterized in that, It contains Streptomyces nogalater PUNP1 according to claim 1.

6. A method for increasing the yield of gougerotin, characterized in that, It includes fermenting Streptomyces nogalater PUNP1 according to claim 1 and separating and extracting gougerotin from the fermentation broth.

7. The method according to claim 6, wherein The fermentation medium is any one of the following: (1) It includes components with the following dosages: 30 g of corn flour, 20 g of soybean cake powder, 20 g of glucose, 4 g of ammonium sulfate, 3 g of calcium carbonate, and 1 L of distilled water; (2) It includes components with the following concentrations: 50 g / L of glucose, 5.3 g / L of fish meal, 10 g / L of ammonium sulfate, 0.5 g / L of magnesium sulfate, 0.25 g / L of dipotassium hydrogen phosphate, 0.4 g / L of potassium dihydrogen phosphate, 0.03 g / L of ferrous sulfate, and 0.04 g / L of zinc sulfate, with a pH of 7.

8. The method according to claim 7, characterized in that, Perform shake flask fermentation culture using the fermentation medium shown in (1), with a culture temperature of 25 - 30 °C, a rotation speed of 200 - 300 rpm, and a culture time of 70 - 80 h.

9. The method according to claim 7, wherein Perform fermenter fermentation culture using the fermentation medium shown in (2). The tank temperature for fermenter fermentation culture is 28 - 30 °C, the tank pressure is 0.03 - 0.05 MPa, and the culture time is 120 - 170 h.

10. The method according to claim 9, wherein During the fermenter fermentation culture process, continuous feeding is carried out. The feeding parameters include: adjusting the pH value to 6.8 after inoculation, adding ammonia water when the pH value drops to 6.0, and controlling the pH of the fermentation broth to 6.0; starting to add sugar when the residual sugar content drops to 0.5%, and controlling the residual sugar content in the fermentation broth to 0.5% - 0.8%; starting to add ammonium sulfate when the ammonia nitrogen concentration is lower than 500 mg / L, and controlling the ammonia nitrogen concentration in the fermentation broth to 0.5 - 1.0 g / L.

Citation Information

Patent Citations

  • A mutant strain of Streptomyces parvum and its application in producing glutathione

    CN118995513B

  • Streptomyces albidus mutant strain, construction method and application

    CN118995552A

  • Streptomyces noursei NK27 for producing glutathione and application of streptomyces noursei NK27 in prevention and treatment of plant diseases

    CN117247872A

  • Streptomyces noursei and application thereof

    CN118256374A

  • Streptomyces albidoflavus mutant strain and application thereof in production of gougerotin

    CN118995513A