Application of Streptomyces noursei PUNP1 in production of gougerotin
By overexpressing the PUNP1 gene in Streptomyces leucovorum to construct a PUNP1 mutant strain of Streptomyces northerneri, the purine metabolism pathway was optimized, solving the problems of insufficient glutenin production and antibacterial effect, and achieving high-efficiency production and significantly improved antibacterial activity.
Patent Information
- Application Number
- CN202510787889.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-13
- Publication Date
- 2026-01-02
- Estimated Expiration
- 2045-06-13
AI Technical Summary
In the existing technology, glutamine has weak antibacterial efficacy and certain mammalian toxicity, which limits its application. Furthermore, there are no reports of using PUNP1 to modify Streptomyces, resulting in insufficient yield and antibacterial effect.
By overexpressing the PUNP1 gene in Streptomyces leucovorum, a PUNP1 mutant strain of Streptomyces northerly was constructed. This optimized the purine metabolism pathway, accelerated adenosine decomposition and nucleotide recovery, promoted the efficient synthesis of oryzanol, and improved yield through optimized fermentation culture conditions.
It significantly increased the content of oryzanol in fermentation products, enhanced the antibacterial effect, especially significantly enhanced the antibacterial ability against red yeast, and improved the metabolic efficiency and cell resistance of the cells.
Smart Images

Figure CN120330118B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to the application of a strain of Streptomyces Norrers PUNP1 in the production of oryzanol. Background Technology
[0002] Gougerotin is a water-soluble basic nucleoside antibiotic, first isolated from Streptomyces oryzae. It possesses broad-spectrum antibacterial, antitumor, antiviral, and antifungal activities, but its antibacterial efficacy is relatively weak and it exhibits some mammalian toxicity (mouse LD50). 50 Its application is limited due to its concentration of approximately 57 mg / kg. 13 C10 NMR and total synthesis confirmed that the chemical structure of oryzanol consists of a nucleoside and a peptide moiety. Biosynthesis is controlled by a gene cluster of approximately 28.7 kb and 15 genes, including 13 enzyme-encoding genes, one regulatory factor (gouR), and one secretory protein gene. The nucleoside moiety is formed by the coupling of cytosine and UDP-glucuronic acid to generate CGA, which is then modified into 4-amino-CGA by GouF, GouA, GouH, and GouB followed by amidation. The peptide moiety is mainly composed of D-serine and sarcosine, assembled through the synergistic action of GouK, GouJ, and GouN, with gouC and gouD being crucial for sarcosine residue modification. Oryzanol exerts its antibacterial and antitumor effects by competitively binding to ribosomal peptidyl transferases, interfering with peptide chain transfer, and blocking protein synthesis. To achieve large-scale production, strategies such as gene cluster engineering, precursor feeding (e.g., cytosine, serine, glycine addition), and promoter substitution were employed to obtain high-yielding strains in *Streptomyces graminearum*. Furthermore, the gouR mechanism was used to regulate and activate the transporter protein gouM, enabling efficient product secretion and reducing intracellular toxicity. In addition, the inventive team previously discovered that oryzanol is an important active ingredient produced by *Streptomyces calceolus* CK-15, effectively controlling plant fungal diseases such as tomato gray mold, tea leaf blight, corn sheath blight, soybean sclerotinia rot, and grape gray mold, demonstrating its potential for development into a novel agricultural antibiotic.
[0003] Purine-nucleoside phosphorylase (PUNP1) is a key enzyme in purine metabolism, catalyzing the reaction of adenosine and inorganic phosphate to generate nucleotides and nucleosides, reducing the dependence of cells on de novo purine synthesis. In addition, in Streptomyces calvu, the key gene nucPUNP1 and the downstream enzyme NucV are involved in the early reaction of nucleoside biosynthesis; in Streptomyces coelicolor, the multi-promoter regulation of the rpsO-PUNP1 operon not only affects the expression of PUNP1, but also regulates the RNA stability, thereby maintaining the balance of nucleotides. At the same time, PUNP1 plays a regulatory role in the biosynthesis of natural products of Streptomyces, and its function is also involved in the regulation of mRNA stability and poly(A) tail length, providing new insights into RNA processing mechanisms. Based on the important role of PUNP1 in Streptomyces, it is of great significance to explore its role in different Streptomyces strains, and currently there is no related report on the use of PUNP1 to modify Streptomyces CK-15. SUMMARY
[0004] The purpose of the present application is to provide an application of Streptomyces noursei PUNP1 in the production of calvulin, to solve the problems existing in the prior art. The mutant strain of Streptomyces noursei PUNP1 constructed by overexpressing PUNP1 in Streptomyces parvulus can significantly improve the content of calvulin in the fermentation product.
[0005] To achieve the above purpose, the present application provides the following scheme:
[0006] The present application provides a strain of Streptomyces noursei, the preservation number of the Streptomyces noursei PUNP1 is CGMCC No.34068, the preservation time is April 1, 2025, the preservation unit is China General Microbiological Culture Collection Center, and the preservation address is No.3, Beijing Chaoyang District, North Chenxi Road, Institute of Microbiology, Chinese Academy of Sciences.
[0007] The present application also provides a construction method of the Streptomyces noursei PUNP1, which comprises the step of overexpressing PUNP1 gene in Streptomyces parvulus, the nucleotide sequence of the PUNP1 gene is shown as SEQ ID NO:1, and the preservation number of the Streptomyces parvulus is CGMCC No.31251.
[0008] The present application also provides an application of the Streptomyces noursei PUNP1 in any of the following:
[0009] (1) the application in the production of calvulin;
[0010] (2) Application in improving the production of valinomycin.
[0011] The application further provides application of the Streptomyces noursei PUNP1 in any one of the following;
[0012] (1) Application in inhibiting yeast;
[0013] (2) Application in preparing a yeast bacteriostatic agent.
[0014] The application further provides a yeast bacteriostatic agent containing the Streptomyces noursei PUNP1.
[0015] The application further provides a method for improving the production of valinomycin, which comprises fermenting the Streptomyces noursei PUNP1 and separating and extracting valinomycin from the fermentation liquor.
[0016] Preferably, the fermentation medium is any one of the following:
[0017] (1) comprising the following components in the following amounts: corn flour 30 g, soybean cake powder 20 g, glucose 20 g, ammonium sulfate 4 g, calcium carbonate 3 g and distilled water 1 L;
[0018] (2) comprising the following components in the following concentrations: glucose 50 g / L, fish meal 5.3 g / L, ammonium sulfate 10 g / L, magnesium sulfate 0.5 g / L, dipotassium hydrogen phosphate 0.25 g / L, potassium dihydrogen phosphate 0.4 g / L, ferrous sulfate 0.03 g / L and zinc sulfate 0.04 g / L, and the pH is 7.
[0019] Preferably, the fermentation medium shown in (1) is used for shake flask fermentation culture, the culture temperature is 25-30 DEG C, the rotation speed is 200-300 rpm, and the culture time is 70-80 h.
[0020] Preferably, the fermentation medium shown in (2) is used for fermentation tank fermentation culture, the tank temperature of the fermentation tank fermentation culture is 28-30 DEG C, the tank pressure is 0.03-0.05 MPa, and the culture time is 120-170 h.
[0021] Preferably, feeding is continuously carried out during the fermentation tank fermentation culture, and the feeding parameters include: after inoculation, the pH value is adjusted to 6.8, ammonia water is added when the pH value is reduced to 6.0, ammonia water is used as lye to dynamically control the pH value of the fermentation liquor to be 6.0; when the residual sugar content is reduced to 0.5%, 60% glucose solution is used to control the residual sugar content in the fermentation liquor to be 0.5%-0.8%; when the ammonia nitrogen concentration is reduced to 500 mg / L, 40% ammonium sulfate solution is used to control the ammonia nitrogen concentration in the fermentation liquor to be 0.5-1.0 g / L.
[0022] The application discloses the following technical effects:
[0023] The present application takes Streptomyces albus CK-15 as the original starting strain, and obtains a PUNP1 overexpression strain, Streptomyces noursei PUNP1, by overexpressing the PUNP1 gene. The present application can optimize the purine salvage synthesis pathway in the starting strain by overexpressing the PUNP1 gene, accelerate the decomposition of adenosine and the recovery of nucleotides, ensure the sufficiency of intracellular nucleotides, thereby promoting the efficient synthesis of DNA, RNA and the natural product valin, and improving the RNA stability and reducing the risk of mRNA degradation under environmental stress. It is proved by experiments that the content of valin in the fermentation product of Streptomyces noursei PUNP1 after shake flask fermentation and fermentation tank fermentation can be as high as 2.56 g / L and 3.74 g / L, respectively, which significantly improves the content of valin in the fermentation product. It is also found that the ability of valin produced by Streptomyces noursei PUNP1 to inhibit Rhodotorula is significantly higher than that of the wild type strain, which indicates that Streptomyces noursei PUNP1 can significantly improve the production of valin in the fermentation product. The present application overexpresses the PUNP1 gene in Streptomyces albus CK-15, which is of great significance to improve the metabolic efficiency of the cell, the yield of natural products and the cell resistance. BRIEF DESCRIPTION OF DRAWINGS
[0024] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed in the embodiments. Obviously, the drawings described below only show some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative effort on the basis of these drawings.
[0025] Figure 1 PUNP1 target fragment amplification map; M: DL5000 marker; 1-2: PUNP1 amplification product;
[0026] Figure 2 pLQ646 plasmid double digestion map; M1: DL5000 marker; M2: DL15000 marker; 1-5: linearized vector; 6: pLQ646 plasmid;
[0027] Figure 3 PUNP1 overexpression streptomyces verification map; M: DL5000 marker; 1-3: PUNP1 overexpression strain; 4: wild type Streptomyces albus CK-15;
[0028] Figure 4 Growth phenotype of PUNP1 overexpression strain;
[0029] Figure 5The results of the determination of the yield of the Gliotoxin synthesized by the PUNP1 overexpression strain; A: LC-MS detection results of the Gliotoxin synthesized by the PUNP1 overexpression strain; B: determination results of the yield of the Gliotoxin synthesized by the PUNP1 overexpression strain; the standard error (SEM) concentration and the standard error bar thereof are shown in the figure (n = 3, three biologically independent samples);
[0030] Figure 6 The mycelium dry weight change curve of the PUNP1 overexpression strain fermented for different time periods;
[0031] Figure 7 The determination results of the antibacterial activity of the fermentation broth of the PUNP1 overexpression strain on the Rhodotorula;
[0032] Figure 8 The detection results of the mycelium concentration (A), residual sugar (B) and ammonia nitrogen content (C) in the fermentation process of the PUNP1 overexpression strain;
[0033] Figure 9 The HPLC detection results of the Gliotoxin in the fermentation process of the PUNP1 overexpression strain. DETAILED DESCRIPTION
[0034] The various illustrative embodiments of the present application will now be described in detail below, which should not be considered as limiting the present application, but should be understood as a more detailed description of certain aspects, characteristics and embodiments of the present application.
[0035] It should be understood that the terms described in the present application are only for describing the specific embodiments, and are not used to limit the present application. In addition, for the numerical range in the present application, it should be understood that each intermediate value between the upper limit and the lower limit of the range is also specifically disclosed. Each smaller range between any stated value or intermediate value within the stated range, and any other stated value or intermediate value within the stated range, is also included in the present application. The upper limit and the lower limit of these smaller ranges can be independently included or excluded from the range.
[0036] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application pertains. Although preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials in connection with which the documents are cited. In the case of conflict between any document incorporated by reference and the present specification, the present specification will control.
[0037] Many modifications and variations to the illustrative embodiments described herein will be apparent to those of ordinary skill in the art from the foregoing description. Such variations may be made by those skilled in the art in light of the foregoing description. The embodiments described herein are to be considered in all respects as illustrative only and not restrictive in any manner.
[0038] As used herein, the terms “comprises,” “comprising,” “includes,” “including,” “has,” “having” or any other variation thereof, are intended to cover a non-exclusive inclusion. Terms not described herein have their ordinary meaning.
[0039] The Streptomyces albulus CK-15 involved in the embodiments of the present application was preserved in the China General Microbiological Culture Collection Center on July 10, 2024, at the address of No. 1, Beichen West Road, Haidian District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with the preservation number of CGMCC No. 31251. It has been disclosed in many patents, such as CN118995513B, a Streptomyces albulus mutant strain and its application in producing gougerotin, CN118995552A, a Streptomyces albulus mutant strain, construction method and application. In addition, after the whole genome of the strain was sequenced, the strain was renamed and classified in NCBI in 2024, and the Streptomyces albulus CK-15 was classified as Streptomyces noursei strain CK-15 (Genebank accession number NZ_CP026094.1).
[0040] Some reagents of the embodiments of the present application: high-fidelity enzyme Phanta Max Super-Fidelity DNA Polymerase P505-d2 was purchased from Nanjing Novozyme Biotech Co., Ltd., DNA Maker DL5000 and DNA Maker DL15000 were purchased from TaKaRa Company, Japan.
[0041] Example 1 Construction of PUNP1 overexpression mutant strain
[0042] 1. Amplification of target fragment
[0043] According to the gougerotin gene cluster reported in Streptomyces notoensis in NCBI, the primer was designed after finding the target gene with high similarity in the Streptomyces albulus CK-15 strain genome using local BLAST, and the target fragment was amplified using the extracted Streptomyces genome.
[0044] Primer for fragment amplification:
[0045] PUNP1-L: 5'-TGAAGAGGTGACGTCCATATGGTGAACGCATCTGTTACCCC-3', SEQ ID NO. 2;
[0046] PUNP1-R: 5'-CTATGACATGATTACGAATTCCTAGATCTTGCTGAGGACCTGG-3', SEQ ID NO. 3.
[0047] PCR reaction system: ddH2O 13 μL, 2x PhantaMAX Buffer 25 μL, dNTPmix 1 μL, upstream primer 2 μL, downstream primer 2 μL, Phanta Max Super-Fidelity DNA Polymerase P505-d2 1 μL, DNA 1 μL and 50% DMSO 5 μL.
[0048] PCR reaction conditions: pre-denaturation: 95°C for 10 min; denaturation: 95°C for 30 sec, 31 cycles; annealing: 65°C for 30 sec, 31 cycles; extension: 72°C for 30-60 sec / kb, 31 cycles; complete extension: 72°C for 10 min.
[0049] The expression gene PUNP1 was subjected to PCR amplification, and the PCR product was subjected to electrophoresis detection in a 1% agarose gel, as shown in Figure 1 The electrophoresis detection result was consistent with the size of the target fragment, the size of the target fragment was 816 bp, and the gene sequence (SEQ ID NO. 1) was:
[0050] GTGAACGCATCTGTTACCCCCGACATCGACCCGAAGGGGGCCGCGGACGCCGCGGCCGCCCGCCTGCGCGAACTCACCGGTGCCGAGAGCCACGACGTGGCCCTGGTCATGGGCTCCGGCTGGGCCCCGGCCGCCGAGGCCCTGGGCGCGCCCGAGCACGAGTTCCCCGTCACCGAGCTGCCCGGCTTCCCGGCGCCGGCCGTCGCCGGCCACGGCGGCAAGGTCCGCTCGTACCGGATCGGCGAGAAGCGCGCCCTGGTCTTCCTGGGCCGCACCCACTACTACGAGGGCCGCGGCGTCGCCTCGGTCTCGCACGGCGTGCGCACCGCCGTCGCCGCCGGCTGCAAGACCGTGGTGCTCACCAACGGCTGCGGCGGCCTGCGCGACGGCATGCGCCCCGGCCAGCCGGTGCTCATCAGCGACCACCTCAACCTCACCGCCACCTCCCCCATCGTCGGCGCCAACTTCGTCGACCTGACCGACCTGTACTCGCCGCGGCTGCGCGCGCTGTGCAAGGAGGTCGACGCGACCCTGGAGGAGGGCGTCTACGCCCAGCTCCCCGGCCCGCACTACGAGACCCCGGCCGAGATCCGGATGCTCCGCACCATGGGCGCCGACCTGGTCGGCATGTCCACCGTCCTGGAGGCGATCGCCGCCCGCGAGGCCGGCGCCGAGGTGCTGGGCCTGTCGCTGGTGACCAACCTCGCCGCCGGCATGACTGGCGAGCCGCTGAACCACGAGGAGGTGCTCCAGGCGGGCCGCGACTCCGCGATCGCGATGGGCACGCTGCTCGGCCAGGTCCTCAGCAAGATCTAG.
[0051] 2. Plasmid double digestion
[0052] The extracted plasmid was double-digested with FastDigest EcoRI (FD0274) and FastDigest NdeI (FD0584) from Thermo Scientific. The double-digestion system was as follows: DNA 1 μg; 10x Fast Digest Green Buffer 2 μL; Fast Digest EcoRI (FD0274) 1 μL; Fast Digest NdeI (FD0584) 1 μL; Nuclease-free water to a total volume of 20 μL. The reaction conditions were 37°C for 40 min. After the enzyme digestion, the gel was run to confirm the enzyme digestion results, and the enzyme-digested fragments were recovered. The pLQ646 plasmid was linearized by double-digestion with restriction enzymes EcoRI and NdeI, and the linearized fragments after double-digestion were detected by agarose gel electrophoresis, as shown in FIG. 1. Figure 2 The size of the fragment shown in FIG. 1 was consistent with the expected size of 5934 bp.
[0053] The primers for amplifying the target fragment were as follows:
[0054] PUNP1-L: tgaagaggtgacgtccatatg GTGAACGCATCTGTTACCCC, SEQ ID NO. 4;
[0055] PUNP1-R: ctatgacatgattacgaattc CTAGATCTTGCTGAGGACCTGG, SEQ ID NO. 5.
[0056] The PCR reaction system is shown in Table 1.
[0057] Table 1
[0058]
[0059] The PCR reaction conditions are shown in Table 2.
[0060] Table 2
[0061]
[0062] 3. Linearization of the vector and ligation of the target gene, transformation, and verification of the recombinant vector
[0063] The target fragment of the right size was purified by gel recovery from the linearized vector, assembled by Gbison Assembly at a molar ratio of 1:3 of vector to fragment, to construct recombinant pLQ646-PUNP1 (995 bp); and transformed into E. coli. DH5α competent cells by chemical transformation. The transformed single colonies were verified by colony or broth PCR, and the verification primers were as follows:
[0064] 152-Long-F: gattaagttgggtaacgcca, SEQ ID NO. 6;
[0065] 152-Long-R: ggacaggtatccggtaagcg, SEQ ID NO. 7.
[0066] The PCR reaction system is shown in Table 3:
[0067] Table 3
[0068]
[0069] The PCR reaction conditions are shown in Table 4:
[0070] Table 4
[0071]
[0072] After the positive clones were obtained, the PCR products were sent to Shengong Biotechnology Company for sequencing. The sequencing results were compared with the sequence of the constructed vector. If the comparison results were consistent, it indicated that the overexpression vector was successfully constructed.
[0073] The recombinant plasmid successfully constructed and transformed into E. coli. DH5α was also transformed into E. coli. ET12567 (PUZ8002) competent cells by chemical transformation. After 3-4 transformed single colonies were obtained, colony or broth PCR was performed to obtain positive clones, and the PCR products were sent to Shengong Biotechnology Company for sequencing again. The sequencing results were compared with the sequence of the constructed vector. If the comparison results were consistent, it further indicated that the overexpression vector was successfully constructed and successfully transformed into E. coli. ET12567 (PUZ8002).
[0074] Example 2: PUNP1 overexpression strain and wild-type Streptomyces albus CK-15 strain conjugation transfer
[0075] (1) E. coli. ET12567 cell culture: the day before conjugation transfer, E. coli. ET12567 with the target plasmid was inoculated in LB medium and cultured at 37°C. When the OD 600 was 0.4-0.6, the conjugation transfer experiment was performed.
[0076] (2) Streptomyces CK-15 spore culture: CK-15 spores were spread on SFM solid medium and cultured at 30°C for 3-5 days. At this time, the solid medium was covered with gray-black spores. The spores were collected with a cotton swab in TES buffer solution for direct conjugation transfer, or collected in 20% glycerol and stored in a -80°C refrigerator for long-term preservation.
[0077] (3) E. coli. ET12567 cell washing: 1 mL of LB medium was added to each EP tube, and the mixture was mixed by pipetting and then centrifuged at 12000 rpm for 1 min to collect the cells. This operation was repeated 3 times, and then 100 uL of medium was added for re-melting in a 10-fold concentrated manner.
[0078] (4) Streptomyces spore washing: an appropriate amount of Streptomyces spores was washed with 1 mL of TES buffer solution, mixed by pipetting, and then centrifuged at 12000 rpm for 1 min. After repeating this operation twice, the spores were washed with 1 mL of TES buffer solution, mixed by pipetting, and then centrifuged at 12000 rpm for 1 min. After washing the spores twice, 500 uL of TES was added for re-melting, and the mixture was mixed by pipetting.
[0079] (5) After the Streptomyces spores were heat-shocked at 50°C for 10 min, 2x spore pre-germination solution (yeast extract 10 g / L; casein hydrolysate 10 g / L; H2O to 1 L) and 0.5M calcium chloride 20 uL were added and mixed.
[0080] (6) The E. coli. ET12567 cells and heat-shocked spores were mixed in a ratio of 10:1 and spread on SFM solid medium with the addition of 10 mM Mg 2+ , and then blown dry in a clean bench. The plates were placed in a 30°C incubator for 16 h.
[0081] (7) After 16 h, antibiotics were overlaid. Each plate needed to be evenly overlaid with 1.5 mL of ddH2O + 40 uL of Apramycin (sulfate) + 40 uL of Nalidixic acid. After blowing dry in a clean bench, the plates were placed in a 30°C incubator for 3-5 days to grow conjugants.
[0082] (8) The conjugants were picked and streaked on SFM solid medium with a final concentration of 0.1% Apramycin and 0.1% Nalidixic acid for 2-3 days.
[0083] (9) After the mycelium grew, it was transferred to antibiotic-free seed medium and cultured at 30°C for 2-3 days. After the mycelium grew, PCR verification was performed, and the verification primer was:
[0084] 152-Long-F: gattaagttgggtaacgcca, SEQ ID NO. 8;
[0085] 152-Long-R: ggacaggtatccggtaagcg, SEQ ID NO. 9.
[0086] The PCR reaction system is shown in Table 5:
[0087] Table 5
[0088]
[0089] The PCR reaction conditions are shown in Table 6:
[0090] Table 6
[0091]
[0092] (10) PCR verification of correct conjugants, after being cultured on SFM-antibiotic-free solid medium from the seed medium to produce spores, the spores were collected and stored in a final concentration of 20% and stored in a -80°C freezer.
[0093] Example 3 Screening and verification of PUNP1 overexpression strain
[0094] The recombinant plasmid successfully constructed and transformed into E. coli. ET12567 (PUZ8002) was introduced into wild-type S. albus CK-15 by conjugation transfer, and single colonies grown on antibiotic plates were extracted and cultured on resistance plates containing nalicin and apramycin sulfate to remove E. coli. Then, an appropriate amount of mycelium was inoculated in seed medium containing apramycin sulfate and cultured for one generation, and then PCR verification was performed using 152-Long-F / 152-Long-R (152-Long-F: GATTAAGTTGGGTAACGCCA (SEQ ID NO. 10) / 152-Long-R: GGACAGGTATCCGGTAAGCG, (SEQ ID NO. 11), 908 bp). The PCR product was detected by agarose gel electrophoresis.
[0095] The results are shown in Table 6: Figure 3 As shown in Table 6, the PUNP1 overexpression strain can amplify a band of the desired fragment size, indicating that the overexpression Streptomyces strain has been successfully constructed.
[0096] The PUNP1 overexpression strain is named Streptomyces noursei PUNP1, which has been preserved in the China General Microbiological Culture Collection Center on April 1, 2025, with a preservation number of CGMCC No. 34068 and a preservation address of No. 3, Yikuangli, Beichenxi Road, Chaoyang District, Beijing, China Institute of Microbiology.
[0097] Example 4: Observation of growth phenotype of PUNP1 overexpression strain
[0098] Wild-type S. albulus CK-15 and PUNP1 overexpression strain (OE PUNP1) were cultured on SFM plates for 4 days, and the growth of the strains was observed. As shown in Figure 4 the results showed that the sporulation rate of the PUNP1 overexpression strain was significantly faster than that of the wild-type S. albulus CK-15. Therefore, the overexpression strain PUNP1 can accelerate the sporulation rate of the strain.
[0099] Example 5: Detection of valin production by PUNP1 overexpression strain
[0100] Preparation of soybean meal medium (SFM): weigh 20 g of soybean meal, add 800-900 mL of distilled water, mix well, and sterilize at 121°C for 20 min. Take the supernatant and filter with gauze, then add 20 g of mannitol to the supernatant, and add distilled water to make up to 1 L. Mix well and divide into 4 500 mL triangular flasks, add 4-4.5 g of agar powder to each flask, sterilize at 121°C for 20 min.
[0101] Preparation of seed culture medium (g / L): weigh 20 g of glucose, 6 g of proteose peptone, 6 g of yeast powder, and 10 g of sodium chloride in 1 L of distilled water, and adjust the pH to 7.2-7.4.
[0102] Preparation of valin fermentation medium (g / L): weigh 30 g of corn flour, 20 g of soybean meal, 20 g of glucose, 4 g of ammonium sulfate, and 3 g of calcium carbonate in 1 L of distilled water.
[0103] The PUNP1 overexpression strain was cultured on SFM plates and the spores were collected and stored in glycerol with a final concentration of 20%. Three mutant strains were saved for each PUNP1 overexpression strain, and the OD 600The OD values of spores of wild type S. albus and PUNP1 overexpression strains were detected at 600 nm using a microplate reader. The spore solutions of all strains were adjusted to the same concentration. The adjusted spore solutions of three mutant strains of the same gene overexpression strain were mixed, and 50 μL was uniformly coated on an SFM plate and incubated in a 30°C incubator for 2 days, then inoculated in seed culture medium and cultured at 30°C, 220 rpm for 24 h. The fermentation was carried out by transferring 10% inoculum into 50 mL freshly prepared gentamicin fermentation medium, and the fermentation conditions were as follows: 30°C, 220 rpm for 72 h.
[0104] 1 mL of the fermentation broth was centrifuged at 4°C, 4000 rpm for 10 min, and the supernatant was diluted 10 times with ddH2O, then filtered with a 0.22 μm water phase filter for LC-MS analysis. The LC-MS instrument used was an Agilent Ultivo triple quadrupole liquid chromatography-mass spectrometry system (LC / TQ), using a Waters Amide chromatographic column (ACQUITY UPLC BEH Amide Column, 130 Å, 1.7 μm, 2.1 mm x 100 mm, 1 / pk), and a protective column (ACQUITY UPLC BEH Amide VanGuard Pre-column, 130 Å, 1.7 μm, 2.1 mm x 5 mm, 3 / pk). The mobile phase A (water phase) was 5 mM ammonium acetate water, and the B phase was acetonitrile, with a flow rate of 0.3 mL / min. The detection time for each sample was 17 min, and the injection volume was 1.00 μL. The detection conditions are shown in Tables 7-9.
[0105] Table 7 Time schedule
[0106]
[0107] Table 8 ACQUITY UPLC BEH Amide Column rinse method
[0108]
[0109] Table 9 MRM conditions
[0110]
[0111] The gentamicin in the fermentation broth of wild type S. albus CK-15 and PUNP1 overexpression strains was quantitatively detected by LC-MS. The results are shown in Figure 5 and Table 10, which showed that the yield of gentamicin in the PUNP1 overexpression strain was increased by 238% compared with the wild type S. albus CK-15, reaching 2.56 g / L.
[0112] Table 10 LC-MS Detection Results of Overexpression Strains
[0113]
[0114] Example 6: Detection of mycelial growth in PUNP1 overexpression strains
[0115] The mycelial growth of the overexpression strain was measured using the mycelial dry weight method. A clean, dry 1.5 mL EP tube was weighed on an analytical balance and labeled. 1 mL of fermentation broth was added to the EP tube, centrifuged at 12000 rpm for 2 min, and the supernatant was carefully removed using a pipette. The tube was then dried in a 65°C oven for 5 days, and the weight of the EP tube was recorded. The difference between the two weights was the dry weight of the mycelium.
[0116] During the fermentation of oryzanol by wild-type Streptomyces CK-15 and PUNP1 overexpression strains, the mycelial dry weight was determined by collecting fermentation broth at different fermentation time points. For example... Figure 6 As shown, the results indicate that the 0-12h period is the exponential phase, during which the growth rate of the overexpressing strain is higher than that of the wild-type *Streptomyces simonii* CK-15. The growth rate of the PUNP1 overexpressing strain is faster than that of the wild-type *Streptomyces simonii* CK-15. Both the wild-type *Streptomyces simonii* CK-15 and the PUNP1 overexpressing strain reach their maximum biomass at 12h of fermentation. After 12h, the cell growth of both the PUNP1 overexpressing strain and the wild-type *Streptomyces simonii* CK-15 transitions from the exponential phase to the stationary phase. From 48h to 196h, the mycelial dry weight of the PUNP1 overexpressing strain decreases the fastest, while the mycelial dry weight of the wild-type *Streptomyces simonii* CK-15 tends to stabilize. This suggests that although the cells grow, their metabolic activity may be affected by the large-scale synthesis of secondary metabolites, consuming the dry matter accumulated during mycelial growth, thus leading to a decrease in mycelial dry weight.
[0117] Example 7: Detection of antibacterial activity of PUNP1 overexpression strain fermentation broth
[0118] The antibacterial activity of fermentation broths of wild-type *Streptomyces chrysogenum* CK-15 and PUNP1 overexpression strains was determined using the tube-butterfly method with *Rhodotorula rubrum* as an indicator. 30-50 μL of each of the two *Streptomyces* strains, preserved in 20% glycerol tubes, were spread onto SFM plates and incubated at 30℃ for 2 days. A 1 cm section was then cut from each plate. 2The square piece of 1 mL was placed in 30 mL seed medium and cultured at 30°C, 220 rpm for 24 h to obtain the seed liquid. The seed liquid was inoculated into fresh 50 mL fermentation medium at a 10% inoculation amount and cultured at 30°C, 220 rpm for 72 h. After the culture ended, 1 mL of the fermentation liquid was centrifuged at 12000 rpm for 1 min, and the supernatant was then taken with a 1 mL syringe and filtered into a sterile 1.5 mL EP tube with a 0.22 μm water filter. 1 mL of the red yeast liquid with an OD value of 1.2 was added to the PDA medium, mixed well, and then 20 mL of the PDA medium containing the red yeast was added to each plate. The sterile Oxford cup was placed in the plate with sterile forceps, and 200 μL of the filtered fermentation liquid was taken into the Oxford cup. Four replicates were set for each treatment, and the plates were cultured at 30°C for 48 h before observation and measurement of the inhibition zone diameter.
[0119] The red yeast was used as an indicator to measure the inhibition zone of the valinomycin. The antibacterial activity of the PUNP1 overexpression strain on the red yeast was determined, and five replicates were set for each treatment. The inhibition zone of the PUNP1 overexpression strain on the red yeast indicator was significantly larger than that of the wild type S. albus CK-15. Therefore, as shown in Figure 7 the results showed that the PUNP1 overexpression strain significantly increased the production of the antibacterial active substance valinomycin compared with the wild type S. albus CK-15.
[0120] Example 8: 50L fermentation test of PUNP1 overexpression strain
[0121] 1. Detection of 50L fermenter bacterial concentration, residual sugar, and ammonia nitrogen content of overexpression strain
[0122] (1) Activation of fermentation seed in tomato bottle
[0123] Prepare MS medium: 20 g of soybean cake powder is boiled in distilled water for 30 min, filter with 4 layers of gauze, and then dilute to 1000 mL. Each 100 mL is transferred into a 250 mL triangular flask containing 2.0 g of mannitol and 1.7 g of agar powder, and sterilized at 121°C for 30 min. The spore culture conditions in the tomato bottle are 28-30°C, and the culture time is 6-8 days.
[0124] (2) Subculture
[0125] Seed medium (M3G): glucose 50 g / L, yeast powder 5 g / L, ammonium sulfate 10 g / L, magnesium sulfate 0.5 g / L, potassium hydrogen phosphate 0.8 g / L, potassium dihydrogen phosphate 1.36 g / L, ferrous sulfate 0.03 g / L, zinc sulfate 0.04 g / L, pH adjusted to 7 with NaOH. The culture temperature is 30°C, the rotation speed is 180 rpm, the fermentation culture period is 31 h, and the pH is 4.0. The inoculation amount is 8-10%.
[0126] Fermentation medium (M3G): glucose 50 g / L, fish meal 5 g / L, ammonium sulfate 10 g / L, magnesium sulfate 0.5 g / L, potassium phosphate dibasic 0.2 g / L, potassium phosphate monobasic 0.34 g / L, ferrous sulfate 0.03 g / L, zinc sulfate 0.04 g / L, pH 7 adjusted with NaOH.
[0127] Fermentation parameters: Before inoculation, sterilize the tank at 121°C for 30 min; reduce the temperature to about 30°C, adjust the pH of the fermentation medium to 7.0 with ammonia water, then inoculate, maintain the tank temperature at 30°C and the tank pressure at 0.05 MPa, and use continuous feeding to regulate the fermentation process, wherein the pH is adjusted to 6.8 after inoculation, ammonia water is started when the pH drops to 6.0, and ammonia water is used as the alkali to dynamically control the pH of the fermentation broth to 6.0 during the fermentation process; maintain the ventilation volume at 1 VVM (0.7 m 3 / h), and stir at 25 HZ (300 rpm) to maintain the dissolved oxygen between 10% and 30% by coupling the rotation speed with the dissolved oxygen.
[0128] Glucose (7.5 kg required): start feeding the sugar when the residual sugar drops to 0.5%, use pre-sterilized 60% glucose solution to control the residual sugar in the fermentation process to 5-8 g / L; use pre-sterilized 40% ammonium sulfate solution to control the NH + 4 concentration in the fermentation broth to 0.5-1.0 g / L; ammonium sulfate required 1.1 kg: start feeding ammonium sulfate when the ammonia nitrogen concentration drops to 500 mg / L, and use pre-sterilized 40% ammonium sulfate solution to control the ammonia nitrogen in the fermentation process to 0.5-1.0 g / L.
[0129] After sterilization and inoculation, take biochemical samples every 8 h to measure pH, bacterial concentration, residual sugar, ammonia nitrogen, and make a record, and take samples to measure the residual sugar and ammonia nitrogen at any time according to the actual situation. Measure the titer at 96 h, and the cycle is 120-170 h.
[0130] Take samples every 4 h during the fermentation process to measure the bacterial concentration, residual sugar, and ammonia nitrogen content of the fermentation broth. Start feeding sugar at 33 h, and start feeding ammonium sulfate at 94 h. The results are shown in Figure 8 , Figure 8 The bacterial concentration of medium A shows linear growth from 8 h to 32 h, the strain shows explosive growth during this stage, the strain growth remains stable from 32 h to 100 h, and the strain growth starts to show a downward trend from 100 h to 120 h. Figure 8 Mediums B-C show that the corresponding changes in residual sugar and ammonia nitrogen are negatively correlated with the change in bacterial concentration.
[0131] PUNP1 overexpression strain 50L fermentation tank production of valin, detection of 96h-120h fermentation broth valin content, collection of different time points of fermentation broth and then centrifuged at 4000 rpm 4℃ 5min, take the supernatant was diluted 40 times after using HPLC detection, results as shown in Figure 9 The results show that the valin peak at 7.936 min, indicating that the content of valin in the fermentation broth at 120h is the highest, the yield reaches 3.74g / L.
[0132] The above-described embodiments are only to describe the preferred modes of the present application, and not to limit the scope of the present application, without departing from the design spirit of the present application, the person skilled in the art makes various modifications and improvements to the technical solutions of the present application, which shall fall within the protection scope determined by the claims of the present application.
Claims
1. Application of Streptomyces pubescens PUNP1 in any of the following: (1) Application in the production of oryzanol; (2) Application in increasing the yield of oryzanol; The accession number of the Streptomyces pubescens PUNP1 is CGMCC No. 34068.
2. A method for increasing the yield of oryzanol, characterized in that, This includes fermenting Streptomyces PUNP1 from Norilsk and isolating and extracting oryzin from the fermentation broth; The accession number of the Streptomyces pubescens PUNP1 is CGMCC No. 34068.
3. The method as described in claim 2, characterized in that, The fermentation medium is any one of the following: (1) The following components are included in the following amounts: 30g corn flour, 20g soybean meal, 20g glucose, 4g ammonium sulfate, 3g calcium carbonate and 1L distilled water; (2) The components include the following concentrations: glucose 50 g / L, fish meal 5.3 g / L, ammonium sulfate 10 g / L, magnesium sulfate 0.5 g / L, dipotassium hydrogen phosphate 0.25 g / L, potassium dihydrogen phosphate 0.4 g / L, ferrous sulfate 0.03 g / L and zinc sulfate 0.04 g / L, with a pH of 7.
4. The method as described in claim 3, characterized in that, Shake flask fermentation was carried out using the fermentation medium shown in (1), with a culture temperature of 25-30℃, a rotation speed of 200-300rpm, and a culture time of 70-80h.
5. The method as described in claim 3, characterized in that, Fermentation culture was carried out in a fermenter using the fermentation medium shown in (2). The fermentation temperature in the fermenter was 28-30℃, the pressure was 0.03-0.05MPa, and the culture time was 120-170h.
6. The method as described in claim 5, characterized in that, During the fermentation process in the fermenter, continuous feeding was carried out. The feeding parameters included: adjusting the pH value to 6.8 after inoculation, adding ammonia water when the pH value dropped to 6.0, and controlling the pH of the fermentation broth to 6.0; starting sugar feeding when the residual sugar content dropped to 0.5%, and controlling the residual sugar content in the fermentation broth to 0.5%-0.8%; and starting ammonium sulfate feeding when the ammonia nitrogen concentration was below 500 mg / L, and controlling the ammonia nitrogen concentration in the fermentation broth to 0.5-1.0 g / L.
Citation Information
Patent Citations
A mutant strain of Streptomyces parvum and its application in producing glutathione
CN118995513B
Streptomyces albidus mutant strain, construction method and application
CN118995552A
Streptomyces albidoflavus mutant strain and application thereof in production of gougerotin
CN118995513A
Streptomyces noursei and application of streptomyces noursei in preparation of multimycotin B
CN119979411A